Involvement of Penicillium digitatum PdSUT1 in fungicide sensitivity and virulence during citrus fruit infection

Microbiological Research 203 (2017) 57–67

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Involvement of Penicillium digitatum PdSUT1 in fungicide sensitivity and virulence during citrus fruit infection Marta de Ramón-Carbonell, Paloma Sánchez-Torres

MARK

⁎

Instituto Valenciano de Investigaciones Agrarias (IVIA), Centro de Protección Vegetal y Biotecnología. Apartado Oficial, 46113-Moncada, Valencia, Spain

A R T I C L E I N F O

A B S T R A C T

Keywords: Fungicide resistance Host pathogen interaction Penicillium digitatum Sucrose transporter Virulence

A putative sucrose transporter PdSUT1 included in the same clade that Sut1p from Schizosaccharomyces pombe was identified in Penicillium digitatum, the major citrus postharvest pathogen. PdSUT1 gene was characterized using target gene disruption and gene overexpression. The ΔPdSUT1 mutants generated by gene elimination showed reduction in fungal virulence during citrus fruit infection assayed in mature fruit at 20 °C. However, the overexpression mutants did not increased disease severity neither in the mutants coming from a high virulent nor from a low virulent P. digitatum progenitor strains. Moreover, fungicide sensitivity was affected in the deletant mutants but not in the overexpression transformants. The expression analysis of several genes involved in fungicide resistance showed an intensification of MFS transporters and a decrease of sterol demethylases transcriptional abundance in the ΔPdSUT1 mutants compare to the parental wild type strain. PdSUT1 appear not to be directly involved in fungicide resistance although can affect the gene expression of fungicide related genes. These results indicate that PdSUT1 contribute to P. digitatum fungal virulence and influence fungicide sensitivity through carbohydrate uptake and MFS transporters gene activation.

1. Introduction Penicillium digitatum (Pers.,Fr.) Sacc., the causal agent of green mould decay, is a wound pathogen widespread and the most economically important postharvest pathogen of citrus in Mediterranean countries (Kanetis et al., 2008). Economical losses due to postharvest decays are very important worldwide and synthetic fungicides constitute the primary way to control these losses (Kinay et al., 2007). Public concern in food safety and the increase of pathogen resistant population has enhanced the attention in evolving alternatives to control postharvest fruit diseases. Currently two different approaches tend to be used to address this problem, first deepen in fungicide resistance mechanisms and second to focus on pathogen virulence. Many fungal transporters may play an important role in fungicide resistance because they promote the efflux of toxic compounds and might have relevance in virulence (de Waard et al., 2006). The most extensively studied fungal transporters comprise the ATP-binding cassette transporters (ABC) and the major facilitator superfamily transporters (MFS) (Sánchez-Torres and Tuset 2010; Wang et al., 2012; Wu et al., 2016). Both types of transporters could have broad spectrum of specificity, allowing the elimination of toxic products such as fungicides and elements of fruit defense response (de Waard et al., 2006).

⁎

In pathogenic fungus/plant interaction, most of the transport proteins identified so far are specific for monosaccharides (Hirose et al., 2010; Sauer, 2007; Schüβler et al., 2006; Sivitz et al., 2005; Voegele et al., 2001) and are involved in the uptake of glucose or fructose and, to a lesser extent, of other hexoses. But it remains unknown is if these transporters could act in combination with fungal and/or plant-derived cell wall invertases to provide the pathogen with the necessary carbon source resulting from extracellular sucrose hydrolysis (Wahl et al., 2010). Sugar transporters, particularly sucrose transporters, have been mainly studied in plants (Kuhn and Grof, 2010; Reinders et al., 2006; Weise et al., 2000). Plants can display mechanisms to sense changes in glucose concentrations and could react to these changes with the induction of defense responses. Since many plants are able to sense and destroy possible pathogens, the use of a sucrose transporter rather than of an invertase/hexose transporter, might represent an advantage to these pathogens (Wahl et al., 2010). Plant sucrose transporters (SUTs) are part of the major facilitator superfamily (MFS) since there are members of the glycoside-pentosidehexuronide (GPH) cation symporter family q) but are not closely related to hexose transporters in bacteria, fungi and animals (Reinders et al., 2001).

Corresponding author. Present Address: de Universidad Politécnica Valencia. Dpto. E46022, Valencia,Spain. E-mail address: [email protected] (P. Sánchez-Torres).

http://dx.doi.org/10.1016/j.micres.2017.06.008 Received 27 March 2017; Received in revised form 12 June 2017; Accepted 29 June 2017 Available online 10 July 2017 0944-5013/ © 2017 Elsevier GmbH. All rights reserved.

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

The first fungal homologue to plant sucrose transporters was identified from Schizosaccharomyces pombe, which transports mainly maltose, and, to a lesser extent, sucrose and other disaccharides (Reinders et al., 2001). Two biotrophic plant-interacting fungi monosaccharide transporters involved in the uptake of sugars from the host plant were also characterized. An Amanita muscaria monosaccharide transporter isolated using a targeted approach (Nehls et al., 1998) and a glucose transporter of Uromyces fabae that is expressed specifically in haustoria (Voegele et al., 2001). Another high affinity glucose transporter was reported in Trichoderma harzianum (Delgado-Jarana et al., 2003). Recently, it has been described an specific sucrose transporter (STR1) in the biotrophic fungus Ustilago maydis. The SRT1 gene is involved in virulence and is essential for pathogenesis since deletion mutants showed very little disease symptoms and STR1 gene complementation restored its virulence (Wahl et al., 2010). Finally, Trichoderma virens fungal sucrose transporter was characterized. This transporter exhibited biochemical properties similar to those described for sucrose symporters from plants (Vargas et al., 2011). Therefore, although many MFS transporters have been defined as specific sugar transporters (Saier, 2000), it is still unknown if an specific sugar transporter could play a relevant role in fungicide sensitivity and fungal infectivity. Consequently, in this work we aimed to identify and functionally characterize the first putative sucrose transporter from P. digitatum (PdSUT1) through gene elimination and gene overexpression to provide insight on the contribution of this sugar transporter in fungal virulence and the development of fungicide resistance.

Table 1 Oligo sequence used in this study.

2. Material and methods 2.1. Microorganisms, fruit and culture conditions The fungal isolates used in this study were Pd1 (CECT20795) (fungicide resistant) and Pd27 (fungicide sensitive), both virulent P. digitatum strains and Pd149 (CECT2954) (fungicide sensitive), a low virulence P. digitatum strain provided by the Spanish Type Culture Collection (CECT) (Sánchez-Torres and Tuset, 2010). Potato dextrose broth (PDB; Liofilchem Laboratories,) or potato dextrose agar (PDA; Liofilchem Laboratories) were used for fungal growth. Cultures were incubated at 24 °C with continuous light for 1, 2 or 3 days (liquid cultures) depending of the further use or up to 1 week in dark (solid media). Conidia were collected from 1-week-old PDA plates by scraping them with a sterile spatula, and transferring them to sterile water. Conidia were titrated with a hemacytometer and adjusted to a desire final concentration. For nutrients uptake evaluation, P. digitatum isolates were grown in minimal media (NaNO3 3 g/L, KCl 0.5 g/L, MgSO4·7H2O 0.5 g/L, FeSO4 .7H2O 0.01 g/L and K2H2PO4) amended with 1% of glucose, sucrose, maltose, lactose, citric acid or sorbitol as only carbon source. Escherichia coli DH5α was used for propagation material and plasmid storage. E. coli cultures were grown in LB plates or LB liquid media amended with 100 μg/mL of kanamycin at 37 °C. Agrobacterium tumefaciens C58C1 was used for P. digitatum transformation. A. tumefaciens harbouring plasmid constructs was cultured in LB plates or LB liquid medium with 50 μg/mL Rifampycin and 100 μg/ mL Kanamycin at 28 °C as described by de Ramón-Carbonell and Sánchez-Torres (2017). Mature oranges (Citrus sinensis L. Osbeck) from the cultivars ‘Navelina’,‘Navelate’ and ‘Valencia’ without any fungicide treatment were harvested from different orchards at IVIA in Moncada (Valencia, Spain) and then used throughout this study.

Name

Sequence (5′-3′)

SUT1 SUT2 SUT3 SUT4 SUT5 SUT6 SUT7 SUT8 SUT9 SUT10 SUT11 SUT12 SUT13 SUT14 SUT15 SUT16 HygRt HygFt HygR HygF hTubF hTubR qTubF qTubR q28SF q28SR qH3F qH3R qM1-F qM1-R qM2-F qM2-R qM3-F qM3-R qM4-F qM4-R qM5-F qM5-R qCYPA-F qCYPA-R qCYPB-F qCYPB-R

AGCCATTCCTTCTATCCCTCGG GCGAGTAGCATCTTCCC GGC ATCATCTCTGGTAAGTCACG CAGTGATGTTGAGCATGGAC TTGATAGTCGAAGGCGACGC GAATGATACAGAGCACGGTG GGTCTTAAUGTCTTCAGGGCGTATGTAT GGCATTAAUATCATCTCTGGTAAGTCACG GGACTTAAUCAGTGATGTTGAGCATGGAC GGGTTTAAUTTGATAGTCGAAGGCGACGC ACAGGTACAGCACAAGACCGAG GGGTTTAAUGTCTTCAGGGCGTATGTATG GGACTTAAUTTGATAGTCGAAGGCGACGC TCCAGGCAGCGATTCAGATG CAACTGGAGGTGCATCAAGC AGTGGATGAAGAGGAACTCCG ATCGAAGCTGAAAGCACGAG GGCAATTTCGATGATGCAGC AGCTGCGCCGATGGTTTCTACAA GCGCGTCTGCTGCTCCATACAA AGCGGTGACAAGTACGTTCC ACCCTTAGCCCAGTTGTTAC AGCGGTGACAAGTACGTTCC ACCCTTAGCCCAGTTGTTAC TTATAGCCGAGGGTGCAATG TTTCAAGACGGGTCGCTTAC AGGCTCCCCGTAAGCAGCTCGC CGACATGAGGCGGAACTTACCGG AGTTGCAGCTGCGTACGATG ACCAAATTGCCGAGACCACG ACTGCATGTCGGTGAGAAGC GTCGAGCAGTGTGGTCATGGC GCCACACAAATCGCGCAGTAC CACGATTCAACTCGAGATAAGCG TCTCAATGGTAGTCGCCTTC ACTGGTGAGCATGAAAAGAGC TGGATACGTTCAAGCAGCTG ATAGCGAGGTACAGCCGAG ATGTGCCCCTAATCGCCGACG CTGCGGTAAAGGTGGTTATCTC GCTGCACAGAAGAAGTTGAC CATTCTTGTACGTGCACGAC

to the procedures previously described by Marcet-Houben et al. (2012). All PCR DNA fragments obtained in this work were purified using Ultra Clean TM PCR Clean-up (MoBio, Solan Beach, USA) and then sequenced using the appropriate primers. DNA sequencing was performed using the fluorescent chain-terminating dideoxynucleotide method (Prober et al., 1987) and an ABI 377 sequencer (Applied Biosystems, Madrid, Spain). DNA sequences were compared with those from the EMBL database with the Washington University-Basic Local Alignment Search Tool (WU-BLAST) algorithm (Altschul et al., 1997). Total RNA was extracted from frozen mycelium of Penicillium digitatum by using Trizol (Ambion Inc., Austin, USA) following manufacturer’s recommendations. Total RNA during fruit infection was obtained from fruit peel discs as described previously (López-Pérez et al., 2014).

2.3. Isolation of PdSUT1 Two PCR primers, SUT-1 and SUT-2 (Table 1), based on partial nucleotide sequence of Penicillium digitatum SUT1, were used for the screening of the P. digitatum Pd1 genomic DNA library provided by Dr. González-Candelas (IATA-CSIC, Spain) (López-Pérez et al., 2014) The PCR reaction consisted of a first denaturation at 94 °C for 4 min, followed by 30 cycles at 94 °C for 30 s, 58 °C for 45 s and 72 °C for 60 s, a final elongation step was carried out at 72 °C for 10 min. The PCR amplicon was directly sequenced using the same primers used for PCR

2.2. Nucleic acids manipulations Genomic DNA was obtained from P. digitatum mycelium according 58

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

PCR System. The thermal profile used was, activation step (95 °C for 5 min), amplification step (45 cycles of 95 °C for 10 s, annealing temperature (Tan) 58 °C for 5 s, and 72 °C 10 s) melting curve program (95 °C for 5 s, 65 °C for1 min, and heat to 97 °C at 0.1 °C s−1 rate) and cooling step (40 °C for 10 s). Three biological replicates were conducted for each experiment, and PCR experiments were repeated at least twice. Oligos SUT14-SUT15 were used for the PdSUT1 gene, and genes coding for fungal β-tubulin (qTubF-qTubR), ribosomal protein 28S (q28SF-q28SR) and histone H3 (qH3F-qH3R) were simultaneously used as independent reference genes (Table 1). The quantification cycle point (Cq) was obtained using the software LightCycler 480 SW 1.5 (Roche Diagnostics). Specific amplification for each primer set was confirmed by determining the melting temperature (LightCycler 480SW1.5). The Relative Expression Software Tool (Multiple Condition Solver REST-MCS v2) (Pfaffl et al., 2002) was used to determine the relative quantification of target genes as normalized to the reference genes.

amplification. The library scrutiny was carried out as described before by de Ramón-Carbonell and Sánchez-Torres (2017). The protein domains of PdSUT1 were analysed using SMART (http,//smart.embl-heidelberg.de). The orthology sequences of SUTs from different fungi and plants were downloaded from GenBank (www. ncbi.nlm.nih.gov). Sequence protein alignments were performed using the Clustal W program, and the phylogenetic tree was constructed using the Mega 7.0 program with neighbor-joining method. 2.4. Construction of vectors and fungal transformation Gene elimination by homologous recombination and gene overexpression were done on binary plasmids, pRF-HU2 and pRF-HU, respectively (Frandsen et al., 2008). The design of the construct to obtain both ovexpresssion and disruption mutants was done as previously described by de Ramón-Carbonell and Sánchez-Torres (2017). The resulting plasmids were introduced into Escherichia coli DH5α chemical competent cells. Appropriate fusions were tested by DNA sequencing, and then the plasmids were transferred to A. tumefaciens C58C1 electrocompetent cells. Agrobacterium-mediated transformation of P. digitatum Pd1 was performed as described (Marcet-Houben et al., 2012). Transformants were selected on PDA plates containing 100 μg/ mL of hygromycin B. PCR of genomic DNA from each of monosporic isolate was used for both gene disruption and gene overexpression verification. Quantification of copy number was performed by real time quantitative PCR (qRT-PCR) using beta-tubulin as reference gene for either the absence of ectopic copies in gene elimination and for gene copy number in the case of the overexpression transformants (de Ramón-Carbonell and Sánchez-Torres, 2017).

3. Results 3.1. Cloning of PdSUT1 gene An 880 bp fragment was obtained by PCR using the primers SUT1 and SUT2 (Table 1). The deduced amino acid sequence of the fragment showed homology to GPH family sucrose/H+ symporter, fungal sucrose transporter genes. The genomic version was obtained using these two primers by screening a Pd1 P. digitatum genomic library (LópezPérez et al., 2014) as described in Materials and methods. PdSUT1 (P. digitatum SUT1 = PDIP_54000) sequence shows an open reading frame of 2117 bp disrupted by three introns of 94, 112, and 57 bp, placed at positions 1.167, 261.300, 412.733, 790.2117 of the coding region and is predicted to encode a protein of 618 amino acids. PdSUT1p presented typical DNA-binding motifs, including a domain with high similarity to MFS transporters. The domain exhibited a match with the consensus GPH family sucrose/H+ symporter existent in all sucrose transporters identified, when scanned against the Pfam protein families. Phylogenetic analysis indicated that PdSUT1p clusters within plant pathogenic fungi Penicillium italicum and Penicillium expansum, Colletotrichum gloeosporioides Aspergillus oryzae, Apergillus niger and Aspergillus terreus and the yeast Schizosaccharomyces pombe Sut1p. PdSUT1p was apart from the plant SUTs (Oryza sativa, Citrus sinensis, Malus domestica, Licopersicum esculentum, Arabidopsis thaliana, Glycine mays) and other fungal sugar transporters (Penicilium spp. Aspergillus spp., Ustilago spp., Amanita muscaria, Trichoderma harzianum, Uromyces fabae) clustered separately on the tree (Fig. 1A). Additionally, phylogenetic analysis of different P. digitatum transporters that belong to MFS family showed that PdSUT1 clustered close to a P. digitatum invertase as expected in different branch that most of MFS transporters and fructose transporter and it was apart from those that encode a glucose, lactose permease or alpha–glucoside on the other side (Fig. 1B)

2.5. Fungicide assessment A total of four fungicides, Imazalil (Textar I; Tecnidex), Prochloraz (Ascurit; Tecnidex), and Philabuster (Decco Ibérica) at concentrations of 0, 0.5, 1, 2, 4, 8, and 10 μg/mL and Thiabendazol (Textar 60 T; Tecnidex) at 0, 5, 10, 20, 40, 80 and 100 μg/mL were used to evaluate the different P. digitatum strains. Three replicates were prepared for each treatment. All transformants were tested regarding their ability to grow in the presence of different fungicide concentrations in 96-well microtiter plates and were compared with respective untransformed wild-type strain isolates assayed at the same time. The activity and efficacy of the different fungicides were evaluated following the protocol described by Sánchez-Torres and Tuset (2011). All values were referred to normal growth in absence of fungicide and therefore were expressed in percentage as relative growth. 2.6. Virulence assays Infection experiments with freshly harvested orange (Citrus sinensis) fruits and collection of fruit peel tissue samples were performed as described previously (González-Candelas et al., 2010). Fruits were wounded at four places around the equatorial axis and inoculated with 10 μL of a conidial suspension adjusted to 105 conidia/mL to compare the virulence of different strains. They were kept at 20 °C and 90% RH. There were three replicates of five fruits each. Tissue samples were frozen at −80 °C to be use for RNA extraction.

3.2. Targeted disruption of PdSUT1 Agrobacterium tumefaciens-harboring plasmid pΔSUT1 (Fig. 2A) was used for P. digitatum Pd1 transformation. The pΔSUT1, which derives from pRFHU2 plasmid (Frandsen et al., 2008), contains a 1.4 kb fragment of upstream gene region using primers SUT7-SUT8 (Table 1) and a 1.45 kb fragment of downstream gene region using primers SUT9SUT10 (Table 1) adjacent to the hygromycin resistant cassette in the TDNA region of the plasmid (Fig. 2B). Monosporic transformants were confirmed by PCR with primers HygF-HygR (Table 1) (Fig. 2C). Deletion of the targeted gene was analysed from both flanks with primers HygRt-SUT11 and SUT16-HygFt (Table 1). In the wild-type strain and

2.7. Quantification of relative gene expression Synthesis of the first strand of cDNA was performed with oligodT primed cDNA synthesis using 1 μg of total RNA and PrimeScript™ RT reagent Kit (Takara Bio Inc.) in a 20 μL reaction, following the recommendations of the manufacturer. Quantitative PCR was performed in a reaction volume of 10 μL on 1 μL of 1/10 diluted cDNA using the LightCycler 480 SYBR Green I Master mix (Roche Diagnostics, Spain) in a LightCycler 480 Real Time 59

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Fig. 1. A: Phylogenetic analysis of sugar transporters from fungi and plants. Neighbour joining analysis was performed on aligned amino acid sequences of Sp = Schizosaccharomyces pombe α-glucoside transporter, Cg = Colletotrichum gloespoiroides, AO = Aspergillus oryzae, ATEG = Aspergillus terreus, ABL = Aspergillus nidulans, PEX = Penicillium expansum, PIT = Penicillium italicum, PDIP = Penicillium digitatum, Gm = Glycine maix, At = Arabidopsis thaliana, Le = Lycopersiculm esculentum, Md = Malus domestica, Cs = Citrus sinensis, Os = Oryze sativa, Uf = Uromyces fabae, Am = Amanita muscaria, Th = Trichoderma harzianum, Um = Ustilago mays, Uh = Ustilago hordei, ANi = Apergillus niger. All accession numbers refer to the GenBank database. B: Phylogenetic tree generated using Neighbour joining analysis on aligned amino acid sequences of different P. digitatum MFS transporters. Accession numbers refer to the GenBank database. Evolutionary distances were computed using the Poisson correction method. MFS transporters used in gene expression analysis are framed with a shaded square. Hypothetical function of several sugar transporters are shown. Numbers indicate percent of 500 bootstrap analyses.

ΔT7) containing only a single T-DNA integration and one ectopic mutant (ET4) were selected for further analysis. Phenotypic analysis of the different strains WT, deletant transformants (ΔT1 and ΔT7) and ectopic transformant (ET4) did not show differences when grown in PDA. No differences were also observed when grown in minimal media with several carbon sources. All strains were able to grow in presence of glucose, sucrose, maltose and to lesser extend lactose, sorbitol and citric acid. Differences were only observed

in no replacement transformants there was no amplification, while true knock-out mutants amplified a fragment of 2.8 kb and 1.7 kb, respectively (Fig. 2C). The absence of the targeted gene in the deletion mutants was further verified using the primers SUT1-SUT2 (Table 1) (Fig. 2C). To select those null mutants without additional T-DNA integrations, the copy number of integrated DNA was determined by real-time quantitative PCR (qRT-PCR). Two PdSUT1 deletion mutants (ΔT1 and

60

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Fig. 2. Construction and analysis of Penicillium digitatum knock-out PdSUT1 transformants. (A) Map of plasmid pΔSUT1. (B) Diagram of wild-type locus and the PdSUT1 replacement with the HygR selectable marker from pΔSUT1 by homologous recombination to generate the ΔSUT1 mutants. Primers used in the construction of plasmid pΔSUT1 and those used for the analysis of the transformants are shown. (C) Polymerase chain reaction (PCR) analysis of the wild-type Pd1 strain, two ΔPdSUT1 null mutants (ΔT1, ΔT7) and the respective ectopic mutant (ET4) with analytic primers.

Surprisingly, Pd1 deletion mutants showed an increase of fungicide resistance restricted to DMIs assayed, IMZ, PCL and PHI (mixture of IMZ and pyremethanil) when compare to the wild type Pd1 parental strain, while no differences occurred when TBZ fungicide was used. The increase ranged from 75% to 31% from 4 μg/mL of IMZ, 27–16% from 1 μg/mL of PCL and 16% from 1 μg/mL of PHI compare to wild type Pd1 strain (Fig. 5). On the contrary, no effect on fungicide sensitivity was observed neither in Pd27 overexpression transformants (OT1 and OT5) (Supplementary Fig. 1) nor in Pd149 overexpression transformants (OT14, OT15 and OT16) (Supplementary Fig. 2). All P. digitatum strains (transformants and wild types) behave the same way as sensitive strains not able to grow in presence of fungicides.

among the different carbon sources exhibiting alterations between growth rate and ability of sporulation but not between wild type and deletants strains (Fig. 3). 3.3. Overexpression of the P. digitatum PdSUT1gene The whole P. digitatum PdSUT1 gene containing the promoter (1.2 kb) and the terminator (0.9 kb) was introduced into plasmid pRFHU (Frandsen et al., 2008) using primers SUT12-SUT13 to obtain plasmid pOSUT1 (Fig. 4A). After A. tumefaciens-mediated transformation of P. digitatum Pd27 and Pd149 strains (both sensitive to several fungicides), we screened 10 transformants of each strain by PCR to confirm the presence of the hygromycin gene using the primers HygFHygR (Fig. 4B). The expected 588-bp PCR fragment was detected in all transformants and was absent from the untransformed Pd27 and Pd149 strains (Fig. 4C). We took five transformants from each strain for determination of T-DNA copies integrated in the genome by quantitative PCR as described above and using wild-type Pd27 and Pd149 strains as controls and the β-tubulin coding gene as a reference. We selected for further analysed two Pd27:PdSUT1 mutants (OT1 and OT5) and three Pd149:PdSUT1 (OT14, OT15 and OT16). Transformants OT1 and OT5 contained one or two T-DNA copies integrated elsewhere in the genome, respectively (two or three copies of the PdSUT1 gene). The Pd149, PdSUT1 (OT14) contained one T-DNA copy while OT15 and OT16 contained two T-DNA copies integrated elsewhere in the genome.

3.5. Virulence of PdSUT1 To determine whether PdSUT1 was involved in pathogenicity/ virulence, infection of fungal different strains was carried out in mature orange fruits. We selected all wild-type P. digitatum strains (Pd1, Pd27 and Pd149), two Pd1:ΔPdSUT1 knock-out mutants (ΔT1 and ΔT7) an ectopic transformant ET4, two Pd27:PdSUT1 overexpression strains (OT6 and OT5) and three Pd149:PdSUT1 overexpression strains (OT14, OT15 and OT16). Two independent infection assays were conducted, and virulence was determined as incidence of infection and disease severity at different days post infection (dpi). The results revealed that all P. digitatum ΔSUT1 mutants were less virulent than the wild-type Pd1 strain throughout all infection time evaluated, although the decrease was more obvious at 3–4 dpi (Fig. 6A). This effect was also noticeable in disease severity, even more than the observed on infection capacity and the reduction was of four

3.4. Effect of PdSUT1 on fungicide sensitivity All different P. digitatum strains (transformants and parental strains) were evaluated regarding to their ability to grow in presence of different concentration of several chemical fungicides. 61

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Fig. 3. A: Influence of carbon sources in fungal growth curves. P. digitatum strains (WT, ET4, ΔT1 and ΔT7) were grown in PDA and MM media containing 1% of specific carbon.glucose (GLC), sucrose (SUC), maltose (MAL), lactose (LAC), sorbitol (SOR) or citric acid (CIT) during twelve days at 25 °C. Error bars represent standard deviation. B: Plates of P. digitatum strains (WT, ET4, ΔT1 and ΔT7) grown in the different media during five days at 25 °C.

Fig. 4. Construction and analysis of Penicillium digitatum overexpression PdSUT1 transformants. (A) Map of plasmid pOSUT1. (B) Diagram of wild-type locus and the PdSUT1 gene with the HygR selectable marker from pOSUT1 inserted elsewhere in the genome. Primers used in the construction of plasmid pOSUT1 and those used for the analysis of the transformants are shown. (C) Hygromycin polymerase chain reaction (PCR) analysis of the wild-type Pd27 strain, transformants and control plasmid using primers HygF/HygR. Lanes correspond to P: pOSUT1 plasmid, T1-T5: Pd27-overexpressed transformants and T6-T10: Pd149-overexpression transformants (T14-T18) and WT: DNA from Pd27 strain.

62

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Fig. 5. Evaluation of fungicide sensitivity in disruptant mutants compared to wild type Pd1. IMZ = imazalil, TBZ = Thiabendazol, PCL = Prochloraz, PHI = Philabuster. Percentage of relative growth was calculated respect to the each strain grown without fungicide. Error bars represent standard deviation among three replicas.

3.6. Transcriptional profiling of PdSUT1

times. P. digitatum ectopic strain ET4 behaved as parental strain Pd1 (Fig. 6B). The average reduction in the disruption mutants was around 67% in disease incidence and 88% in disease severity at 3 dpi. Over time, at 7 dpi, the virulence results became more similar to those of wild type showing only 14% reduction in disease severity. Conversely, P. digitatum overexpression transformants, regardless of whether they came from the strain Pd27 or Pd149 strain, showed the same rate of virulence than respective parental strains (Pd27 and Pd149). No differences were observed in either disease incidence or disease severity for both types of transformants (Fig. 7).

Analysis of P. digitatum PdSUT1 gene expression was conducted using qRT-PCR. We performed in vitro growth assays using the P. digitatum wild-type stains Pd1, Pd27 and Pd149 at three different time points (1 d, 2 d and 3 d) comparing Pd1 deletion mutants, two Pd27 overexpression transformants and three Pd149 overexpression transformants at the same time. In axenic liquid culture, the results showed that all wild-type P. digitatum strains share the same pattern of induction, increasing their expression through time assayed, although Pd1 exhibited higher rate of

Fig. 6. Evaluation of virulence as disease intensity (%) (A) and disease severity (cm2) (B). Virulence evaluation of Pd1, the ectopic transformant ET4 and the disruptant transformants (ΔT1, ΔT7). All are mean of two infection experiments. Control correspond to oranges mock inoculated. Error bars represent standard deviation.

63

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

120

50

Disease severity (cm2)

100

60

3dpi 4dpi 5dpi 6dpi 7dpi

80

60

40

3dpi 4dpi 5dpi 6dpi 7dpi

40

30

20

20

10

0

0

Fig. 7. Evaluation of virulence as (A) disease intensity (%) and (B) disease severity (cm2). Virulence evaluation of Pd27, Pd149 and the overexpression transformants. All are mean of three infection experiments. Control correspond to oranges mock inoculated. Error bars represent standard deviation.

Fig. 8. Analysis of PdSUT1 relative gene expression (RGE). (A): time course evaluation of gene expression of Pd1 and deletant mutants in PDB liquid culture at 24 °C. (B): time course evaluation of gene expression of Pd27 and overexpression transformants in PDB liquid culture at 24 °C. (C): time course evaluation of gene expression of Pd149 and overexpression mutants in PDB liquid culture at 24 °C. (D): time course evaluation of gene expression of Pd1 and Pd149 in PDB liquid culture at 24 °C and during orange infection. In all cases, 1, 2 and 3 correspond to 1 dpi, 2 dpi and 3 dpi, respectively. The expression levels are relative to three reference genes: ribosomal 28S RNA, β-tubulin and histone H3. Error bars indicate standard deviations of three biological replicates. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

range of expression in OT14 with very slightly induction at 2 and 3 dpi (Fig. 8C). Furthermore, gene expression was assessed during citrus fruits infection for Pd1 (very virulent) and P149 (less virulent) wild-type strains at 1, 2 and 3 dpi. The Pd1 expression profile clearly varied during infection compared to in vitro growth. During the first 24 h of infection (1 dpi), PdSUT1 gene transcription did not vary, but at 2 and 3 dpi expression level fell drastically. However, Pd149 showed somewhat increments in gene

transcription abundance compare to the other parental strains. No expression was detected in both Pd1 deletion mutants (Fig. 8A). In both the Pd27 and Pd149 overexpression mutants, differences were observed in level of expression that were related to the copy number integrated into the genome. OT5 exhibited a large increase in expression over time evaluated, while OT1 showed the same range of transcriptional abundance as Pd27 wild-type (Fig. 8B). In the same way, transformants OT15 and OT16 showed an increase over time, particularly after 2 dpi, compared to wild-type Pd149 and almost the same

64

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Fig. 9. Relative gene expression (RGE) of: MFS transporter genes (PdMFS1-5) and two sterol demethylases genes (PdCYP51 and PdCYP51B) in wild-type P. digitatum (Pd1) (black columns) and deletant mutant ΔT1 and ΔT7 (grey and white columns, respectively) at different time points in liquid culture (1 day = d1, 2 days = d2 and 3 days = d3). The expression levels are relative to three reference genes: ribosomal 28S RNA, β-tubulin and histone H3. Error bars indicate standard deviations of three biological replicates.

describe the fruit–fungus interaction and generate insight into fungal pathogenicity/virulence (González-Candelas et al., 2010; López-Pérez et al., 2014) and fungicide resistance (Sánchez-Torres and Tuset, 2011). In the present study, we reported the contribution of P. digitatum PdSUT1 on fungal virulence and fungicide sensitivity. In plants, sucrose transporters (SUTs, also called SUCs) encode a small gene family (Kuhn and Grof, 2010; Lemoine, 2000; Williams et al., 2000) and are basic membrane proteins with twelve transmembrane spanning domains as part of the glycoside-pentoside-hexuronide (GPH) cation symporter family within the major facilitator superfamily (Chang et al., 2004). Compare to plants and yeasts, sugar transporters in filamentous fungi are largely unknown. It has been identified a number of hexose transporter homologues and sugar sensors due to fungal sequencing projects, differential screenings or in targeted methods (Vargas et al., 2011; Degaldo-Jarama et al., 2003; Wahl et al., 2010; de Vries et al., 2017). Nevertheless, very little is reported concerning their functions in the corresponding organisms (Wei et al., 2004). Analysis of the PdSUT1 sequence revealed high identity to other fungal transporter genes and the presence of transmembrane domains typical for MFS transporters. The phylogenetic analysis of PdSUT1p included P. digitatum sucrose transporter in the same clade than other fungal transporter of Penicillium spp and Aspergillus spp, C. gloesporioides and the yeast S. pombe with high affinity to maltose (Reinders and Ward., 2001) However, PdSUT1p was clearly apart from plant sucrose transporters and other fungal sucrose transporters already characterized (Degaldo-Jarama et al., 2003; Vargas et al., 2011; Wahl et al., 2010). Moreover, the phylogenetic analysis of several P. digitatum MFS transporters that comprise the MFS transporters used in this work, revealed that PdSUT1 clustered close to a P digitatum invertase and apart of other predicted sugar transporters such as glucose or fructose reinforcing this role in sucrose transporter. The main function of fungal sucrose transporters and how they are regulated, persist unknown. In this work, P. digitatum PdSUT1 sucrose transporter appeared to be involved in virulence and fungicide sensitivity. The interest of getting insight on both (virulence, fungicide resistance) mechanisms, resides in the requirement for new breakthroughs in control strategies that avoid the use of chemical fungicides on P. digitatum. The involvement of PdSUT1 in virulence was confirmed through PdSUT1 deletion mutants, which exhibited a reduction in virulence, as shown, by incidence and disease severity depletion. Both

expression comparing in vitro and in vivo samples, especially at early stages (1–2 dpi) (Fig. 8D). 3.7. Gene expression in Pd1 deletant mutants To determine the role of the PdSUT1 gene in fungicide resistance and pathogenesis/virulence responses, the expression of several genes was carried out in the WT Pd1 and in both deletant mutanst (ΔT1 and ΔT7). We analysed five MFS (Major Facilitator Superfamily) transporter genes (PdMFS1-5) (PDIP_09580, PDIP_42510, PDIP_09600, PDIP_54080, and PDIP_53980) and two sterol demethylases genes (PdCYP51 and PdCYP51B) (PDIP_80150 and PDIP_01820), which play different roles in fungal pathogenesis/virulence and fungicide resistance. The expression analyses were performed comparing wild type and ΔSUT1 mutant strains (ΔT1 and ΔT7) at three different time points in liquid culture (1–3 days) to evaluate the effect of PdSUT1 on gene regulation (Fig. 9). The results showed that the transcriptional abundance pattern was the same in all MFS transporters and in most of them, gene expression increased in both deletant strains compared with wild-type Pd1, particularly on days 2 and 3, with the only exception of PdMFS3 gene in which expression level decreased (Fig. 9). However, the magnitude of the expression level was different for each MFS transporter. PdMFS1 and PdMFS4 showed the highest expression; PdMFS2 and PdMFS5 exhibited an intermediate level of expression, but all exhibited marked differences at 3 dpi, where expression levels increased drastically. PdMFS3, the only MFS transporter that behaved differently, was also the one with the lowest expression level. In contrast, both sterol demethylases PdCYP51 and PdCYP51 B exhibited noticeable decreased expression in deletant mutants (Fig. 9). Although both sterol demethylases were repressed in the ΔSUT1 mutants, the expression levels of these enzymes were considerably different. PdCYP51 was only slightly expressed while the PdCYP51 B transcription level was very high. However, expression rate was the same for both genes since they were almost constitutively expressed in ΔSUT1 mutants assuming a decrease of 20 times in the gene expression compared to wild type Pd1. 4. Discussion The economic impact of P. digitatum, the most damaging postharvest pathogen of citrus fruit, has motivated the use of molecular tools to 65

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

bound transport (Wei et al., 2004). To our knowledge, this is the first time that a sucrose transporter has been reported in P. digitatum, suggesting that a sugar transporter is necessary for carbohydrate metabolism and when PdSUT1 is eliminated, other fungal transporters are able to replace its function. Moreover, expression profiles analysed during infection showed that in Pd1 (virulent strain), there was a decrease expression from 2 dpi compared to during in vitro growth, but in the less virulent strain (Pd149), expression was almost not affected. The results provide in this work reinforce that the effect of PdSUT1 in fungal virulence is probably driven through induction of sugar transporters and PdSUT1 has no direct role in P. digitatum virulence because both Pd27- and Pd149-overexpression mutants clearly increase PdSUT1 expression but not infectivity and PdSUT1 transcriptional abundance in wild type did not increase during infection. In conclusion, gene elimination could indicate that PdSUT1 is important in virulence and affect fungicide resistance. However, the additional information provided by the overexpression transformants and the gene expression study revealed that its participation is indirect and PdSUT1 role is probably more related to the uptake of carbohydrates. When PdSUT1 is affected, the infectivity and fungicide sensitivity might be influenced through MFS transporters gene activation.

disruption mutants and the wild-type strain were able to macerate orange tissue, suggesting that the PdSUT1 mutation affects the disease severity more than the disease incidence. The deletion mutants (ΔT1 and ΔT7) exhibited a reduction in lesion diameter of more than 4 times in commercial oranges compared with the wild-type strain (Pd1) or the ectopic transformant (ET4). These results are consistent with other P. digitatum genes reported for affecting fungal virulence. All genes showed an important reduction in virulence and never reached the disease index of the wild type (de Ramón-Carbonell and SánchezTorres, 2017; Gandía et al., 2014; Harries et al., 2015; Liu et al., 2015; López-Pérez et al., 2014; Ma et al., 2016; Vilanova et al., 2016; Zhang et al., 2013a,b,c). The role of PdSUT1 regarding to fungicide evaluation provided striking results. We observed only an increase in fungicide resistance in the deletant mutants and no changes in the overexpression mutants. The PdSUT1 transporter specificity, only capable to transport sucrose and not toxic compounds could be a possible explanation for not increasing fungicide resistance in overexpression transformants. Nevertheless, this fact does not explain why fungicide resistance increased in deletant mutants. The results obtained in the evaluation of the gene expression showed that in absence of PdSUT1, the expression of several genes involved in secondary transport, as MFS transporters (PdMFS1-5) is increased. Apparently, sugar transport not only affect the presence of sugar as nutrients but also affect gene regulation since act as signaling molecules that trigger several responses (de Vries et al., 2017). This might be the reason for the intensification of fungicide resistance on PdSUT1 deletant mutants. When PdSUT1 gene is absent, other fungal transporters with broad range of specificity that are able to efflux wide range of substrates, including sugars and toxic products (fungicides) (Stergiopoulos et al., 2002), could replace sugar transport. MFS transporters can act in this way (Hayashi et al., 2002). Indeed, four of five MFS transporters evaluated that are phylogenetically apart from PdSUT1, exhibited induction upon deletant mutants, which could confer fungicide resistance to DMIs. In contrast, PdSUT1 might positively affect sterol demethylases (CYP51 and PdCYP51B) (Sun et al., 2011). Fungal MFS transporter could exert the same effect in sensitivity to DMIs as sterol demethylases do, but with different mechanism. Thus, when MFS transporters are induced, repression of sterol demethylases is produced. Similar effect was reported in PdSte12, a P. digitatum transcription factor, in which deletant mutants showed induction of MFS transporters and reduction of sterol demethylases (Vilanova et al., 2016). In PdSte12 deletant mutants, PdMFS3 was also induced while in PdSUT1 deletant mutants was the only repressed, indicating that probably PdSte12 regulates in different way gene expression and exert control in signal transduction pathways. In the absence of PdSUT1, a replacement of sugar transport could take place since sugar uptake using several carbon sources assay evidenced that the deletant mutants were able to use monosaccharides and disaccharides and no differences were found when compared to the wild type Pd1 or the ectopic mutant. In the same way, the real contribution of PdSUT1 in virulence might be due to carbohydrate uptake. Fungal virulence is clearly affected in the deletant mutants but not in the overexpression transformants. The lack of PdSUT1 probably triggers a quick response to enable the overproduction of other fungal transporters to carry out its function but in less efficient way and therefore infection capacity and disease severity was compromised at the first stages (3–4 dpi). On the contrary, although the overexpression mutants exhibited different profiles depending on the number of PdSUT1 copies, all overexpression transformants with two extra copies of PdSUT1 showed an enhance on transcription abundance at 2 and 3 dpi. This result did not correlate with the infectivity and none of the overexpression transformants showed a higher virulence. The carbohydrate metabolism starts with the uptake of the molecules into the cell. This means that the microorganisms use many different major facilitator superfamily proteins involved in membrane-

Acknowledgements The work was funded by AGL2008-04828-C03 and ALG200130519-C03-02 projects from the Ministry of Science and Innovation (Spain). M de Ramón-Carbonell was recipient of a fellowship from Instituto Nacional de Investigaciones Agrarias (INIA). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.micres.2017.06.008. References Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST, a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Chang, A.B., Lin, R., Keith Studley, W., Tran, C.V., Saier Jr., M.H., 2004. Phylogeny as a guide to structure and function of membrane transport proteins. Mol. Membr. Biol. 21, 171–181. Delgado-Jarana, J., Moreno-Matios, M.A., Benitez, T., 2003. Glucose uptake in Trichoderma harzianum, role of the Gtt1 gene in glucose transport. Eukaryot. Cell 2, 708–771. Frandsen, R.J.N., Andersson, J.A., Kristensen, M.B., Giese, H., 2008. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Mol. Biol. 9, 70. Gandía, M., Harries, E., Marcos, J.F., 2014. The myosin motor domain-containing chitin synthase PdChsVII is required for development, cell wall integrity and virulence in the citrus postharvest pathogen Penicillium digitatum. Fungal Genet Biol. 67, 58–70. González-Candelas, L., Alamar, S., Sánchez-Torres, P., Zacarías, L., Marcos, J.F., 2010. A transcriptomic approach highlights induction of secondary metabolism in citrus fruit in response to Penicillium digitatum infection. BMC Plant Biol. 10, 194. Harries, E., Gandía, M., Carmona, L., Marcos, J.F., 2015. The Penicillium digitatum protein O-mannosyl transferase Pmt2 is required for cell wall integrity, conidiogenesis, virulence and sensitivity to the antifungal peptide PAF26. Mol. Plant Pathol. 16, 748–761. Hayashi, K., Schoonbeek, H.-J., de Waard, M.A., 2002. Bcmfs1, a novel major facilitator superfamily transporter from Botrytis cinerea, provides tolerance towards the natural toxic compounds camptothecin and cercosporin and towards fungicides. Appl. Environ. Microbiol. 68, 4996–5004. Hirose, T., Zhang, Z., Miyao, A., Hirochika, H., Ohsugi, R., Terao, T., 2010. Disruption of a gene for rice sucrose transporter, OsSUT1, impairs pollen function but pollen maturation is unaffected. J. Exp. Bot. 61, 3639–3646. Kanetis, L., Forster, H., Adaskaveg, J.E., 2008. Baseline sensitivities for the new postharvest fungicides against Penicillium species on citrus and multiple resistance evaluations in P. digitatum. Plant Dis. 92, 261–269. Kinay, P., Mansour, M.F., Mlikota, G.F., Margosan, D.A., Smilanick, J.L., 2007. Characterization of fungicide-resistant isolates of Penicillium digitatum collected in California. Crop Prot. 26, 647–656. Kuhn, C., Grof, C.P., 2010. Sucrose transporters of higher plants. Curr. Opin. Plant Biol. 13, 288–298. López-Pérez, M., Ballester, A.R., González-Candelas, L., 2014. Identification and functional analysis of Penicillium digitatum genes putatively involved in virulence towards

66

Microbiological Research 203 (2017) 57–67

M.d. Ramón-Carbonell, P. Sánchez-Torres

Vargas, W.A., Crutcher, F.K., Kenerley, M.C., 2011. Functional characterization of a plantlike sucrose transporter from the beneficial fungus Trichoderma virens. Regulation of the symbiotic association with plants by sucrose metabolism inside the fungal cells. New Phytol. 189, 777–789. Vilanova, L., Teixidó, N., Torres, R., Usall, J., Viñas, I., Sánchez-Torres, P., 2016. Relevance of the transcription factor PdSte12 in Penicillium digitatum conidiation and virulence during citrus fruit infection. Int. J. Food Microbiol. 235, 93–102. Voegele, R.T., Struck, C., Hahn, M., Mendgen, K., 2001. The role of haustoria in sugar supply during infection of broad bean by the rust fungus Uromyces fabae. Proc. Natl. Acad. Sci. 98, 8133–8138. Wahl, R., Wippel, K., Goos, S., Kämper, J., Sauer, N., 2010. A novel high-Affinity sucrose transporter is required for virulence of the plant pathogen Ustilago maydis. PLoS Biol. 8, e1000303. Wang, J.Y., Sun, X.P., Lin, L.Y., Zhang, T.Y., Ma, Z.H., Li, H.Y., 2012. PdMFS1, a major facilitator superfamily transporter from Penicilliun digitatum, is partially involved in the imazalil-resistance and pathogenicity. Afr. J. Microbiol. Res. 6, 95–105. Wei, H., Vienken, K., Weber, R., Bunting, S., Requena, N., Fischer, R., 2004. A putative high affinity hexose transporter, hxtA of Aspergillus nidulans is induced in vegetative hyphae upon starvation and in ascogenous hyphae during cleistothecium formation. Fungal Genet. Biol. 41, 148–156. Weise, A., Barker, L., Kühn, C., Lalonde, S., Buschmann, H., Frommer, W.B., Ward, J.M., 2000. A new subfamily of sucrose transporters, SUT4, with low affinity⁄high capacity localized in enucleate sieve elements of plants. Plant Cell 12, 1345–1355. Williams, L.E., Lemoine, R., Sauer, N., 2000. Sugar transporters in higher plants −a diversity of roles and complex regulation. Trends Plant Sci. 5, 283–290. Wu, Z., Wang, S., Yuan, Y., Zhang, T., Liu, J., Liu, D., 2016. A novel major facilitator superfamily transporter in Penicillium digitatum (PdMFS2) is required for prochloraz resistance conidiation and full virulence. Biotechnol. Lett. 38, 1349–1357. Zhang, T., Sun, X., Xu, Q., González-Candelas, L., Li, H., 2013a. The pH signaling transcription factor PacC is required for full virulence in Penicillium digitatum. Appl. Microbiol. Biotechnol. 97, 9087–9098. Zhang, T., Sun, X., Xu, Q., Zhu, C., Li, Q., Li, H., 2013b. PdSNF1, a sucrose non-fermenting protein kinase gene, is required for Penicillium digitatum conidiation and virulence. Appl. Microbiol. Biotechnol. 97, 5433–5445. Zhang, T., Xu, Q., Sun, X., Li, H., 2013c. The calcineurin-responsive transcription factor Crz1 is required for conidation, full virulence and DMI resistance in Penicillium digitatum. Microbiol. Res. 168, 211–222. de Ramón-Carbonell, M., Sánchez-Torres, P., 2017. The transcription factor PdSte12 is involved in virulence of Penicillium digitatum on citrus fruit. Postharvest. Biol. Tec. 125, 129–139. de Vries, R.P., Riley, R., Wiebenga, A., Aguilar-Osorio, G., Amillis, S., Uchima, C.A., et al., 2017. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus. Genome Biol. 18. de Waard, M.A., Andrade, A.C., Hayashi, K., Schoonbeek, H.J., Stergiopoulos, I., Zwiers, L.H., 2006. Impact of fungal drug transporters on fungicide sensitivity, multidrug resistance and virulence. Pest Man. Sci. 62, 195–207.

citrus fruit. Mol. Plant Pathol. 16, 262–275. Lemoine, R., 2000. Sucrose transporters in plants, update on function and structure. Biochimica. Biophysica. Acta 1465, 246–262. Liu, J., Yuan, Y., Wu, Z., Li, N., Chen, Y., Qin, T., Geng, H., Xiong, L., Liu, D., 2015. A novel sterol regulatory element-binding protein gene sreA identified in Penicillium digitatum is required for prochloraz resistance, full virulence and erg11 (cyp51) regulation. PLoS One 10, e0117115. Ma, H., Sun, X., Wang, M., Gai, Y., Chung, K.R., Li, H., 2016. The citrus postharvest pathogen Penicillium digitatum depends on the PdMpkB kinase for developmental and virulence functions. Int. J. Food Microbiol. 236, 167–176. Marcet-Houben, M., Ballester, A.R., de la Fuente, B., Harries, E., Marcos, J.F., GonzálezCandelas, L., Gabaldón, T., 2012. Genome sequence of the necrotrophic fungus Penicillium digitatum, the main postharvest pathogen of citrus. BMC Genom. 13, 646. Nehls, U., Wiese, J., Guttenberger, M., Hampp, R., 1998. Carbon allocation in ectomycorrhizas, identification and expression analysis of an Amanita muscaria monosaccharide transporter. Mol. Plant Microbe. Interact 11, 167–176. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST() for groupwise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36. Prober, J.M., Trainor, G.L., Dam, R.J., Hobbs, F.W., Robertson, C.W., Zagursky, R.J., Cocuzza, A.J., Jensen, M.A., Baumeister, K., 1987. A system for rapid DNA sequencing with fluorescent chain terminating dideoxynucleotides. Science 238, 336–341. Reinders, A., Ward, J.M., 2001. Functional characterization of the alpha-glucoside transporter Sut1p from Schizosaccharomyces pombe, the first fungal homologue of plant sucrose transporters. Mol. Microbiol. 39, 445–454. Reinders, A., Sivitz, A.B., His, A., Grof, C.P., Perroux, J.M., Ward, J.M., 2006. Sugar cane ShSUT1, analysis of sucrose transport activity and inhibition by sucralose. Plant Cell Environ. 29, 1871–1880. Sánchez-Torres, P., Tuset, J.J., 2011. Molecular insights into fungicide resistance in sensitive and resistant Penicillium digitatum strains infecting citrus. Postharvest Biol. Technol. 59, 159–165. Saier, M.H., 2000. Families of transmembrane sugar transport proteins. Mol. Microbiol. 35, 699–710. Sauer, N., 2007. Molecular physiology of higher plant sucrose transporters. FEBS Lett. 581, 2309–2317. Schüβler, A., Martin, H., Cohen, D., Fritz, M., Wipf, D., 2006. Characterization of a carbohydrate transporter from symbiotic glomeromycotan fungi. Nature 444, 933–936. Sivitz, A.B., Reinders, A., Ward, J.M., 2005. Analysis of the transport activity of barley sucrose transporter HvSUT1. Plant Cell Physiol. 46, 1666–1673. Stergiopoulos, I., Zwiers, L.H., De Waard, M.A., 2002. Secretion of natural and synthetic toxic compounds from filamentous fungi by membrane transporters of the ATPbinding cassette and major facilitator superfamily. Eur. J. Plant Pathol. 108 (7), 719–734. Sun, X., Wang, J., Feng, D., Ma, Z., Li, H., 2011. PdCYP51B, a new putative sterol 14alpha-demethylase gene of Penicillium digitatum involved in resistance to imazalil and other fungicides inhibiting ergosterol synthesis. Appl. Microbiol. Biotechnol. 91, 1107–1119.

67