Involvement of the plasminogen enzymatic cascade in the reaction to axotomy of rat sympathetic neurons

www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 36 (2007) 174 – 184

Involvement of the plasminogen enzymatic cascade in the reaction to axotomy of rat sympathetic neurons M. Egle De Stefano, a,⁎ Lucia Leone, a Claudia Moriconi, a Arianna Del Signore, a Tamara C. Petrucci, b and Paola Paggi a Dipartimento di Biologia Cellulare e dello Sviluppo, Università “La Sapienza”, Roma, Italy Dipartimento di Biologia Cellulare e Neuroscienze, Istituto Superiore di Sanità, Roma, Italy

a

b

Received 4 April 2007; revised 8 June 2007; accepted 18 June 2007 Available online 18 July 2007

Axotomy of superior cervical ganglion (SCG) neurons is characterized by peripheral regeneration of injured axons and temporary disassembly of the intraganglionic synapses, necessary for synaptic silencing. Both events require remodeling of the extracellular matrix achieved through controlled proteolysis of its components by different enzymatic systems. In this study, we investigate the involvement of the plasminogen enzymatic cascade in the response to axotomy of rat SCG neurons. All components of this proteolytic pathway, tissue plasminogen activator (tPA), plasminogen, membrane receptor annexin II and tPA inhibitor (PAI-1), are constitutively expressed in uninjured SCG and increase significantly after SCG neuron axotomy. Immunolocalization of plasminogen, the key protein converted into the enzymatically active plasmin by tPA, in both neurons and non-neuronal cells indicates that all cell types are involved in the response to axotomy. The time course of activation of tPA/plasmin enzymatic pathway suggests its involvement in both intraganglionic synapse remodeling and axonal regeneration. © 2007 Elsevier Inc. All rights reserved.

Introduction The serinproteinase enzymatic system of plasminogen activators (PAs)/plasmin is one of the most important proteolytic pathways, with major roles in a variety of physiological and pathological conditions, which require extracellular matrix (ECM) remodeling (reviewed in Melchor and Strickland, 2005; Sternlicht and Werb, 2001; Cai et al., 2005). Components of the PAs/plasmin degradative pathway are widely expressed in the central nervous system (CNS) (Sappino et al., 1993) where, by degrading a broad spectrum of substrates, from different ECM molecules to cell membrane receptors (Liotta et al., 1981; Murphy and Docherty, 1992; Sappino et al., 1993; Seeds et al., 1996), they regulate several aspects of ⁎ Corresponding author. Dipartimento di Biologia Cellulare e dello Sviluppo, Università “La Sapienza”, P.le A. Moro 5, 00185 Roma, Italy. Fax: +39 06 4991 2351. E-mail address: [email protected] (M.E. De Stefano). Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2007.06.007

neuronal plasticity (reviewed in Melchor and Strickland, 2005; Yepes and Lawrence, 2004; Gravanis and Tsirka, 2005). These include neurite outgrowth during development (Seeds et al., 1999; Jacovina et al., 2001), synaptic plasticity associated with learning and memory storage in the hippocampus (Calabresi et al., 2000; Baranes et al., 1998) and with motor learning in the cerebellum (Seeds et al., 1995; Seeds et al., 2003), neurodegeneration induced by excitotoxic stimuli (reviewed in Melchor and Strickland, 2005; Tsirka et al., 1995; Siao et al., 2003) and various pathologies (reviewed in Melchor and Strickland, 2005; Gveric et al., 2005). Plasmin is the ultimate effector of this enzymatic pathway, generated by the cleavage of plasminogen by either tissue (tPA) or urokinaselike (uPA) plasminogen activators. In the nervous system, tPA is the most expressed; the binding of both plasminogen and tPA to cell surface receptors, such as annexin II, permits full and rapid conversion of plasminogen into plasmin (reviewed in Melchor and Strickland, 2005). The control of plasmin proteolytic activity can be achieved at different levels of the enzymatic cascade. One of these is the attenuation of tPA activity by the action of serin proteinase inhibitors, such as neuroserpins and plasminogen activator inhibitor1 (PAI-1), a potent endogenous inhibitor that binds tPA irreversibly (reviewed in Melchor and Strickland, 2005; Vassalli et al., 1991). Besides its most common role in degrading ECM components, the PAs/plasmin enzymatic system is also implicated in the activation of matrix metalloproteinase-2 (MMP-2), a gelatinase member of the large family of metalloproteinases (Baramova et al., 1997; Monea et al., 2002). Similarly to plasmin, MMP-2 is expressed in both the CNS and the peripheral nervous system (PNS), where it is involved in different physiological and pathological events requiring ECM remodeling, most of which related to neuronal and synaptic plasticity (reviewed in Sternlicht and Werb, 2001; Dzwonek et al., 2004; Yong, 2005; Leone et al., 2005). We have previously shown that both the activity and protein level of MMP-2 are upregulated in response to axotomy of rat superior cervical ganglion (SCG) neurons (Leone et al., 2005). This surgical procedure permits ganglionic neuron survival and induces remodeling of the intraganglionic synapses, which consists in the detachment,

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

followed by reattachment, of pre- and post-synaptic elements. This process encompasses the time required for axonal regeneration and peripheral target reinnervation (Purves, 1975; Purves and Lichtman, 1978; Zaccaria et al., 1998; Del Signore et al., 2004). The temporary disassembly of the post-synaptic apparatus is achieved by degradation of proteins important for synapse stabilization and neurotransmitter receptor clustering (Zaccaria et al., 1998; Del Signore et al., 2004; Leone et al., 2005).

175

The purpose of this study was to investigate whether the tPA/ plasmin pathway is activated in the reaction of SCG neurons to axotomy and if its activity could overlap with that of MMP-2 previously observed (Leone et al., 2005). In particular, we analyzed changes in mRNA, protein and activity levels, and cellular and subcellular distribution of some components of the tPA/plasmin pathway during the time interval in which injury-induced intraganglionic synaptic remodeling occurs.

Fig. 1. tPA and plasminogen (plng) enzymatic activities and protein levels in control (ct) and injured (1, 3 and 5 days post-axotomy) SCG. (A) tPA zymography. Two lytic bands are present: the upper band corresponds to tPA one-polypeptide chain and the lower to the tPA light chain (L-tPA). The intensity of both bands increases after post-ganglionic nerve crush. st: recombinant human tPA standard. (B) By Western immunoblot, the anti-tPA antibody reveals two bands, one at 40 kDa, corresponding to the tPA heavy chain (H-tPA) and the other at 30 kDa corresponding to the tPA light chain (L-tPA). The intensity of both bands increases after injury. (C) Plasminogen zymography. The intensity of the lytic band corresponding to plasminogen activity increases after injury. st: recombinant human plasminogen standard. (D) In Western immunoblot, the intensity of the band stained by the anti-plasminogen antibody increases after injury. Molecular mass standards are shown on the right hand side. A' (n = 5), B' (n = 3), C' ( n = 4), D' ( n = 4): densitometric analysis of the bands present in A, B, C and D, respectively. Values are expressed as the ratio between the optical density (OD) of the bands in injured SCGs and the OD of the bands in control SCGs (OD injured/OD control) and analyzed by Student's t test. ⁎P ≤ 0.05, ⁎⁎P ≤0.01.

176

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

Results Changes in tPA and plasminogen enzymatic activities and protein levels after axotomy We performed plasminogen/casein zymography assays to assess whether tPA enzymatic activity was involved in the response of rat SCG neurons to axotomy. Fig. 1A shows a typical plasminogen/casein zymography obtained using control and injured (1, 3 and 5 days postaxotomy) SCG extracts. Two lytic bands are present in all specimens. The upper band was identified as tPA on the basis of its alignment with the lytic band of the human recombinant tPA used as standard. Based on the molecular mass, the lower band, barely detectable in the control, could represent the light chain of tPA, which contains the catalytic domain of the enzyme (Rijken and Collen, 1981; van Zonneveld et al., 1986) and can thus be detected with this type of technique. In control zymograms, obtained by incubating gels with 1 mM PMSF (a serine protease inhibitor), or 1 μM tPA-STOP (a synthetic tPA inhibitor), none of the lytic bands were observed. Furthermore, when amiloride was added at the incubation medium at a concentration of 200 μM, known to inhibit uPA, but not tPA, the two lytic bands were still observed, confirming that they were indeed due to tPA activity (data not shown). Densitometric analysis, carried out on five zymographies, showed that the intensity of both bands, whole tPA and its light chain, increased in comparison with the control and that the difference is statistically significant starting 1 day after injury (Fig. 1A'). No differences were, instead, observed between control and injured SCGs removed 15, 30 and 60 min after axotomy (data not shown).

We also investigated, by Western immunoblot, tPA protein levels in control and injured SCGs, removed at the same postoperative times chosen for the zymographic assay. The polyclonal antibody used revealed two bands at approximately 40 kDa and 30 kDa, which correspond to the heavy and light chains of tPA, respectively (Fig. 1B). A disparity in the intensity of labeling has always been observed between the two bands and this may arise from the higher number of epitopes that may be recognized by this polyclonal antibody on the heavy chain in respect to the light chain. Densitometric analysis (Fig. 1B'), carried out on three blots, showed that, although the intensity of both bands increased in comparison with the control from 1 day post-axotomy, the only statistically significant difference was observed in the 30-kDa band between the control and 5 days after axotomy. Similarly to the plasminogen/ casein zymography, no significant difference in tPA protein level was ever observed on Western blot between control and injured SCGs removed 15, 30 and 60 min after axotomy (data not shown). Plasminogen activity was revealed by casein gel zymography using aliquots of the same SCG extracts tested for tPA. Fig. 1C shows a typical casein gel zymography. A single lytic band was detected at approximately 90 kDa in both control and injured SCGs and was identified as plasminogen based on its molecular mass and alignment with the lytic band of the human recombinant plasminogen used as standard. The intensity of the band increased in comparison with the control by 1 day, as also revealed by densitometric analysis (Fig. 1C') carried out on four zymographies; this increase became significant by 3 days post-injury. Incubation of casein gel zymographies with 1 mM PMSF impeded the formation of the lytic band,

Fig. 2. Effect of post-ganglionic nerve crush on annexin II (ann II) protein level and its association with plasminogen (plgn). (A) Annexin II Western immunoblot of control (ct) and injured (1, 3, 5 days post-axotomy) SCGs. The intensity of the band stained by the anti-annexin II antibody (∼36 kDa) increases after injury. (A') Densitometric analysis of annexin II band (n = 5). Values are expressed as the ratio between the optical density (OD) of the bands in injured SCGs and the OD of the bands in control SCGs (OD injured/OD control) and analyzed by Student's t test. ⁎P ≤ 0.05, ⁎⁎P ≤ 0.01. (B) Plasminogen Western immunoblot of control (ct) and 5 days post-axotomy SCGs. Tissue extracts were immunoprecipitated with anti-annexin II, separated on SDS–PAGE (4–12%) gradient gel and transferred onto nitrocellulose. Plasminogen is co-immunoprecipitated by the anti-annexin II antibody, as revealed by the band at about 90 kDa recognized by the anti-plasminogen antibody. The band at about 36 kDa corresponds to annexin II. As expected, both annexin II and plasminogen levels are higher in the 5-day injured than in control SCG extracts. (C) Western immunoblot of plasminogen and annexin II of control (ct) and injured (1, 3, 5, 21 and 40 days after injury) SCGs showing that the level of both proteins is still very high 21 days after injury and decreases at 40 days.

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

177

confirming that this activity is serine proteinase specific (data not shown). Plasminogen protein level evaluation by Western immunoblot was in agreement with the results obtained by gel zymography. A single band at approximately 90 kDa was observed in both control and injured (1, 3 and 5 days post-axotomy) SCG tissue extracts (Fig. 1D). The intensity of the band in injured ganglia increased significantly in comparison with the control by 1 day post-axotomy (Fig. 1D') (densitometric analysis carried out on four blots). No changes in the plasminogen protein levels were observed in the SCGs of sham operated rats, compared with those of control rats (not shown).

levels were observed in the SCGs of sham operated rats, compared with those of control rats (not shown). To verify whether the interaction between plasminogen and annexin II also occurred in our experimental model, we investigated the presence of plasminogen in tissue extracts of control and 5-day injured SCGs immunoprecipitated with the anti-annexin II monoclonal antibody (Fig. 2B). Western immunoblots revealed the presence of both plasminogen and annexin II in all the anti-annexin II immunoprecipitates. The levels of both proteins were higher in 5day injured SCGs than in controls. In contrast, when tissue samples were immunoprecipitated with mouse IgGs, both plasminogen and annexin II were absent.

Effect of axotomy on annexin II protein level and its interaction with plasminogen in control and injured SCGs

Levels of plasminogen and annexin II at later stages of the response of SCG neurons to axotomy

The cleavage of plasminogen to active plasmin by tPA, requires its link with a membrane receptor. The receptor in some tissues for both tPA and plasminogen is annexin II (Hajjar et al., 1994; Hamre et al., 1995; Melchor and Strickland, 2005; Gveric et al., 2005). First we analyzed possible changes in annexin II protein levels in aliquots of the same SCG tissue extracts used to reveal tPA and plasminogen. A band at approximately 36 kDa (Fig. 2A) was detected in both control and injured SCGs. The intensity of the band progressively and significantly increased, starting 1 day after post-ganglionic nerve crush, as shown by densitometric analysis (Fig. 2A') (densitometric analysis carried out on five blots). No changes in the annexin II protein

The changes in enzymatic activities and protein levels of components of the PAs/plasmin enzymatic system so far described refer to a time window after axotomy in which major changes in the neuronal organization and intraganglionic synaptic arrangement occur (Zaccaria et al., 1998; Del Signore et al., 2004). We therefore verified whether the modifications in plasminogen and annexin II protein levels observed at earlier dates after post-ganglionic nerve crush (1, 3 and 5 days post-axotomy) were still ongoing at later stages (21 and 40 days post-axotomy), suggesting a long lasting and diversified activity of the PAs/plasmin system. As shown in Fig. 2C, protein levels of both plasminogen and annexin II

Fig. 3. Time course of the changes in relative levels of PAI-1, annexin II, tPA and plasminogen mRNA after SCG neuron axotomy. tPA mRNA level was evaluated by semiquantitative RT-PCR, while the others were evaluated by real-time RT-PCR. The results were obtained using 3 independent pools of SCGs for each experimental condition. mRNA levels are expressed as percentages of the respective control and plotted as a function of the postoperative times. Data were analyzed by Student's t test. ⁎P ≤ 0.05, ⁎⁎P ≤ 0.01.

178

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

remained higher than controls until 21 days after axotomy and decreased at 40 days. tPA, PAI-1, plasminogen and annexin II mRNAs are affected by SCG neuron axotomy To evaluate whether the changes in enzymatic activity and protein levels of components of the tPA/plasmin system so far observed had also a counterpart in gene expression, we evaluated mRNA levels of tPA, plasminogen, annexin II and PAI-1, the endogenous inhibitor of tPA, by RT PCR (Fig. 3). As also shown by Del Signore et al. (2006), mRNA levels for PAI-1 and annexin II were significantly higher than controls 15 min and 1 day after axotomy, respectively. Together with the level of tPA, they remained significantly higher than controls until 5 days after axotomy. In contrast, the plasminogen mRNA level showed an opposite tendency, decreasing significantly between 6 h and 1 day after axotomy and returning to control levels 3 days after axotomy. Plasmin(ogen) immunolocalization in control and injured SCG Immuno-light and electron microscopy for plasmin(ogen) was performed in order to evaluate the cellular and subcellular localization of the final enzymatic components of the proteolytic cascade in control and injured SCGs. The postoperative dates considered were 1 (electron microscopy only) and 5 days post axotomy. At the light microscope, plasmin(ogen) immunoreactivity in uninjured SCGs was scanty, with scattered areas of the ganglion showing some pale extracellular labeling. Neuronal cell bodies were apparently unstained and immunopositivity was preferentially associated with blood capillaries (Fig. 4A). At a higher magni-

fication, however, the paucity of the extracellular labeling allowed to observe thin, immunopositive nerve fiber-like structures bearing varicosities along their path (Fig. 4B). Immunolabeling was also present in the cell bodies of perineuronal satellite cells (Fig. 4C and inset), which often outlined the neuronal profiles with their thin immunopositive processes (Fig. 4C). Five days after post-ganglionic nerve crush, plasmin(ogen) immunolabeling increased consistently compared to control (Fig. 4D). An abundant immunoreaction product filled the extracellular spaces and was so intense that often higher magnifications could not help in the identification of further immunolabeled elements. Neuronal cell bodies were still apparently unlabeled. However, electron microscopy showed plasmin(ogen) immunolabeling in all cell types of control SCGs: neurons (Fig. 5A), satellite cells, other non-neuronal cells (Fig. 5B) endowed with long thin processes, which surrounded clusters of neurons, and endothelial cells of blood capillaries. The protein occurred mainly in large multivesicular-like bodies scattered within the cytoplasm of the different cell types (Figs. 5A, B), although a more diffuse staining could also be observed, especially in non-neuronal cells. As seen at the light microscope, some extracellular labeling (Fig. 5A) was present in scattered areas of the ganglia. Immunopositivity was also observed within some of the intraganglionic axons (Fig. 5C) and pre-synaptic boutons (Fig. 5D), recognizable as cholinergic by the rounded appearance of their synaptic vesicles. Immunolabeling was mainly associated with vesicle-like structures (Fig. 5D). Plasmin(ogen) cellular localization did not change respect to controls after post-ganglionic nerve crush. The most striking difference was the amount of extracellular immunolabeling, associated with the ECM, which increased consistently (Figs. 5E–G). The immunoreaction product surrounded all ganglionic cellular elements and a more intense rim of immunopositivity was clearly detectable at their

Fig. 4. Changes in plasmin(ogen) immunolabeling in control and injured (5 postoperative days) SCGs. (A–C and inset) Control SCG. (A) Plasmin(ogen) immunolabeling is scanty. At this magnification, blood vessels (arrows) are recognizable as the most immunopositive structures inside the ganglion. (B) At high magnification, immunopositive nerve fiber-like structures (arrowheads), bearing varicosities, are seen in between ganglionic neurons. (C and inset) Strongly immunopositive non-neuronal cells (double arrows) abut ganglionic neurons and emit long processes (arrowheads), which surround the neuronal perikaryon. (D) After post-ganglionic nerve crush, plasmin(ogen) immunolabeling increases notably, filling all the extracellular spaces. Scale bars: A, D: 50 μm; B, C and inset: 25 μm.

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

179

Fig. 5. Subcellular distribution of plasmin(ogen) immunoreactivity in control and injured (1 and 5 postoperative days) SCGs. (A–D) Control SCGs. Intense plasminogen immunoreactivity is associated with multivesicular-like bodies (arrows) localized in the perikaryon of a neuron (A) and a non-neuronal cell (B). As shown in A, some immunopositivity is also present in the extracellular space (asterisk). n: nucleus; b: pre-synaptic bouton. (C) An intraganglionic axon (a) shows intense aggregates of immunoreactivity. v: cluster of synaptic vesicles; Sc: non-myelinating Schwann cell. (D) Plasminogen immunolabeling in a presynaptic cholinergic bouton associated to vesicle-like elements (arrows). (E–G) Injured SCGs. After post-ganglionic nerve crush, a strong plasmin(ogen) immunoreactivity localizes in the extracellular spaces. A more intense rim of immunopositivity (double arrowheads) is observed at the cell surfaces. (E) A cluster of pre-terminal axons (a) is surrounded by intense extracellular immunoreactivity. The arrowhead indicates a pool of synaptic vesicles within one of the axons. Sc: non-myelinating Schwann cell. (F) Plasmin(ogen) immunolabeling decorates the contour of these dendritic branches of different sizes, packed together at the surface of a ganglionic neuron (N). An immunopositive multivesicular-like body is indicated in one of them (arrow). (G) A pre-synaptic bouton (b) is detaching from a neuron (N) aided by thin processes of perineuronal satellite cells (arrowheads). An intense immunoreaction product surrounds the synaptic elements and intrudes in between them. a: pre-ganglionic axon. Scale bar: A–D: 1 μm; E, G: 1,5 μm; F: 0,8 μm.

surface (Figs. 5E–G), where plasminogen binding to its receptor and cleavage into plasmin occurs. Especially in 5-day injured ganglia, we observed plasmin(ogen) immunoreactivity distributed in be-

tween clustered dendritic branches of different sizes (Fig. 5F), suggesting remodeling of the SCG neuron dendritic trees. Immunolabeling increased also in those areas along the neuronal

180

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

cell bodies where pre-ganglionic synaptic boutons were detaching (Fig. 5G), aided by perineuronal satellite cells. Although a statistical analysis was not performed, the number of immunopositive multivesicular-like bodies was lower at both the postoperative dates chosen (1 and 5 days post-axotomy), suggesting exocytosis of the plasminogen in the extracellular space, in which it is activated to become plasmin. Discussion The plasminogen/plasmin enzymatic system is a proteolytic pathway that in the nervous system has been shown to be activated not only in pathological conditions leading to inflammation and neuronal death (Cuzner et al., 1996; Zhang et al., 2003; East et al., 2005; Gveric et al., 2005; Mali et al., 2005), but also in physiological conditions resulting in neuronal circuits remodeling (reviewed in Melchor and Strickland, 2005; Seeds et al., 1996; Muller and Griesinger, 1998; Akassoglou et al., 2000; Sallés and Strickland, 2002; Berardi et al., 2004; Samson and Medcalf, 2006). Components of the ECM are the main targets of the PAs/plasmin proteolytic system, the activity of which, as for all proteolytic systems, needs to be finely balanced since the borderline between its beneficial and detrimental effects is very labile. This is achieved by a perfect timing in the expression of enzymatic activators and inhibitors, that for tPA are PAI-1 and neuroserpin (reviewed in Melchor and Strickland, 2005). In this study, we show that axotomy of SCG neurons, which survive to this type of injury, regenerate their axons and re-establish peripheral connectivity (Matthews and Raisman, 1972; Del Signore et al., 2004), induces changes in all components of the plasmin enzymatic cascade we examined: activators (tPA), receptors (annexin II), effectors (pasmin(ogen)) and inhibitors (PAI-1). Effects of axotomy on the activity and/or expression of components of the tPA/plasmin enzymatic pathway In the brain, tPA has been identified as the principal PA constitutively expressed by neurons and microglial cells in regions involved in learning and memory (hippocampus), emotional states (amigdala), motor learning (cerebellum) and autonomic and endocrine functions (hypothalamus) (reviewed in Melchor and Strickland, 2005). In these CNS regions, tPA is involved in the regulation of synaptic plasticity and neuronal activity, either through activation of the classic plasmin cascade (reviewed in Melchor and Strickland, 2005; Sallés and Strickland, 2002; Madani et al., 2003) or by a direct modulatory effect on glutamatergic and dopaminergic pathways (Nicole et al., 2001; Matys and Strickland, 2003; Samson and Medcalf, 2006). On the other hand, uPA, which is synthesized mostly in cells associated with inflammatory processes (i.e. monocytes, macrophages and activated T cells) (Garcia-Monco et al., 2002), is barely detectable in the normal brain. tPA, rather than uPA, is also synthesized and released by sympathetic neurons, including SCG, both in vivo (reviewed in O'Rourke et al., 2005; Hao et al., 2006) and in vitro (AlvarezBuylla and Valinsky, 1985; Jiang et al., 2003), and in cultured sympathetic neuron analogues, as PC12 and chromaffin cell lines (Parmer et al., 1997). The expression of tPA mRNA (by Northern blot) and protein (by immunohistochemistry) has been shown specifically in cell bodies and axons of SCG neuron innervating resistance vessel walls (reviewed in O'Rourke et al., 2005). We show that tPA is not only constitutively expressed, but it is also activated in rat SCG. Plasminogen gel zymography, in fact,

revealed two lytic bands in SCG extracts, one at about 70 kDa and the other at about 30 kDa, that could correspond to the onepolypeptide chain tPA and to the light chain tPA, respectively. This is in agreement with previous reports showing that human tPA, isolated from different tissues and cell cultures (for reference, see Rijken and Groeneveld, 1986), has a molecular mass of approximately 70 kDa and consists of one-polypeptide chain. During isolation procedures and fibrinogenolysis, the 70 kDa is converted into a two-chain form, consisting of a heavy chain of approximately 38 kDa and a light chain of approximately 31 kDa, connected by a disulphide bridge. Only the light chain contains the active site and can therefore be detected by gel zymography along with the one-polypeptide chain. Both tPA heavy and light chains were detected by Western immunoblot. Along with tPA, also the other components of the PAs/plasmin enzymatic system that we have investigated (i.e. plasminogen, annexin II and PAI-1) are constitutively expressed in rat SCG. After axotomy of the ganglionic neurons, we found that activity (tPA and plasminogen) and protein (tPA, plasminogen, annexin II) levels progressively increased. Notably, tPA activity was significantly higher than the control 1 day after injury preceding, as expected, the increase in plasminogen activity. Moreover, tPA mRNA upregulation parallels the increase in its protein level observed by Western immunoblot. Being activation of tPA the first critical step in the initiation of the proteolytic cascade, a strict control over its activity is required to protect the ECM from excessive degradation. Our data strongly suggest that this control is present, as SCG neuron axotomy upregulates PAI-1 mRNA as early as 15 min after injury while downregulates plasminogen mRNA, thus controlling the level of tPA substrate. However, PAI-1 may also have other functions than that most commonly known as PAs inhibitor. PAI-1 synthesized by macrophages and monocytes is a potent chemoattractant molecule that induces cell migration through changes in cell morphology and cytoskeleton organization in response to tissue injury, or inflammatory processes (Degryse et al., 2004; Cao et al., 2006). This same effect has also been described for motility of invasive breast cancer cells (Chazaud et al., 2002). In our experimental model, there are no ongoing inflammatory processes within the ganglion (Leone et al., 2005), but perineuronal satellite cells show intense morphological changes, i.e. emission of processes, which intrude between pre- and post-synaptic elements contributing to synaptic detachment (synaptic stripping) (Matthews and Raisman, 1972; Del Signore et al., 2004). Injured neurons also undergo cytoskeletal reorganization as they form new growth cones leading to axonal regeneration. We can thus hypothesize that PAI-1 may be synthesized by neuronal and/or non-neuronal cells and play a role in promoting cell motility within the ganglion and/or at the site of crush, in this last case after being transported along the regenerating axons. Annexin II is a co-receptor for both tPA and plasminogen that enhances tPA-dependent plasminogen activation and focalizes proteolytic activity at the cell surface (Hajjar et al., 1994; Gveric et al., 2005). There is evidence that annexin II is involved in neuronal differentiation and development in different areas of the CNS and PNS (Hamre et al., 1995). Moreover, by using cultured PC-12 cells it has been shown that annexin II is transcriptionally up-regulated by nerve growth factor and that annexin II-mediated plasmin generation at the cell surface may be important for neurite development (Jacovina et al., 2001). Accordingly, after SCG neuron axotomy, we found a significant increase in annexin II protein level in parallel with that of tPA and plasminogen. Co-immunoprecipitation of

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

annexin II and plasminogen has definitively demonstrated that their interaction occurs also in our experimental model, confirming annexin II as a receptor for this enzymatic system in SCG. Plasmin(ogen) immunolocalization in control and injured SCG As the synthesis and localization of tPA has been demonstrated in SCG neurons (reviewed in O'Rourke et al., 2005), we investigated, in both control and injured SCGs, whether plasminogen is synthesized and released by neurons, or by other sources. Our immuno-light and electron microscopy experiments demonstrated that both neurons and non-neuronal cells, as well as endothelial cells of the capillaries, express plasminogen. The presence of immunopositive large multivesicular-like elements in the cytoplasm of all these cells, especially in control ganglia, suggests intracellular storage of plasminogen, the exocytosis of which can be promptly triggered by retrograde injury signal/s. This is strongly suggested by the increase in extracellular plasmin(ogen) immunoreactivity observed after SCG neuron axotomy. Interestingly, immunoreactivity increased not only in the broad spaces, rich in ECM, separating clusters of neurons, but also in the narrow gaps between adjacent dendritic branches and between neuronal somata and pre-synaptic boutons. This suggests an involvement of the tPA/plasmin system in both remodeling of dendritic tree architecture and synaptic detachment induced by axonal injury. Similarly to plasminogen, a vesicular mechanism of storage and release has also been demonstrated for tPA (reviewed in Melchor and Strickland, 2005). In particular, it has been shown that tPA expressed by PC12 chromaffin cells is targeted to the regulated pathway of secretion (into catecholamine storage vesicles) and is coreleased with catecholamines by chromaffin cell stimulation (Parmer et al., 1997). A similar system of regulated release of plasminogen could explain the observed decrease in its mRNA levels, as immediate local synthesis would not be required. On the other hand, we also observed an increase in plasminogen protein level by Western immunoblot, which may be the consequence of increased protein synthesis from pre-existing mRNA and/or decreased plasminogen degradation. The presence of plasminogen immunoreactivity in preganglionic boutons strongly supports the hypothesis that this increase may be also partly due to plasminogen axonally transported by preganglionic neurons. Moreover, we do not exclude that part of the plasmin(ogen) immunoreactivity observed in the large extracellular spaces among the ganglionic neurons, where blood capillaries are also situated, could be blood-borne. Final remarks and conclusions The SCG reaction to post-ganglionic nerve crush is characterized by two main structural/physiological events, which involve both neuron and non-neuronal cells: (1) the satellite cell-mediated temporary detachment of pre-synaptic boutons from the injured neurons and (2) the axonal regeneration and re-establishment of synaptic contact with peripheral targets (Del Signore et al., 2004). On the basis of our results, we can hypothesize different roles for the tPA/plasmin pathway in the SCG after injury. Up-regulation of tPA/plasmin activity observed few days after injury (1–5 days), i.e. when the disassembly of intraganglionic synapse overcomes their reassembly, which prevails at later stages (Del Signore et al., 2004), suggests its involvement in synapse remodeling, possibly through ECM degradation. Both neurons and satellite cells contribute to this process, as indicated by plasminogen immunolocalization. Our data are in agreement with the demonstration that

181

the tPA/plasmin cascade is important for reverse occlusion plasticity in the visual system (Muller and Griesinger, 1998). Axonal transport of components of the tPA/plasmin system to the site of crush, which is important for axonal regeneration through the ECM within the injured post-ganglionic nerves, is another element to be taken into consideration. The presence of high levels of plasminogen and annexin II 21 days after injury, when the intraganglionic synapses have been re-established and the majority of the regenerating axons are reaching the peripheral targets (Matthews and Raisman, 1972; Del Signore et al., 2004), suggests that the tPA/plasmin system is also involved in the process of axonal regeneration. Indeed, a role of the PAs/plasmin system has been shown in the regeneration of peripheral nerve axons after sciatic nerve injury (Siconolfi and Seeds, 2001; Akassoglou et al., 2000). The possible involvement of plasmin in the activation of MMP2 and MMP-9 (Baramova et al., 1997; Monea et al., 2002) and in MMP-9 gene expression by triggering intracellular signal transduction has been demonstrated (Hu et al., 2006). As we have previously reported activation of the MMP-2 with the same time course here described for the tPA/plasmin system, we hypothesize the possibility of cooperation between the two enzymatic pathways. Further investigations are in progress to clarify this aspect and will be object of future studies. Experimental methods Animals and surgical procedures Male Wistar rats (150–200 g) were used (Charles River S.P.A., Calco, Italy). The animals were housed and handled in accordance with the guidelines established by the European Community Council Directive (86/609/ EEC of 24 November 1986) and the American Society for Neuroscience. Rats were anesthetized by an intraperitoneal injection of 0.5 ml/kg body mass of Rompun (20 mg/ml xylazine) (Bayer, Leverkusen, Germany) and 0.5 ml/kg body mass of Zoletil (100 mg/ml tiletamine and zolazepam) (Virbac, Carros, France). Neurons of the right SCG were axotomized by crushing the post-ganglionic nerves as previously described (Zaccaria et al., 1998). Sham operation To assess the effect of the sole surgical procedure on the activation of the PAs/plasmin enzymatic cascade, sham operations were performed on four rats. This consists of exposing the SCG and its post-ganglionic nerve trunks, but leaving them undamaged. Rats were killed 3 days after surgery, a postoperative time when changes in the activity and protein levels of tPA, plasminogen and annexin II induced by SCG neuron axotomy were mostly significant. The SCGs were dissected and evaluated by Western immunoblot for plasminogen and annexin II protein levels, as described below. Antibodies The mouse monoclonal antibody against annexin II (diluted 1:5000) was from Transduction Laboratories (San Josè, CA, USA), goat polyclonal antibody against tPA (diluted 5 μg/ml) was from American Diagnostica (Stamford, CT, USA) and rabbit polyclonal antibody against plasminogen (diluited 1:500) was from Molecular Innovations (Southfield, MI, USA). Plasminogen activators and plasminogen zymographies Control (unoperated) and operated rats (15, 30, 60 min and 1, 3, 5 days post-axotomy) were anesthetized with Forane (Abbot, Campoverde di Aprilia, Italy) and killed by decapitation. SCGs were rapidly dissected, frozen

182

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

on dry ice and stored at − 80 °C until use. Pools of two ganglia for each experimental condition were homogenized, using a ground-glass microhomogenizer, in ice-cold non-reducing extraction buffer containing 20 mM Tris/HCl pH 7.6, 150 mM NaCl, 1% Nonidet P-40, 1 mM Na3VO4, according to Mali et al. (2005). After centrifugation (15,000×g at 4 °C for 5 min), the supernatants were collected and measured aliquots were used for protein determination using the Micro BCA kit (Pierce, Rockford, IL, USA). Ganglia extracts containing equal amounts of protein (40 μg) were mixed (1:3) with SDS gel-loading buffer and loaded, without reduction or heating, onto 10% SDS–polyacrylamide gel (SDS–PAGE) containing either 50 μg/ml of plasminogen (Calbiochem, La Jolla, CA, USA) and 0.5% Carnation instant non-fat milk (as source of casein) (Nestlé, USA), to determine PA activities, or 0.5% Carnation instant non-fat milk, to determine plasminogen activity. After electrophoresis at 4 °C, gels were washed 2 × 30 min with 2.5% Triton X-100 and finally incubated at 37 ° C in 0.1 M glycine buffer pH 8.01 to allow substrate proteolysis in the gels. Gels were stained with 0.5% Coomassie Brilliant Blue-R250 and de-stained with a solution containing 30% methanol and 20% acetic acid. Human recombinant tPA, or plasminogen, were run for comparison. Colorburst ™ Electrophoresis Markers, Wide Range (SigmaAldrich, Milano, Italy), or Molecular Weight Standard Mixture (SigmaAldrich), used as molecular mass standards, were also run on all gels. The specificity of tPA activity in the zymograms was confirmed by incubating the gels with either 1 mM phenylmethylsulphonyl fluoride (PMSF; Sigma), or 1 μM of the synthetic tPA inhibitor 2,7-bis-(4-amidinobenzylidene)cycloheptanone-1 dihydrochloride (tPA-STOP) (American Diagnostica), or 200 μM amiloride (Sigma-Aldrich), which at this concentration inhibits uPA, but not tPA (Zhang et al., 2003). The area cleared by tPA and plasmin(ogen) in the zymograms was scanned on a flat-bed scanner and the relative levels of protease activity were determined using an image analysis software (ImageQuant, Amersham Biosciences Europe GmbH, Cologno Monzese, Italy). The results, derived from five independent experiments for tPA and four for plasminogen, were evaluated for statistical significance using the two-tail Student's t test. Differences were considered significant for p b 0.05.

centrifugation (13000×g), the supernatants were incubated with either antiannexin II monoclonal antibody or mouse IgGs; protein G-Sepharose beads were used to immunoprecipitate antigen–antibody complex. After a rinse in TBS, the beads were resuspended in Laemmli buffer and immunoprecipitated proteins were separated on an SDS–polyacrylamide gradient gel (4–12%) and identified by Western immunoblotting using either anti-plasminogen or antiannexin II antibodies. RNA extraction, quantification and reverse transcription RNA was isolated from operated and control ganglia using the RNeasy Micro Kit (Qiagen, Milan, Italy) following the manufacturer's instructions, including the DNase digestion step. RNA concentration was determined by spectrophotometric analysis and its integrity was confirmed on ethidium bromide-stained agarose–formaldehyde gels. Two micrograms of total RNA were reverse-transcribed using random hexanucleotides (Promega, Milan, Italy) as primers, as previously described (Leone et al., 2005). Analysis of tPA mRNA level by semiquantitative reverse transcriptase-polymerase chain reaction Pools of control and operated ganglia (2–3 ganglia/pool) at each postoperative time (15 min, 1 and 6 h and 1, 3 and 5 days post-axotomy) were used. RT-PCR and densitometric analysis were performed as previously described (Leone et al., 2005). Briefly, 1/20 of the cDNA obtained after reverse transcription (corresponding to 100 ng of RNA) and 1 μCi [32P]dCTP (3000 Ci/mmol, Amersham Biosciences) were used in each reaction. Hypoxanthine phosphoribosyl-transferase (HPRT) was used as internal control (Steel and Buckley, 1993). Primer pairs were designed to span at least one intron to avoid genomic DNA amplification. After a first denaturing step at 95 °C for 8 min, PCR amplification was performed for 28 cycles (95 °C for 30 s; 55 °C for 30 s; 72 °C for 1 min) followed by a final extension step (72 °C for 5 min). Primers used are listed in Table 1 together with the length of amplified fragments.

Electrophoresis and immunoblotting Pools of two ganglia for each experimental condition (control and 15, 30, 60 min, and 1, 3, 5, 21, 40 days post-axotomy) were homogenized as described above, but using a RIPA buffer containing 50 mM Tris/HCl pH 7.6, 150 mM NaCl, 1% SDS, 1% Triton X-100, 1% of a cocktail of inhibitors, 1 mM PMSF, 1 mM EDTA, 0.2 mM Na3VO4 and 0.1 mM NaF. After centrifugation (15,000×g for 15 min at 4 °C), the supernatants were collected and measured aliquots were used for protein determination. For each sample, 40 μg of proteins were separated on 10% SDS–polyacrylamide gels. Molecular mass standards and either human recombinant tPA or plasminogen, used as positive controls, were run with SCG extracts on the same gel and transferred onto nitrocellulose membranes. Non-specific binding sites were blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.05% Tween-20 (TTBS) and the membranes were incubated overnight at 4 °C with one of the primary antibodies, all diluted with 3% BSA, 0.05% NaN3 in TTBS. After a rinse in buffer, membranes were incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (1:10000 dilution) (Promega, Madison, WI, USA) for 1 h at room temperature. The reactive bands were detected using an enhanced chemiluminescence (ECL) kit (Pierce, Rockford, IL, USA) and exposing the membranes to Kodak X-OMAT films (Cedex, France). Densitometric analysis of band intensities was performed as described above on three filters for tPA, four filters for plasminogen and five filters for annexin II. Data were evaluated for statistical significance using the two-tail Student's t test. Differences were considered significant for p b 0.05. Immunoprecipitation Two pools (4 ganglia/pool) of control and 5-day injured SCGs were homogenized in 20 mM Tris/HCl pH 6.8, 3 mM MgCl2, 50 mM NaCl, 300 mM sucrose, 1% Triton X-100 (v/v) containing 1 mM PMSF and 2 μg/ml each of aprotinin, leupeptin and pepstatin, according to Diaz et al. (2004). After

Analysis of plasminogen, annexin II and PAI-1 mRNA levels by Real-time PCR Pools of control or operated ganglia (1–2 ganglia/pool) were used in triplicate for each time point (15 min, 6 h 1, 3 and 5 days post-axotomy). Real-time PCR was performed as previously described (Del Signore et al., 2006). cDNA (1/50) obtained after reverse transcription (corresponding to 40 ng of RNA) was amplified in a 25-μl reaction mixture containing 1× SYBR Green JumpStart Taq ReadyMix (Sigma, Milan, Italy) and 0.2 mM of each primer. Hypoxanthine-phospho-ribosyl-transferase (HPRT) was used as

Table 1 Primers (5′–3′) used for reverse transcriptase-polymerase chain reaction (RT-PCR) experiments Gene

Primer

Length (bp)

HPRT

F: AGTCCCAGCGTCGTGATTAG R: CCATCTCCTTCATGACATCTCG F: CAGGTCATTCCAGTACCACAGC R: TTGCCGATGCCAGTCTTACAC F: AGCACTACAAAAGGTCAAGATCG R: GCCGAACCACAAAGAGAAAGG F: GCCCCTGTACTTTGCTGAC R: TGCGAGAGACCATGATTCTAATC F: CCTGCTGGATTACATTAAAGCACTG R: CCTGAAGTACTCATTATAGTCAAGG F: AGAAAATGGGGCTGAATGC R: CAAGGGTGTGAGGTGATGTCT

160

Plasminogen PAI-1 Annexin II ⁎HPRT ⁎TPA

44 134 89 370 549

This table shows the forward (F) and reverse (R) primer sequences with length of amplified fragments (bp) used in real time RT-PCR experiments. ⁎Shows primer sequences used in semiquantitative RT-PCR.

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184 internal standard (Steel and Buckley, 1993); amplification efficiencies of HPRT and of all genes of interest were set to be approximately equal. Primers used are listed in Table 1 together with the length of amplified fragments. Differences in expression were calculated and statistically analyzed as previously described (Del Signore et al., 2006) using the 2− ΔΔCt method (Livak and Schmittgen, 2001) and Student's t test. Immunohistochemistry Two animals for each experimental point were used (control, 1 and 5 days post-axotomy) to immunolocalize plasminogen. Rats were deeply anesthetized and perfused transcardially with an oxygenated Ringer solution, pH 7.3, followed by a fixative composed of freshly depolymerized paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4. Ganglia were dissected 1 h after perfusion. Light microscopy After overnight cryoprotection in 30% sucrose, SCGs were embedded in OCT compound, cut into 14-μm sections on a cryostat and collected free floating in PB. Sections were processed for plasminogen immunohistochemistry using the peroxidase-anti-peroxidase (PAP) procedure as previously described (De Stefano et al., 1997). The rabbit anti-plasminogen antibody was diluted 1:700. The secondary antibodies used were goat antirabbit IgG (diluted 1:300) and rabbit PAP (1:300) and were purchased from Sternberger Monoclonals Inc. (Baltimore, MD. USA). Antibody binding sites were revealed by 3,3′-diaminobenzidine-H2O2 (DAB) reaction developed for 20 min. Negative controls were obtained by omitting the primary antibody. Sections were mounted on glass slides, observed at a Zeiss light microscope equipped with a Canon PowerShot G6 digital camera. Selected pictures were processed with Adobe Photoshop to optimize contrast and brightness. Electron microscopy Once dissected, SCGs were embedded in 4% bacto agar and cut on a vibratome into 40-μm-thick sections, collected free floating. To allow antibody penetration into the tissue, sections were cryoprotected first in 10% DMSO and 1% glycerol (1× 10 min at 4 °C), then in 20% DMSO and 2% glycerol (2× 10 min) and then frozen-thawed 3 times in liquid nitrogen-cooled isopentane. Immunohistochemistry and the subsequent processing of the specimens for electron microscopy were performed as previously described (De Stefano et al., 1997). As for light microscopy, antibody binding sites were revealed by DAB reaction, developed for 10 min. Negative controls were obtained by omitting the primary antibody. Ultrathin sections (60–70 nm) were cut on a Reichert ultramicrotome, lightly counterstained with lead citrate to avoid shading of the reaction product and observed at a Philips EM208S transmission electron microscope operated at 60 kV. Images were acquired with a digital camera (Megaview III, Soft Image System) and processed with Adobe Photoshop to optimize contrast and brightness.

Acknowledgments This work was partially supported by MIUR (Cofin 2006, Ateneo 2005), Istituto Pasteur-Fondazione Cenci Bolognetti and Agenzia Spaziale Italiana (ASI, DCMC grant) to P.P. and by Ministero della Salute (Malattie Neurodegenerative ex art.56) to T.C.P. References Alvarez-Buylla, A., Valinsky, J.E., 1985. Production of plasminogen activator in cultures of superior cervical ganglia and isolated Schwann cells. Neurobiology 82, 3519–3523. Akassoglou, K., Kombrinck, K.W., Degen, J.L., Strickland, S., 2000. Tissue plasminogen activator-mediated fibrinolysis protects against axonal

183

degeneration and demyelination after sciatic nerve injury. J. Cell Biol. 149 (5), 1157–1166. Baramova, E.N., Bajou, K., Remacle, A., L'hoir, C., Krell, H.W., Weidle, U.H., Noel, A., Foidart, J.M., 1997. Involvement of PA/plasmin system in the processing of pro-MMP-9 and in the second step of pro-MMP-2 activation. FEBS Lett. 405, 157–162. Baranes, D., Lederfein, D., Huang, Y.Y., Chen, M., Bailey, C.H., Kandel, E.R., 1998. Tissue plasminogen activator contributes to the late phase of LTP and to synaptic growth in the hippocampal mossy fiber pathway. Neuron 21 (4), 813–825. Berardi, N., Pizzorusso, T., Maffei, L., 2004. Extracellular matrix and visual cortical plasticity: freeing the synapse. Neuron 44 (6), 905–908. Cai, G., Chen, X., Fu, B., Lu, Y., 2005. Activation of gelatinases by fibrin is PA/plasmin system-dependent in human glomerular endothelial cells. Mol. Cell. Biochem. 277, 171–179. Calabresi, P., Napolitano, M., Centonze, D., Marfia, G.A., Gubellini, P., Teule, M.A., Berretta, N., Bernardi, G., Frati, L., Tolu, M., Gulino, A., 2000. Tissue plasminogen activator controls multiple forms of synaptic plasticity and memory. Eur. J. Neurosci. 12 (3), 1002–1012. Cao, C., Lawrence, D.A., Li, Y., Von Arnim, C.A., Herz, J., Su, E.J., Makarova, A., Hyman, B.T., Strickland, D.K., Zhang, L., 2006. Endocytic receptor LRP together with tPA and PAI-1 coordinates Mac-1-dependent macrophage migration. EMBO J. 25 (9), 1860–1870. Chazaud, B., Ricoux, R., Christov, C., Plonquet, A., Gherardi, R.K., Barlovatz-Meimon, G., 2002. Promigratory effect of plasminogen activator inhibitor-1 on invasive breast cancer cell populations. Am. J. Pathol. 160 (1), 237–246. Cuzner, M.L., Gveric, D., Strand, C., Loughlin, A.J., Paemen, L., Opdenakker, G., Newcombe, J., 1996. The expression of tissue-type plasminogen activator, matrix metalloproteases and endogenous inhibitors in the central nervous system in multiple sclerosis: comparison of stages in lesion evolution. J. Neuropathol. Exp. Neurol. 55, 1194–1204. Degryse, B., Neels, J.G., Czekay, R.P., Aertgeerts, K., Kamikubo, Y., Loskutoff, D.J., 2004. The low density lipoprotein receptor-related protein is a mitogenic receptor for plasminogen activator inhibitor-1. J. Biol. Chem. 279 (21), 22595–22604. Del Signore, a., Gotti, C., Rizzo, A., Moretti, M., Paggi, P., 2004. Nicotinic acetylcholine receptor subtypes in the rat sympathetic ganglion: pharmacological characterization, subcellular distribution and effect of preand postganglionic nerve crush. J. Neuropathol. Exp. Neurol. 63 (2), 138–1150. Del Signore, A., De Sanctis, V., Di Mauro, E., Negri, R., Perrone-Capano, C., Paggi, P., 2006. Gene expression pathways induced by axotomy and decentralization of rat superior cervical ganglion neurons. Eur. J. Neurosci. 23 (1), 65–74. De Stefano, M.E., Zaccaria, M.L., Cavaldesi, M., Petrucci, T.C., Medori, R., Paggi, P., 1997. Dystrophin and its isoforms in a sympathetic ganglion of normal and dystrophic mdx mice: immunolocalization by electron microscopy and biochemical characterization. Neurosci. 80 (2), 613–624. Diaz, R., Hurtado, M., Thomson, T.M., Reventos, J., Paciucci, R., 2004. Specific interaction of tissue-type plasminogen activator (tPA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro. Gut 53, 993–1000. Dzwonek, J., Rylski, M., Kaczmarek, L., 2004. Matrix metalloproteinases and their endogenous inhibitors in neuronal physiology of the adult brain. FEBS Lett. 567 (1), 129–135. East, E., Baker, D., Pryce, G., Lijnen, H.R., Cuzner, M.L., Gveric, D., 2005. A role for the plasminogen activator system in inflammation and neurodegeneration in the central nervous system during experimental allergic encephalomyelitis. Am. J. Pathol. 167 (2), 545–554. Garcia-Monco, J.C., Coleman, J.L., Benach, J.L., 2002. Soluble urokinase receptor (uPAR, CD 87) is present in serum and cerebrospinal fluid in patients with neurologic diseases. J. Neuroimmunol. 129, 216–223. Gravanis, I., Tsirka, S.E., 2005. Tissue plasminogen activator and glial function. Glia 49 (2), 177–183. Gveric, D., Herrera, B.M., Cuzner, M.L., 2005. tPA receptors and the fibrinolytic response in multiple sclerosis lesions. Am. J. Pathol. 166 (4), 1143–1151.

184

M.E. De Stefano et al. / Mol. Cell. Neurosci. 36 (2007) 174–184

Hajjar, K.A., Jacovina, A., Chacko, J., 1994. An endothelial cell receptor for plasminogen/tissue plasminogen activator. I. Identity with annexin. J. Biol. Chem. 269, 21191–21197. Hamre, K.M., Chepenik, K.P., Goldowitz, D., 1995. The annexins: specific markers of midline structures and sensory neurons in the developing murine central nervous system. J. Comp. Neurol. 352 (3), 421–435. Hao, Z., Guo, C., Jiang, X., Krueger, S., Pietri, T., Dufour, S., Cone, R.E., O'Rourke, J., 2006. New transgenic evidence for a system of sympathetic axons able to express tissue plasminogen activator (t-PA) within arterial/ arteriolar walls. Blood 108 (1), 200–220. Hu, K., Yang, J., Tanaka, S., Gonias, S.L., Mars, W.M., Liu, Y., 2006. Tissue-type plasminogen activator acts as a cytokine that triggers intracellular signal transduction and induces matrix metalloproteinase-9 gene expression. J. Biol. Chem. 281 (4), 2120–2127. Jacovina, A.T., Zhong, F., Khazanova, E., Lev, E., Deora, A.B., Hajjar, K.A., 2001. Neuritogenesis and the nerve growth factor-induced differentiation of PC-12 cells requires annexin II-mediated plasmin generation. J. Biol. Chem. 52, 49350–49358. Jiang, X., Hand, A.R., Shen, S., Cone, R.E, O'Rourke, J., 2003. Enhanced tissue plasminogen activator synthesis by the sympathetic neurons that innervate aging vessels. J. Neurosci. Res. 71 (4), 567–574. Leone, L., De Stefano, M.E., Del Signore, A., Petrucci, T.C., Paggi, P., 2005. Axotomy of sympathetic neurons activates the metalloproteinase-2 enzymatic pathway. J. Neuropathol. Exp. Neurol. 64 (11), 1007–1017. Liotta, L.A., Goldfarb, R.H., Brundage, R., Siegal, G.P., Terranova, V., Garbisa, S., 1981. Effect of plasminogen activator (urokinase), plasmin, and thrombin on glycoprotein and collagenous components of basement membrane. Cancer Res. 41 (11 Pt 1), 4629–4636. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCt method. Methods 25, 402–408. Madani, R., Kozlov, S., Akhmedov, A., Cinelli, P., Kinter, J., Lipp, H.P., Sonderegger, P., Wolfer, D.P., 2003. Impaired explorative behavior and neophobia in genetically modified mice lacking or overexpressing the extracellular serine protease inhibitor neuroserpin. Mol. Cell. Neurosci. 23 (3), 473–494. Mali, R.I, Cheng, M., Chintala, S.K., 2005. Plasminogen activators promote excitotoxicity-induced retinal damage. FASEB 19 (10), 1280–1289. Matthews, M.R., Raisman, G., 1972. A light and electron microscopic study of the cellular response to axonal injury in the superior cervical ganglion of the rat. Proc. R. Soc. Lond. 181, 43–79. Matys, T., Strickland, S., 2003. Tissue plasminogen activator and NMDA receptor cleavage. Nat. Med. 9, 371–373. Melchor, J.P, Strickland, S., 2005. Tissue plasminogen activator in central nervous system physiology and pathology. Thromb. Haemost. 93 (4), 655–660. Monea, S., Lehti, K., Keski-Oja, J., Mignatti, P., 2002. Plasmin activates promatrix metalloproteinase-2 with a membrane-type 1 matrix metalloproteinase-dependent mechanism. J. Cell. Physiol. 192, 160–170. Muller, C.M., Griesinger, C.B., 1998. Tissue plasminogen activator mediates reverse occlusion plasticity in visual cortex. Nat. Neurosci. 1 (1), 47–53. Murphy, G., Docherty, A.J., 1992. The matrix metalloproteinases and their inhibitors. Am. J. Respir. Cell Mol. Biol. 7, 120–125. Nicole, O., Ali, C., Docagne, F., Plawinski, L., MacKenzie, E.T., Vivien, D., Buisson, A., 2001. Neuroprotection mediated by glial cell line-derived neurotrophic factor: involvement of a reduction of NMDA-induced calcium influx by the mitogen-activated protein kinase pathway. J. Neurosci. 21 (9), 3024–3033. O'Rourke, J., Jiang, X., Hao, Z., Cone, R.E., Hand, A.R., 2005. Distribution of sympathetic tissue plasminogen activator (tPA) to a distant microvasculature. J. Neurosci. Res. 79, 727–733. Parmer, R.J., Mahata, M., Mahata, S., Sebald, M.T., O'Connor, D.T., Miles, L.A., 1997. Tissue plasminogen activator (t-PA) is targeted to the regulated secretory pathway. Catecholamine storage vesicles as a reservoir for the rapid release of t-PA. J. Biol. Chem. 272, 1976–1982.

Purves, D., 1975. Functional and structural changes in mammalian sympathetic neurones following interruption of their axons. J. Physiol. 252, 429–463. Purves, D., Lichtman, J.W, 1978. Formation and maintenance of synaptic connections in autonomic ganglia. Physiol. Rev. 58 (4), 821–852. Rijken, D.C., Collen, D., 1981. Purification and characterization of the plasminogen activators secreted by human melanoma cells in culture. J. Biol. Chem. 256 (13), 7035–7041. Rijken, D.C., Groeneveld, E., 1986. Isolation and functional characterization of the heavy and light chains of human tissue-type plasminogen activator. J. Biol. Chem. 261 (7), 3098–3102. Sallés, F.J., Strickland, S., 2002. Localization and regulation of the tissue plasminogen activator-plasmin system in the hippocampus. J. Neurosci. 22, 2125–2134. Samson, M., Medcalf, R., 2006. Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron 50, 673–678. Sappino, A.P., Madani, R., Huarte, J., Belin, D., 1993. Extracellular proteolysis in the adult murine brain. J. Clin. Invest. 92, 679–685. Seeds, N.W., Williams, B.L., Bickford, P.C., 1995. Tissue plasminogen activator induction in Purkinje neurons after cerebellar motor learning. Science 270 (5244), 1992–1994. Seeds, N.W., Friedman, G., Krystosek, A., Haffke, S., Hayden, S., Thewke, D., McGuire, P., 1996. Plasminogen activators and extracellular matrix in neuronal development, regeneration and plasticity. Semin. Neurosci. 8, 405–412. Seeds, N.W., Basham, M.E., Haffke, S.P, 1999. Neuronal migration is retarded in mice lacking the tissue plasminogen activator gene. PNAS 96, 14118–14123. Seeds, N.W., Basham, M.E., Ferguson, J.E., 2003. Absence of tissue plasminogen activator gene or activity impairs mouse cerebellar motor learning. J. Neurosci. 23 (19), 7368–7375. Siao, C.J., Fernandez, S.R., Tsirka, S.E., 2003. Cell type-specific roles for tissue plasminogen activator released by neurons or microglia after excitotoxic injury. J. Neurosci. 23 (8), 3234–3242. Siconolfi, L.B., Seeds, N.W., 2001. Induction of the plasminogen activator system accompanies peripheral nerve regeneration after sciatic nerve crush. J. Neurosci. 21 (12), 4336–4347. Steel, M.C., Buckley, N.J., 1993. Differential regulation of muscarinic receptor mRNA levels in neuroblastoma cells by chronic agonist exposure: a comparative polymerase chain reaction study. Mol. Pharmacol. 43, 694–701. Sternlicht, M.D., Werb, Z., 2001. How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17, 463–516. Tsirka, S.E., Gualandris, A., Amaral, D.G., Strickland, S., 1995. Excitotoxin-induced neuronal degeneration and seizure are mediated by tissue plasminogen activator. Nature 377 (6547), 340–344. van Zonneveld, A.J., Veerman, H., MacDonald, M., van Mourik, J., Pannekoek, H., 1986. Structure and function of human tissue-type plasminogen activator (tPA). J. Cell. Biochem. 32, 169–178. Vassalli, J.D., Sappino, A.P., Belin, D., 1991. The plasminogen activator/ plasmin system. J. Clin. Invest. 88 (4), 1067–1072. Yepes, M., Lawrence, D.A0., 2004. New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp. Biol. Med. (Maywood) 229 (11), 1097–1104. Yong, V.W, 2005. Metalloproteinases: mediators of pathology and regeneration in the CNS. Nat. Rev. Neurosci. 6 (12), 931–944. Zaccaria, M.L., De Stefano, M.E., Properzi, F., Gotti, C., Petrucci, T.C., Paggi, P., 1998. Disassembly of the cholinergic postsynaptic apparatus induced by axotomy in mouse sympathetic neurons: the loss of dystrophin and β-dystroglycan immunoreactivity precedes that of the acetylcholine receptor. J. Neuropathol. Exp. Neurol. 57 (8), 768–779. Zhang, X., Chaudhry, A., Chintala, S.K., 2003. Inhibition of plasminogen activation protects against ganglion cell loss in a mouse model of retinal damage. Mol. Vis. 9, 238–248.