Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus

G Model

ARTICLE IN PRESS

JVAC 16424 1–8

Vaccine xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus

1

2

Q1

3 4

Q2

5

Dennis Berbulla Bela-ong a,b,∗ , Brian Dall Schyth b , Jun Zou c , Christopher J. Secombes c , Niels Lorenzen a,∗ a

Fish Health Section, Department of Animal Science, University of Aarhus, Hangøvej 2, DK-8200 Århus N, Denmark Section for Immunology and Vaccinology, National Veterinary Institute, Technical University of Denmark, Bulowsvej 27, DK-1870 Frederiksberg C, Denmark c Scottish Fish Immunology Research Centre, University of Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24 2TZ, Scotland, United Kingdom b

6 7 8 9

a r t i c l e

10 25

i n f o

a b s t r a c t

11

Article history: Received 13 January 2015 Received in revised form 22 March 2015 Accepted 27 April 2015 Available online xxx

12 13 14 15 16 17

24

Keywords: microRNA Viral hemorrhagic septicemia virus (VHSV) Rhabdovirus glycoprotein DNA vaccination Interferons Rainbow trout

26

1. Introduction

18 19 20 21 22 23

Mechanisms that account for the high protective efficacy in teleost fish of a DNA vaccine expressing the glycoprotein (G) of Viral hemorrhagic septicemia virus (VHSV) are thought to involve early innate immune responses mediated by interferons (IFNs). Microribonucleic acids (miRNAs) are a diverse class of small (18–22 nucleotides) endogenous RNAs that potently mediate post-transcriptional silencing of a wide range of genes and are emerging as critical regulators of cellular processes, including immune responses. We have recently reported that miR-462 and miR-731 were strongly induced in rainbow trout infected with VHSV. In this study, we analyzed the expression of these miRNAs in fish following administration of the DNA vaccine and their potential functions. Quantitative RT-PCR analysis revealed the increased levels of miR-462, and miR-731 in the skeletal muscle tissue at the site of vaccine administration and in the liver of vaccinated fish relative to empty plasmid backbone-injected controls. The increased expression of these miRNAs in the skeletal muscle correlated with the increased levels of the type I interferon (IFN)inducible gene Mx, type I IFN and IFN-␥ genes at the vaccination site. Intramuscular injection of fish with either type I IFN or IFN-␥ plasmid construct resulted in the upregulation of miR-462 and miR-731 at the site of injection, suggesting that the induction of these miRNAs is elicited by IFNs. To analyze the function of miR-462 and miR-731, specific silencing of these miRNAs using anti-miRNA oligonucleotides was conducted in poly I:C-treated rainbow trout fingerlings. Following VHSV challenge, anti-miRNAinjected fish had faster development of disease and higher mortalities than control fish, indicating that miR-462/731 may be involved in IFN-mediated protection conferred by poly I:C. © 2015 Published by Elsevier Ltd.

Q4

DNA vaccines encoding the glycoprotein (G) of fish rhabdoviruses like viral hemorrhagic septicemia virus (VHSV) have been shown to confer efficient protection against lethal virus challenge under laboratory conditions [1,2]. The immune response elicited by these vaccines involves early, short-term non-specific immunity, followed by specific, long-lasting protection [1,3]. Neutralizing antibodies and cytotoxic cells are believed to be involved in the specific protection [1,4]. The early protection correlates with upregulation of the interferon (IFN)-induced antiviral myxovirus

27 28 29 30 31 32 33 34 35

Q3

∗ Corresponding authors at: Animal Science-Fish Health Section, Aarhus University, Hangøvej 2, 8200 Aarhus N, Denmark. Tel.: +45 25520730. E-mail addresses: [email protected] (D.B. Bela-ong), [email protected] (N. Lorenzen).

resistance Mx protein. Initial studies suggested that expression of the G protein on the surface of transfected cells induces expression of IFN in the neighbouring cells [5], but the exact protective mechanism remains to be elucidated [3,6–8]. Type I IFN responses implicate activation of an array of innate antiviral defense mechanisms. Recent reports suggest that these include small regulatory RNAs called microRNAs (miRNAs) [9–13]. MicroRNAs are short (19–25 nucleotides) endogenous RNAs that regulate gene expression by repressing translation of and/or degrading target mRNAs, resulting in altered mRNA and protein expression profiles [14]. Each miRNA may regulate multiple genes [15,16] and can control a broad spectrum of cellular processes, including function and development of immune cells [17] and hostpathogen interactions [18–20]. Recently we reported that two miRNAs in teleost fishes, miR462 and miR-731, were the most highly induced miRNAs in the liver of rainbow trout (Oncorhynchus mykiss) following VHSV infection

http://dx.doi.org/10.1016/j.vaccine.2015.04.092 0264-410X/© 2015 Published by Elsevier Ltd.

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

G Model JVAC 16424 1–8

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

2

Table 1 Anti-miRNAs and mismatched controls used in the experiments. Name

Sequence (5 → 3 )a

dre-anti-miR-462 probe dre-anti-miR-731 probe dre-anti-miR-462 mismatch probe dre-anti-miR-731 mismatch probe

mA mU IT mA mU IG mG mG IT mU mC IC mG mU IT mA mG mA IG mA mA IA mA mC IG mU mG IT mC mA IT mU mA mU IT mA mU IG mG mG IA mU mC IA mG mU IT mA 5 mG mA IG mA mA IA mA mC IC mU mG IA mC mA IT mU

a Positions in which the control anti-miRNAs differed from the anti-miRNAs are underlined and are located in positions complementary to that of the seed sequence in the mature miRNAs. 2 -O-methylated positions are indicated/preceded by the letter m, while the LNA coupled positions are indicated by the letter I.

53 54 55 56 57 58 59

(Schyth et al., submitted). Here, we report the upregulation of these miRNAs in fish immunized with a VHSV G-expressing DNA vaccine and determine the kinetics of expression following vaccination. We further show that the expression of these miRNAs is elicited by IFN such that inhibition of the two miRNAs in fish treated with the IFN inducer poly I:C reduces the ability of poly I:C to protect fish against lethal VHSV infection.

60

2. Materials and methods

61

2.1. Fish and virus

62 63 64 65 66 67 68 69 70 71

72

Outbred O. mykiss were hatched from disinfected eggs obtained from a commercial fish farm certified as disease-free. The fish were kept in pathogen-free aquarium facilities and acclimatized to laboratory conditions several weeks prior to experiments. Throughout the experiments, fish were maintained in 8 L aquaria at 10 ± 2 ◦ C supplied with flow through partly deionized water. VHSV isolate DK-3592B [21] was used in infection trials. All fish experiments were conducted according to European and Danish guidelines for the use of experimental animals and permitted by the Danish Committee for Animal Experiments (license no. 2007/561-1312). 2.2. DNA vaccine

78

The DNA vaccine (herein referred to as pcDNA3-vhsG) included the VHSV G gene under the control of the cytomegalovirus (CMV) promoter at a multiple cloning site in the plasmid pcDNA3 (Invitrogen) as described previously [2]. Control fish were injected with either pcDNA3 (empty vector) diluted in 0.9% NaCl (physiological saline, PS) or PS only.

79

2.3. IFN-expressing plasmids

73 74 75 76 77

80 81 82 83 84 85 86

87

88 89 90 91 92 93 94 95 96 97

The IFN constructs consisted of the full-length coding sequence of IFNa1 (GenBank accession no. AJ580911; [22,23] or IFN-␥ (GenBank accession no. AJ616215; [24]) inserted at a multiple cloning site in the plasmids, pcDNA3.1/3.3 (Invitrogen) driven by the CMV promoter. The constructs are herein referred to as pcDNA3.3-IFNa1 and pcDNA3.1-IFN-G. Control fish were injected with pcDNA3.1 (empty vector) dissolved in PS or with PS only. 2.4. Poly I:C and anti-miRNAs Polyinosinic: polycytidylate sodium salt (Poly I:C; CAS # 4242450-0) was purchased from Sigma-Aldrich GmBH (Steinheim, Germany). The anti-miR-462 and anti-miR-731 and their corresponding mismatch controls were unconjugated 2 -O-methylated Locked Nucleic Acid (LNA)-based oligonucleotide probes (RiboTask Langeskov, Denmark). The anti-miRNAs were designed as complete anti-sense sequences of the mature zebrafish miRNA sequences, whereas the corresponding mismatch anti-miRNA controls differed from the anti-miRNAs by two nucleotides (underlined bases) within the anti-seed region (Table 1).

2.5. Vaccination and injection with IFN constructs Fish (approx. 1 g each) were anaesthetized with 0.01% benzocaine were injected with 10 ␮g of pcDNA3-vhsG or 10 ␮g of pcDNA3 empty plasmid backbone in 20 ␮L phosphate buffered saline (PBS) or PBS only in the right epaxial muscle in front of the dorsal fin as described [25]. For injection with IFN-expressing plasmids, benzocaine-anaesthetized fish were injected with 10 ␮g of either pcDNA3.3-IFNa1 or pcDNA3.1-IFN-G in 20 ␮L PBS. Positive controls were injected with 5 ␮g poly I:C (Sigma) in 20 ␮L PBS. Negative controls were injected with 10 ␮g of the empty vector in 20 ␮L PBS or 20 ␮L PBS alone. At 1, 4, 7, and 21 days post-vaccination (dpv), muscle tissue from the injection site and liver from 6 fish were sampled for each group. Muscle tissue was immediately processed for RNA isolation while liver samples were stored at −80 C in RNALater until examined. 2.6. RNA isolation, cDNA synthesis, and quantitative RT-PCR for miRNAs and mRNAs Total RNA was isolated and purified from tissue samples using the miRNeasy Kit (cat.# 217004, Quiagen SA Biosciences, Hilden, Germany), with DNase treatment (Qiagen RNase-free DNase Set, cat. # 79254). For miRNA expression studies, total RNA (1 ␮g) was reverse transcribed with the QuantiMiR RT Kit Small RNA Quantitation System (cat. # RA420A-1, System Biosciences, Mountain View, CA, USA) to convert small non-coding RNAs into cDNAs. For mRNA (Mx, IFN-1, IFN-G) expression analyses, 1 ␮g RNA was used to make cDNA using iScript cDNA synthesis kit from BioRad (cat. # 170-8891, Hercules, CA, USA). Levels of mature miR-462 and miR-731 and those of Mx, IFN1, and IFN-G mRNAs were detected by qPCR. Primer sequences for both miRNA and mRNA expression analysis are given in Table 2. See Supplementary information for a complete description of the qPCR protocol. 2.7. Anti-miRNA injection and virus challenge experiments All groups were in duplicate aquaria (18–27 fish/aquarium). A flow diagram of the experiment is presented in Fig 1. Fish fingerlings (approx. 0.5 g each) anaesthetized in benzocaine were injected intraperitoneally (IP) with poly I:C in PS or PS only (control). 24 h post-poly I:C treatment or PS injection, fish received IP anti-miRNA treatments or controls according to group designations (Fig. 1). On the day of virus challenge, water flow was discontinued and VHSV isolate DK-3592B [21] was added to each experimental aquarium to a final titer of approximately 104 tissue culture infectious dose50 (TCID50 )/mL per aquarium. Water flow was subsequently restarted after virus challenge of 2 h. Unchallenged controls consisted of a mix of fish from each of the treatment groups. Disease development in each aquarium was monitored daily for 21 days post-challenge (dpc). Moribund fish were terminated, and along with dead fish removed, registered and examined for external manifestations of disease (skin darkening, bleeding, ascitis, exopthalmia) and frozen (for virological examination). Initially, the effect of anti-miRNA on susceptibility to VHSV without prior poly I:C was analyzed (Supplementary information).

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

98

99 100 101 102 103 104 105 106 107 108 109 110 111 112

113 114

115 116 117 118 119 120 121 122 123 124 125 126 127 128 129

130

131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149

G Model

ARTICLE IN PRESS

JVAC 16424 1–8

D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

3

Table 2 Primers used in real time PCR analysis.

150

151 152 153

Gene name

Accession number

Primer sequence (5 → 3 )

dre-miR-462

MIMAT0001855

Forward TAACGGAACCCATAATGCAGCT

dre-miR-731

MIMAT0003761

Forward AATGACACGTTTTCTCCCGGATCG

dre-snoU23

AJ009730

Forward GCCCATGTCTGCTGTGAAACAAT

omy-Mx3

U47946

omy type I IFN

AY788890.1

IFN Gamma

AY795563

omy-ARP

AY505012

Forward GCAGAGGGAGATGCTTCAGA Reverse CGATGTCAAAGTCCTCCTTCA Forward GAAAAGGACTGGGGCATTCT Reverse GAATACCTTTCCCTGCTGGAC Forward AAGGGCTGTGATGTGTTTCTG Reverse TGTACTGAGCGGCATTACTCC Forward GAAAATCATCCAATTGCTGGATG Reverse CTTCCCACGCAAGGACAGA

2.8. Virological examination Fish organs were processed (see Supplementary information for details) inoculated on fish cell cultures and analyzed by a VHSVspecific ELISA [26].

Prism software version 5 (Graphpad Software, SanDiego, CA, USA), and p < 0.05 considered statistically significant. 3. Results and discussion 3.1. miR-462 and miR-731 were upregulated in pcDNA3-vhsG-vaccinated fish

154

155 156 157

158 159

160

161 162

2.9. Statistical analysis The significance of the differences in miRNA expression at different times post DNA vaccination compared to day 1 were analyzed using the non-parametric Mann–Whitney test with Graph Pad

We have recently reported that the clustered miRNAs miR-462 and miR-731, known in teleost fishes only according to the miRNA repository miRbase [27], were the most highly upregulated miRNAs in rainbow trout liver infected with VHSV (Schyth et al., submitted).

Fig. 1. Schematic diagram of the anti-miRNA injection experiment on poly I:C pre-treated fish. Poly I:C-injected fish (or saline-injected controls) were injected with two doses of either anti-miRNA mix (final dose of 1 ␮g of each anti-miRNA per gram body weight), mismatch anti-miRNA mix (1 ␮g of each mismatch anti-miRNA per gram body weight), or TE buffer (control) with a 24-hr interval between the first and second dosing.

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

163 164 165 166

G Model JVAC 16424 1–8 4

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

Induction of the two miRNAs in both the site of vaccination and in the liver also correlated with increased transcript levels of the type 1 IFN-inducible myxovirus resistance gene Mx, which remained significantly upregulated to the final sampling time point (21 dpv) (Fig. 3B). The Mx protein is known as a non-specific antiviral protein in mammals and in other vertebrates, including teleost fishes [32,33] and has earlier been shown to be upregulated in fish injected with the plasmids expressing the rhabdovirus G protein [34]. In teleost fishes, the expression of Mx is stimulated both by type I IFN [35] and to a less extent by IFN-␥ [36]. Taken together, results indicate that injection of pcDNA3-vhs-G induced both local and systemic IFN response, which in turn stimulated the expression of miR-462 and miR-731.

3.2. miR-462 and miR-731 were induced in fish injected with type I and type II IFN-expressing plasmid constructs

Fig. 2. Expression of miR-462 and miR-731 in the skeletal muscle (site of vaccine administration) (A) and in the liver (B) of pcDNA3-vhsG-vaccinated fish at different times points post-vaccination determined by quantitative PCR. Fold change (fold upregulation; 2-Ct ) values were calculated in 6 vaccinates relative to the average of 6 plasmid backbone-injected fish. Horizontal bars indicate median values. * indicates significant difference compared to day 1 post vaccination (Mann–Whitney, p < 0.05).

167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187

In the present study, expression levels of miR-462 and miR-731 were also upregulated (relative to empty vector-injected controls) in the skeletal muscle at site of vaccination and in the liver of fish following vaccination with pcDNA3-vhsG (Fig. 2A and B). Levels of miR-462 and miR-731 expression significantly increased 4 days post-vaccination (dpv), which continued to 3 weeks. The expression of the two miRNAs in both tissues showed a similar kinetics (Fig. 2A and B). The parallel miR-462 and miR-731 induction and expression kinetics reflects their genome organization. The two miRNAs genes are positioned in a cluster (miR-462 cluster) and are as such most likely expressed as part of a polycistronic transcript, like other clustered miRNAs. The induction of miR-462 and miR-731 following the administration of the DNA vaccine (this study) and in VHSV-infected fish (Schyth et al., submitted) may be attributed to the stimulation of the IFN response elicited by immunization with the VHSV-G-based DNA vaccine [28] as well as by VHSV infection [29], respectively. Fish rhabdovirus glycoproteins, including VHSVG, have been known to be potent elicitors of the IFN response [5,30,31]. This was here confirmed by the increased levels of type I IFN and IFN-␥ transcripts at the vaccination site (Fig. 3A).

The stimulatory effect of interferons on the expression of miR-462 and miR-731 was further supported by the observation that injection of fish with type I- (pcDNA3-IFNa1) or type II (pcDNA3-IFN-G) IFN-encoding plasmid constructs or with the TLR3-, MDA5-, and RIG-I agonist and IFN-stimulator poly I:C [37], resulted in miR-462, miR-731, and Mx upregulation at the site of injection (Figs. 4A and B). Upregulation of miR-462/731 following poly I:C treatment in cultured rainbow trout liver cells has been previously reported (Schyth et al., submitted). A highly conserved IFN-stimulated response element (ISRE) and gamma IFN activation sequence (GAS) were found in the promoter upstream of the miR-462/731 cluster locus in teleost fish (Schyth et al., submitted), accordingly supporting the stimulatory role of IFNs. Salmonids like rainbow trout are known to have all the six subgroups (IFN-a–f) of fish type I IFNs described so far [22]. In our study, injection with a plasmid construct encoding IFN-a induced miR-462/731 expression, as did injection with poly I:C, which in the Atlantic salmon TO cell line exclusively induced the expression of IFN-a [38]. Whether any of the other type I IFN subgroups can also induce the expression of miR-462/731 remains to be investigated. Which cell types that express miR-462 and miR-731 are currently not known. At the vaccination site the two miRNAs may have been induced in myocytes due to IFN induction following vaccine injection. Alternatively, miR-462 and miR-731 could be induced in immune cells infiltrating the site of vaccination. Immunization with pcDNA3-vhs-G vaccine has been shown to promote the recruitment of immune cells to the site of vaccine administration [7,39]. The increased expression of IFN-␥ observed at the site of vaccination accordingly suggested the presence of activated NK, NKT, and/or T cells. Whereas the kinetics of miR-462/731 and Mx expression timely correlated in terms of onset, levels of miRNA transcripts remained particularly elevated despite the decrease of Mx expression at 21 dpv (Fig. 2A and B). This suggests that in addition to the putative roles of miR-462/731 in the early innate immune response, they may potentially also be involved in other processes like the development of specific adaptive immune responses such as the activation and differentiation of immune cells. Apart from the ISRE element, the miR-462/731 promoter region also contained a GAS and a purine box 1 (PU.1 box: GAGGAAGT) (Schyth et al., submitted). The PU.1 box, a conserved immune-related regulatory element in vertebrate genomes, is the binding site of the leukocyte differentiation related transcription factor PU.1, which is involved in the regulation of hematopoiesis [40,41]. Isolation of infiltrating cells at the vaccination site and subsequent miRNA profiling will be needed to resolve this.

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

188 189 190 191 192 193 194 195 196 197 198 199 200

201 202

203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250

G Model JVAC 16424 1–8

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

5

Fig. 3. (A) Type I IFN and IFN-␥ expression at the skeletal muscle (site of vaccination) of pcDNA3-vhsG-vaccinated fish at different times post-vaccination. Fold change (fold upregulation; 2-Ct ) values were measured in a pool of tissue from 6 vaccinated fish relative to a pool of tissue from 6 plasmid backbone-injected fish. (B) Expression of Mx in the skeletal muscle (site of vaccination) and in the liver of pcDNA3-vhsG-vaccinated fish at different times post-vaccination as determined by quantitative PCR. Fold upregulation (2-Ct ) values were calculated in 6 vaccinates relative to the mean value of 6 plasmid backbone-injected fish. Horizontal bars indicate median values. * indicates significant difference compared to day 1 post vaccination (Mann–Whitney, p < 0.05).

251 252

253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276

3.3. Effects of miR-462 and miR-731 inhibition with specific anti-miRNAs in fish Inhibitory LNA anti-miR-462 and anti-miR-731, anti-sense oligonucleotides that hybridize with miR-462 and miR-731, respectively, were designed in order to determine the potential role of these miRNAs. The anti-miRNAs by themselves did not stimulate the IFN response in a preliminary experiment (data not shown). Injection of anti-miRNA-462/731 followed by VHSV challenge tended to promote disease progression (Supplementary Fig. S1). However, the effect was minor and not conclusive, possibly due to an excessive challenge dose with the highly virulent VHSV isolate and an insufficient challenge dose with the low virulent isolate. Alternatively, the persistence of the anti-miRNAs might have been too short to clearly affect the miRNAs induced by the subsequent VHSV infection. As the early IFN-related protection induced by DNA vaccination lasts 2–3 weeks or more depending on the water temperature [1], it was considered to be practically difficult to maintain a functional concentration of anti-miRNAs which could efficiently block the transcribed miRNAs. To increase the chance of having antimiRNAs present in the fish during the time of miRNA induction, we therefore decided to test the effect of anti-miRNAs on the more transient poly I:C-induced protection against VHSV. Poly I:C injection itself resulted in miR-462 and miR-731 induction (Fig. 4A). Poly I:C has been previously shown to induce the IFN response in fish and protects against virus infection in vitro [42] and in vivo [43,44]

shortly after administration, as was also demonstrated in this study (Fig. 5 and Fig. S1A). Injection with poly I:C slowed down disease development and decreased mortality (60% mortality, compared with almost 100% cumulative mortality 21 dpc in fish that did not receive poly I:C) (Fig. 5 and Fig. S1A). Administration with a mixture of anti-miR462/731 to poly I:C-treated fish hastened disease development and increased mortality compared to the poly I:C-treated group that was not injected with anti-miRNAs. This demonstrates that silencing miR-462/731 with anti-miRNAs counteracted the protective effects of poly I:C against VHSV. Without poly I:C treatment, injection with anti-miRNAs only or with mismatch controls only showed similar disease development and mortality profiles with the group injected only with saline/TE. Replicate aquaria displayed very similar mortalities (Table S1), except in the case of fish injected with mismatch anti-miRNA controls following poly I:C treatment. Only one moribund fish (5%) in one replicate compared to 38% in the other suggested an experimental failure of the virus challenge in the prior. In the remaining replicate, the mortality was still lower but more comparable to the poly I:C-treated fish tanks. Introduction of mismatches thus abrogated the ability of the anti-miRNAs to eliminate the poly I:C induced protection. Infection by VHSV in dead or moribund fish from the challenged groups was confirmed by ELISA (Table S1). One basic question related to the observed effect of the antimiRNAs is whether they are systemically distributed and taken up by cells following IP delivery. Reports on systemic effects of

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303

G Model JVAC 16424 1–8 6

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

Fig. 4. Expression of (A) miR-462 and miR-731 and (B) Mx in the skeletal muscle of pcDNA3-IFNa1 (type I IFN)-, pcDNA3-IFN-G (IFN-␥)-, and poly I:C-injected fish at different time points post-injection determined by quantitative PCR. Fold change (fold upregulation; 2-Ct ) values were measured in a pool of tissue from 6 vaccinated fish relative to a pool of tissue from 6 plasmid backbone-injected fish. 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320

anti-miRNAs in mammals suggest that it is possible to specifically inhibit miRNAs in vivo by the administration of small chemicallymodified LNA-based anti-miRNAs [45,46]. Furthermore, a short LNA-based anti-miRNA against miR-122 (called Miravirsen) is currently in phase 2 clinical trials for the treatment of HCV infection [47]. Novel data demonstrate that Miravirsen not only blocks the mature miR-122 but also interferes with precursor and primary miRNA stages, thereby interrupting miRNA biogenesis and the production of functional mature miRNA [48]. Although the specific interference at the molecular level with miR-462/731 by the administered anti-miRNAs in the work presented here remains to be confirmed, current research supports that endogenously expressed miRNAs can be specifically inhibited by the applied approach. Altogether, our data suggest that miR-462 and -731 are involved in IFN-mediated antiviral activities. IFNs are important mediators of immune responses elicited by the recognition of virus pathogenassociated molecular patterns (PAMPs) by host cell receptors. Type

I IFNs induce the expression of the cells’ predominantly proteinbased antiviral resources including the Mx GTPases, adenosine deaminase, protein kinase R, and the 2 5 oligoadenylate synthetase/RNase L system [49]. However, recently IFNs have been shown to upregulate expression of some cellular miRNAs in human cells [10–13]. Cellular miRNAs induced by IFN-␤ in human cells have been demonstrated to target viral transcripts, thereby contributing towards the antiviral properties of IFN-␤ [10]. Similarly, an IFN-␥induced miRNA, miR-29a [50] has been shown to target the 3 UTR of HIV-1 [51]. The recent years have also seen an increasing number of cellular miRNAs reported to be involved in antiviral responses against diverse viruses in mammalian cells [9–13]. Some of these miRNAs are IFN-inducible and have been demonstrated to directly target viral sequences, while others target host mRNAs that encode proteins involved in virus replication and host-virus interactions, [9–13,52,53]. Therefore, the IFN response may potentially use

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337

G Model JVAC 16424 1–8

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

7

Fig. 5. Development of mortality in poly I:C-treated fish in which miR-462 and miR-731 were inhibited by injection of anti-miRNA-specific oligonucleotides followed by challenge of the fish with VHSV. Mortality (%) data are presented as mean values from two replicate aquaria, except for the poly I:C + mismatch a-miR group (*). In this group (*), data from only one replicate aquarium were considered because of failure of virus challenge in the other replicate aquarium.

338 339 340 341 342 343 344 345 346 347 348 349 350 351 352

353

354

355

cellular miRNAs as RNA-based antiviral effectors in addition to a myriad of well-known antiviral proteins. In conclusion, our results suggest that miR-462/731 are involved in IFN-mediated antiviral defense in teleost fish and may partly account for the protective effects of poly I:C and possibly also the IFN-mediated early innate protection elicited by the rhabdovirus G-based DNA vaccines. Validated targets of these two miRNAs are currently unknown and whether they can directly target VHSV sequences needs further investigation. To our knowledge, this is the first report to address expression of specific miRNAs in response to DNA vaccination against a fish rhabdovirus and to identify IFNinduced miRNAs that may be involved in host-virus interactions and immune responses in teleost fish. We speculate that miRNAmediated RNA interference might play an important role in innate antiviral immunity in this highly diverse vertebrate group. Conflict of interest statement The authors declare that no conflict of interest exists. Acknowledgments

The authors gratefully acknowledge the kind and able assistance of the staff of the National Veterinary Institute, Technical 357 University of Denmark and of the Fish Health Section, Department 358 of Animal Science, University of Aarhus. This work was supported 359 Q5 by the Danish Research Council for Technology and Production 360 Sciences (grants no. 26-03-0059 and 274-05-0585); the Lundbeck 361 Foundation (grant no. 52/03); the European Commission (contract 362 FP6007103 IMAQUANIM, and contract FP7311993 TargetFish); and 363 Q6 by the John Birthe Meyer Foundation. 364 356

365

366 367 368

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.vaccine.2015.04. 092

References [1] Lorenzen N, LaPatra S. DNA vaccines for aquacultured fish. Rev Sci Tech 2005;24(1):201–13. [2] Lorenzen N, Lorenzen E, Einer-Jensen K, Heppell J, Wu T, Davis H. Protective immunity to VHS in rainbow trout (Oncorhynchus mykiss, Walbaum) following DNA vaccination. Fish Shellfish Immunol 1998;8:261–70. [3] Kurath G. Biotechnology and DNA vaccines for aquatic animals. Rev Sci Tech 2008;27(1):175–96. [4] Utke K, Kock H, Schuetze H, Bergmann SM, Lorenzen N, Einer-Jensen K, et al. Cell-mediated immune responses in rainbow trout after DNA immunization against the viral hemorrhagic septicemia virus. Dev Comp Immunol 2008;32(3):239–52. [5] Acosta F, Collet B, Lorenzen N, Ellis AE. Expression of the glycoprotein of viral haemorrhagic septicaemia virus (VHSV) on the surface of the fish cell line RTGP1 induces type 1 interferon expression in neighbouring cells. Fish Shellfish Immunol 2006;21:272–8. [6] McLauchlan PE, Collet B, Ingerslev E, Secombes CJ, Lorenzen E, Ellis AE. DNA vaccination against viral hemorrhagic septicemia (VHS) in rainbow trout: size, dose, route of injection and duration of protection—early protection correlates with Mx expression. Fish Shellfish Immunol 2003;15:39–50. [7] Lorenzen N, Lorenzen E, Einer-Jensen K, LaPatra SE. DNA vaccines as a tool for analysing the protective immune response against rhabdoviruses in rainbow trout Fish. Shellfish Immunol 2002;12(5):439–53. [8] Lorenzen N, Lorenzen E, Einer-Jensen K, Heppell J, Davis HL. Genetic vaccination of rainbow trout against viral hemorrhagic septicemia virus: small amounts of plasmid DNA protect against a heterologous serotype. Virus Res 1999;63(12):19–25. [9] Sisk JM, Witwer KW, Tarwater PM, Clements JE. SIV replication is directly downregulated by four antiviral miRNAs. Retrovirology 2013;10:95. [10] Russo A, Potenza N. Antiviral effects of human microRNAs and conservation of their target sites. FEBS Lett 2011;585(16):2551–5. [11] Pedersen IM, Cheng G, Wieland S, Volinia S, Croce CM, Chisari FV, et al. Interferon modulation of cellular microRNAs as an antiviral mechanism. Nature 2007;449(7164):919–22. [12] Zhang X, Daucher M, Armistead D, Russell R, Kottilil S. MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-␣. PLoS ONE 2013;8(2):e55733. [13] Buggele WA, Horvath CM. MicroRNA profiling of Sendai virus-infected A549 cells identifies miR-203 as an interferon-inducible regulator of IFIT1/ISG56. J Virol 2013;87(16):9260–70. [14] Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116(2):281–97. [15] Creighton CJ, Hernandez-Herrera A, Jacobsen A, Levine DA, Mankoo P, Schultz N, et al. Integrated analyses of microRNAs demonstrate their widespread influence on gene expression in high-grade serous ovarian carcinoma. PLoS ONE 2012;7(3):e34546. [16] Bonci D, Coppola V, Musumeci M, Addario A, Giuffrida R, Memeo L, et al. The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med 2008;14(11):1271–7.

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

369

370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417

G Model JVAC 16424 1–8 8

ARTICLE IN PRESS D.B. Bela-ong et al. / Vaccine xxx (2015) xxx–xxx

[17] Wu H, Neilson JR, Kumar P, Manocha M, Shankar P, et al. miRNA profiling of naïve, effector and memory CD8 T cells. PLoS ONE 2007;2(10):e1020. 420 [18] Swaminathan S, Murray DD, Kelleher AD. miRNAs and HIV: unforeseen deter421 minants of host-pathogen interaction. Immunol Rev 2013;254(1):265–80. 422 [19] Eulalio A, Schulte L, Vogel J. The mammalian microRNA response to bacterial 423 infections. RNA Biol 2012;9(6):742–50. 424 [20] Skalsky RL, Cullen BR. Viruses, microRNAs, and host interactions. Annu Rev 425 Microbiol 2010;64:123–41. 426 [21] Lorenzen N, Olesen NJ, Vestergård Jørgensen PE, Etzerodt M, Holtet TL, 427 Thøgersen HC. Molecular cloning and expression in Escherichia coli of the gly428 coprotein gene of VHS virus, and immunization of rainbow trout with the 429 recombinant protein. J Gen Virol 1993;74:623–30. 430 [22] Zou J, Gorgoglione B, Taylor NG, Summathed T, Lee PT, Panigrahi A, et al. 431 Salmonids have an extraordinary complex type I IFN system: characterization 432 of the IFN locus in rainbow trout Oncorhynchus mykiss reveals two novel IFN 433 subgroups. J Immunol 2014;193(5):2273–86. 434 [23] Zou J, Tafalla C, Truckle J, Secombes CJ. Identification of a second group of 435 type I IFNs in fish sheds light on IFN evolution in vertebrates. J Immunol 436 2007;179(6):3859–71. 437 [24] Zou J, Carrington AC, Collet B, Dijkstra JM, Yoshiura Y, Bols N, et al. Identifica438 tion and bioactivities of IFN-gamma in rainbow trout Oncorhynchus mykiss: 439 the first Th1-type cytokine characterized functionally in fish. J Immunol 440 2005;175(4):2484–94. 441 [25] Lorenzen E, Einer-Jensen K, Rasmussen JS, Kjaer TE, Collet B, Secombes CJ, et al. 442 The protective mechanisms induced by a fish rhabdovirus DNA vaccine depend 443 on temperature. Vaccine 2009;27(29):3870–80. 444 [26] Mortensen HF, Heuer OE, Lorenzen N, Otte L, Olesen NJ. Isolation of viral haem445 orrhagic septicaemia virus from wild marine fish species in the Baltic Sea, 446 Kattegat, Skagerrak and the North Sea. Virus Res 1999;63:95–106. 447 Q7 [27] Griffiths-Jones S. miRBase: microRNA sequences and annotation. In: Baxevanis 448 AD, editor. Current protocols in bioinformatics. John Wiley and Sons; 2010. p. 449 1–10. Chapter 12, Unit 12.9. 450 [28] Byon JY, Ohira T, Hirono I, Aoki T. Comparative immune responses in Japanese 451 flounder, Paralichthys olivaceus after vaccination with viral hemorrhagic sep452 ticemia virus (VHSV) recombinant glycoprotein and DNA vaccine using a 453 microarray analysis. Vaccine 2006;24:921–30. 454 [29] Verrier ER, Langevin C, Benmansour A, Boudinot P. Early antiviral response and 455 virus induced genes in fish. Dev Comp Immunol 2011;35:1204–14. 456 [30] Chico V, Martinez-Lopez A, Ortega-Villaizan M, Falco A, Perez L, Coll JM, et al. 457 Pepscan mapping of viral hemorrhagic septicemia virus glycoprotein G major 458 lineal determinants implicated in triggering host cell antiviral responses medi459 ated by type I interferon. J Virol 2010;84(14):7140–50. 460 [31] LaPatra SE, Corbeil S, Jones GR, Shewmaker WD, Lorenzen N, Anderson ED, et al. 461 Protection of rainbow trout against infectious hematopoietic necrosis virus four 462 days after specific or semi-specific DNA vaccination. Vaccine 2001;19:4011–9. 463 [32] Verhelst J, Hulpiau P, Saelens X. Mx proteins: antiviral gatekeepers that restrain 464 the uninvited. Microbiol Mol Biol Rev 2013;77(4):551–66. 465 [33] Trobridge GD, Leong JC. Characterization of a rainbow trout Mx gene. J Inter466 feron Cytokine Res 1995;15:691–702. 467 [34] Kim CH, Johnson MC, Drennan JD, Simon BE, Thomann E, Leong JA. DNA vaccines 468 encoding viral glycoproteins induce nonspecific immunity and Mx protein syn469 thesis in fish. J Virol 2000;74(15):7048–54. 470 [35] Berg K, Svingerud T, Sun B, Robertsen B. An antiserum against Atlantic salmon 471 IFNa1 detects IFN and neutralizes antiviral activity produced by poly I:C stimulated cells. Dev Comp Immunol 2009;33:638–45. 418 419

[36] Sun B, Skjæveland I, Svingerud T, Zou J, Jørgensen J, Robertsen B. Antiviral activity of salmonid gamma interferon against infectious pancreatic necrosis virus and salmonid alphavirus and its dependency on type I interferon. J Virol 2011;85(17):9188–98. [37] Richmond JY, Hamilton LD. Foot-and-mouth disease virus inhibition induced in mice by synthetic double-stranded RNA (polyriboinosinic and polyribocytidylic acids). Proc Natl Acad Sci USA 1969;64:81–6. [38] Svingerud T, Solstad T, Sun B, Nyrud ML, Kileng Ø, Greiner-Tollersrud L, et al. Atlantic salmon type I IFN subtypes show differences in antiviral activity and cell-dependent expression: evidence for high IFNb/IFNc-producing cells in fish lymphoid tissues. J Immunol 2012;189:5912–23. [39] Castro R, Martínez-Alonso S, Fischer U, Haro NÁ, Soto-Lampe V, Wang T, et al. DNA vaccination against a fish rhabdovirus promotes an early chemokinerelated recruitment of B cells to the muscle. Vaccine 2014;32(10):1160–8. [40] Mak KS, Funnell APW, Pearson RCM, Crossley M. PU.1 and haematopoietic cell fate: dosage matters. Int J Cell Biol 2011;2011:808524. [41] Anderson MK, Sun X, Miracle AL, Litman GW, Rothenberg EV. Evolution of hematopoiesis: three members of the PU.1 transcription factor family in a cartilaginous fish, Raja eglanteria. Proc Natl Acad Sci USA 2001;98:553–8. [42] Schyth BD, Lorenzen N, Pedersen FS. Antiviral activity of small interfering RNAs: specificity testing using heterologous virus reveals interferon-related effects overlooked by conventional mismatch controls. Virology 2006;349(1):134–41. [43] Schyth BD, Lorenzen N, Pedersen FS. A high throughput in vivo model for testing delivery and antiviral effects of siRNAs in vertebrates. Mol Ther 2007;15(7):1366–72. [44] Eaton WD. Antiviral activity in four species of salmonids following exposure to poly (I)-poly (C). Dis Aquat Organ 1990;9:193–8. [45] Bernardo BC, Gao XM, Winbanks CE, Boey EJ, Tham YK, Kiriazis H, et al. Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remodeling and improves heart function. Proc Natl Acad Sci USA 2012;109(43):17615–20. [46] Elmén J, Lindow M, Schütz S, Lawrence M, Petri A, Obad S, et al. LNA-mediated microRNA silencing in non-human primates. Nature 2008;452(7189):896–9. [47] Janssen HL, Reesink HW, Lawitz EJ, Zeuzem S, Rodriguez-Torres M, Patel K, et al. Treatment of HCV infection by targeting microRNA. N Engl J Med 2013;368(18):1685–94. [48] Gebert LF, Rebhan MA, Crivelli SE, Denzler R, Stoffel M, Hall J. Miravirsen (SPC3649) can inhibit the biogenesis of miR-122. Nucleic Acids Res 2014;42(1):609–21. [49] Schoggins JW, Rice CM. Interferon-stimulated genes and their antiviral effector functions. Curr Opin Virol 2011;1(6):519–25. [50] Schmitt MJ, Philippidou D, Reinsbach SE, Margue C, Wienecke-Baldacchino A, Nashan D, et al. Interferon-␥-induced activation of signal transducer and activator of transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells. Cell Commun Signaling 2012;10: 41. [51] Nathans R, Chu CY, Serquina AK, Lu CC, Cao H, Rana TM. Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell 2009;34:696–709. [52] Gao L, Guo XK, Wang L, Zhang Q, Li N, Chen XX, et al. MicroRNA 181 suppresses porcine reproductive and respiratory syndrome virus (PRRSV) infection by targeting PRRSV receptor CD163. J Virol 2013;87(15):8808–12. [53] Terrier O, Textoris J, Carron C, Marcel V, Bourdon JC, Rosa-Calatrava M. Host microRNA molecular signatures associated with human H1N1 and H3N2 influenza A viruses reveal an unanticipated antiviral activity for miR-146a. J Gen Virol 2013;94(Pt 5):985–95.

Please cite this article in press as: Bela-ong DB, et al. Involvement of two microRNAs in the early immune response to DNA vaccination against a fish rhabdovirus. Vaccine (2015), http://dx.doi.org/10.1016/j.vaccine.2015.04.092

472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526