Involvement of the SH3 domain in Ca2+-mediated regulation of Src family kinases

Biochimie 88 (2006) 905–911 www.elsevier.com/locate/biochi

Involvement of the SH3 domain in Ca -mediated regulation of Src family kinases 2+

A.N.A. Monteiro * Risk Assessment, Detection and Intervention Program, The H. Lee Moffitt Cancer Center and Research Institute, MRC 3 West, 12902 Magnolia Drive, Tampa, FL 33612, USA Received 1 November 2005; accepted 20 January 2006 Available online 10 March 2006

Abstract When cells are treated with Ca2+ and Ca2+-ionophore, c-Src kinase activity increases, whereas c-Yes kinase activity decreases. This opposite modulation can be reproduced in an in vitro reconstitution assay and is dependent on Ca2+ and on soluble factors present in cell lysates. Since cSrc and c-Yes share a high degree of homology, with the exception of their N-terminal “unique” domains, their activity was thought to be coordinately regulated. To assess the mechanism of regulation we generated stable cell lines expressing eight different constructs containing wild type c-Src and c-Yes, as well as swaps of the unique domain alone, unique and Src homology 3 (SH3) domains together and the SH3 domain alone. Swapping of the unique domains was not sufficient to reverse the regulation of the chimeric molecules. On the other hand, chimeras containing swaps of the unique plus the SH3 domains displayed reverse regulation, implicating both domains in the regulation of kinase activity by Ca2+. To rule out the participation of the unique domain, we used chimeric molecules with swapped SH3 domains only and found that the SH3 domain is necessary and sufficient to confer Ca2+-mediated regulation of Src and Yes tyrosine kinases. © 2006 Elsevier SAS. All rights reserved. Keywords: c-Src; c-Yes; Tyrosine kinases; Calcium; MDCK cells; SH3 domain

1. Introduction Protein tyrosine kinases regulate several aspects of cell physiology such as cell growth and transformation. c-Src and c-Yes encode non-receptor tyrosine kinases that participate in cellular growth signaling pathways, since specific mutations that activate their intrinsic kinase activity lead to altered cell growth and neoplasia [1]. It has been shown that elevation of intracellular calcium levels causes c-Src activation and c-Yes inactivation [2,3]. Results obtained in other systems have supported the view of a cross talk between the tyrosine kinases signaling pathway and intracellular calcium levels [4–6]. Abbreviations: EDTA, ethylene dinitrilo-tetraacetic acid; GST, glutathioneS-transferase; GT, glutathione; IVKA, in vitro kinase assays; IVRA, in vitro reconstitution assays; MDCK, Madin–Darby canine cells; PMSF, phenylmethyl sulfonyl fluoride; PVDF, polyvinylidene difluoride; RIPA, radioimmunoprecipitation; SDS, sodium dodecyl sulfate; SH2, Src homology 2 domain; SH3, Src homology 3 domain. * Corresponding author. Tel.: +1 813 745 6321; fax: +1 813 745 1720. E-mail address: [email protected] (A.N.A. Monteiro). 0300-9084/$ - see front matter © 2006 Elsevier SAS. All rights reserved. doi:10.1016/j.biochi.2006.01.013

The p62c-yes (c-Yes) protein is highly homologous to p60c-src (c-Src): their C-terminal region share approximately 90% amino acid similarity and their N-terminal SH2 and SH3 domains share 75–80% amino acid identity [7,8] (Fig. 1A). With a few exceptions [9], it was generally believed that cSrc and c-Yes were coordinately regulated by action of cellular phosphatases and phosphorylation of their C-terminal negative regulatory tyrosine. During Ca2+-induced keratinocyte differentiation, c-Src is activated and c-Yes is inactivated. This phenomenon is also reproducible in several different cell types including fibroblasts, indicating that opposite regulation of c-Src and c-Yes activities is a general phenomenon [2,3]. Moreover, this modulation can be replicated in an in vitro reconstitution assay (IVRA) which demonstrated that it is dependent on factors present in the cell lysates. In the absence of cytosolic factors addition of Ca2+ to immunoprecipitates is not sufficient to cause an increase in c-Src activity nor decrease in c-Yes activity [2,3]. The opposite regulation found in c-Src and c-Yes raised the question of how differential regulation is achieved and which domains are responsible for regulation. Here, using

906

A.N.A. Monteiro / Biochimie 88 (2006) 905–911

Fig. 1. Generation of wild type and chimeric constructs of Src and Yes kinases, and α-Yes unique antibody. A. Constructs used in this study. The percent identity between the different domains of Src and Yes is shown. B. Antibody against the unique domain of c-Yes. Coomassie staining of GST-fusion of the unique domain of c-Yes used to raise a rabbit polyclonal antibody (left panel). MDCK and 3Y1 cells were harvested, lysed in RIPA buffer, separated on a 10% SDS-PAGE, transferred to a PVDF membrane and blotted against the α-GST c-Yes unique raised in this study (center panel) or with a α-human c-Yes (right panel). The double-headed arrow indicates the band corresponding to c-Yes. C. IVKA of MDCK cells overexpressing c-Yes using different antibodies against c-Yes (lanes 1–4). Lane 4 shows lysates precleared with α-GST c-Yes unique and then subjected to IVKA using α-human c-Yes.

a series of chimeric molecules containing swaps of the unique and SH3 domains of Src and Yes, I identify the SH3 domains as the domains responsible for the Ca2+-mediated regulation of Src and Yes. 2. Material and methods 2.1. Constructs pSrc: c-Src was amplified by PCR (first cycle: denature 94 ° C, 5 min; annealing 54 °C, 2 min; extension 72 °C, 3 min; subsequent 30 cycles: denature 94 °C, 1 min; annealing 54 ° C, 2 min; extension 72 °C, 3 min; and last cycle: denature 94 ° C, 1 min; annealing 54 °C, 2 min; extension 72 °C, 10 min) using primers S1 (5′ ATCGCGGATCCATGGGGAGCAA 3′) and S2 (5′ GGAGGGGTACCAGGCCTATAGGTT 3′) and plasmid p5H as template [10]. pYes: c-Yes was amplified by PCR (same conditions as above) using primers Y1 (5′ GACG GATCCAAGCAACCATGGGGTG 3′) and H (5′ CTGTTGGTACCTAAATTGTCCC 3′) and plasmid p6a as template [11]. The chimeric constructs were obtained using splicing by overlapping extension by PCR [12]. For each construct two initial (first round) separate PCR reactions were performed to generate the 5′ and the 3′ ends of the chimeras. The products of the two separate reactions were combined and used as templates for the second round of PCR. pYUS first round: primers Y1 and Y3 (5′ GCCCCGGCACGCTGCGGTGGCACAGCT GAAAATGA 3′) using p6a as template; primers S2 and S3

(5′ TCATTTTCAGCTGTGCCACCGCAGCGTGCCGGGG CACT 3′) using p5H as template. pYUS second round: primers Y1 and S2 with first round products combined and used as template. pSUY first round: primers S1 and F (5′ AGTACTAG GATATGGACTCGACGTAACGGTGTCAGA 3′) with p5H as template; primers H and G (5′ TCTGACACCGTTACGTC GAGTCCATATCCTAGTACT 3′) with p6a as template. pSUY second round: primers S1 and H with first round products combined and used as template. pYU3S2K first round: primers Y1 and R (5′ CTGGATGGAGTCTGAGGGAGCTA CATAATTGCTTGG 3′) with p6a as template; primers U (5′ CCAAGCAATTATGTAGCTCCCTCAGACTCCATCCAG 3′) and S2 with p5H as template. pYU3S2K second round: primers Y1 and S2 with first round products combined and used as template. pSU3Y2K first round: primers S1 and S (5′ TTGAATGGAGTCTGCAGGCGCGACATAGTTACTGGG 3′) with p5H as template; primers T (5′ CCCAGTAAC TATGTCGCGCCTGCAGACTCCATTCAA 3′) and H with p6a as template. pSU3Y2K second round: primers S1 and H with first round products combined and used as template. pYes (S3) first round: primers Y1 and S with pYUS as template; T and H with p6a as template. pYes(S3) second round: primers Y1 and H with first round products combined and used as template. pSrc(Y3) first round: primers S1 and R with pSUY as template; primers U and S2 with p5H as template. pSrc(Y3) second round: primers S1 and S2 with first round products combined and used as template. The final PCR products were cloned at BamH1 and KpnI sites into pMEXneo and confirmed by sequencing.

A.N.A. Monteiro / Biochimie 88 (2006) 905–911

2.2. Antibodies A polyclonal antiserum against a GST-fusion to chicken c-Yes unique domain was raised in rabbit. Chicken c-Yes unique domain was obtained by PCR, using Pfu polymerase, p6a plasmid as template [11] and primers Y9402340 (5′ CCATG GATCCCATTAAAAGCAAAG 3′) and Z9402341 (5′ CAC GAATTCAAGTACTAGGATATGGAC 3′). We inserted a 5′ BamH1 site and a 3′ EcoR1 site. The PCR fragment coding for the first 90 amino acids of c-Yes (270 bp) was digested and subcloned in frame to GST (glutathione-S-transferase) into pGEX1 (Pharmacia, Piscataway, NJ) and confirmed by sequencing. The bacterially expressed GST-fusion protein showed the expected 37.5 kDa band and was purified through binding to glutathione (GT)-agarose beads, eluted with reduced glutathione and used to generate a rabbit polyclonal antiserum against the chicken c-Yes unique domain. Polyclonal antisera against the unique and SH3 domains of human c-Yes and chicken c-Yes were a gift from Marius Sudol (Mount Sinai School of Medicine) [13]. Monoclonal antibodies against c-Src unique domain, Mab 2-17 and against c-Src SH3 domain, Mab 327 were a gift from Joan Brugge (Van Andel Research Institute) [14]. 2.3. Cell culture and stable transfections Madin–Darby canine kidney (MDCK, ATCC# CCL-34) and 3Y1 rat fibroblasts were maintained in DMEM supplemented with 10% calf serum. Stable transfections were performed with lipofectamine (GIBCo) and cells were selected with 0.4 mg/ml of G418. Clones were isolated and tested for expression by Western blot. Ten clones of each cell lines were isolated and screened for expression. Expression levels for the clones used in this study were high for Src and Yes but consistently lower for the chimeras being approximately the following: 30-fold for Src, 20-fold for Yes, and between two and fivefold for the chimeras. 2.4. In vitro kinase assays Cells were washed with PBS and lysed in RIPA buffer (150 mM NaCl, 10 mM Tris–HCl [pH 7.4], 5 mM EDTA, 0.1% SDS, 1% Triton X-100, 0.1% sodium deoxycholate, 1% trasylol, 1 mM leupeptin, 1 mM antipain, 1 mM PMSF, 1 mM sodium vanadate, 1 mM sodium molybdate). Src family kinases were immunoprecipitated using 1 μg of antibody bound to protein A/G agarose beads (polyclonal α-Yes unique domain, monoclonal α-Src Mabs 327 and 2-17) and 200 μg of total protein from cell lysates. Immunoprecipitates were washed twice in RIPA buffer and subsequently in kinase buffer (100 mM NaCl, 50 mM Tris–HCl [pH 7.4], 10 mM MnCl2, 0.2 mM sodium vanadate, 0.5 mM sodium molybdate and 0.1% β-mercaptoethanol). The samples in kinase buffer were incubated at RT in the presence of 0.5 μCi of [P32] ATP for 15 min. The reaction was stopped with loading buffer, boiled and separated on a 10% SDS-PAGE. All gels used in this study

907

were treated with KOH to eliminate alkali-labile phospho-serines and phospho-threonines [15]. In some cases IVKAs were preceded by depletion of endogenous proteins from lysates. Beads were precoated with the depleting antibody for 30 min, washed twice with RIPA and incubated with the cell extract for 4 h in the cold room. After the incubation period the samples were centrifuged, the lysate retrieved and added to a new set of beads with the immunoprecipitation antibodies for the IVKA. 2.5. IVRA IVRA were preformed as previously described in [3]. Briefly, supernatant from immunoprecipitates (called cytosolic fraction) were saved and set aside. Then immunoprecipitates were washed and incubated for 60 min with: RIPA only; RIPA plus 20 mM CaCl2, cytosolic fraction only; cytosolic fraction plus 20 mM CaCl2. After treatment the immunoprecipitates were subjected to in vitro kinase assays (IVKA) as described above. 2.6. In vivo treatment Cells were treated by adding 2 mM CaCl2 calcium and 2 μM A23187 calcium ionophore for 40 min (or mock treated with DMSO) to the culture medium. The cells were then lysed and Src and Yes were immunoprecipitated and subjected to IVKA. The immunoprecipitates were divided in two equal fractions, one being processed for Western blot and the other for kinase assays. 3. Results and discussion To identify which specific domain of the Src family kinases determines the opposite regulation of Src and Yes by Ca2+ I made use of chimeric molecules containing several swaps of the unique and SH3 domains of Src and Yes (Fig. 1A). In addition, to study chimeric constructs containing different fragments of c-Src and c-Yes I generated a polyclonal antibody against a GST-fusion to the chicken c-Yes unique domain (Fig. 1B, left panel). To test the specificity of the polyclonal antiserum I probed a Western blot of whole cell lysates of MDCK and 3Y1 cells. The antiserum recognized a major band of approximately 62 kDa, corresponding to the expected size of c-Yes (Fig. 1B, center panel) that comigrated with the band recognized by a previously characterized α-human Yes (Fig. 1B, right panel) and an α-chicken Yes antibodies (data not shown) [13]. I also performed IVKA comparing immunoprecipitates using the newly generated antiserum with two other characterized antibodies. The antibody recognized a native form of c-Yes as demonstrated by the kinase assay (Fig. 1C). Pre-clearing of the lysate with the newly generated antibody decreased substantially the activity shown in the immunoprecipitate with α-human c-Yes, indicating that it recognizes the same protein. Taken together, the data shows that the

908

A.N.A. Monteiro / Biochimie 88 (2006) 905–911

antiserum is specific for c-Yes. This antibody did not recognize Src unique domain (data not shown). MDCK cell lines express relatively low and high levels of c-Src and c-Yes, respectively (Zhao and Hanafusa, unpublished results), making it an ideal background to study activation of Src and inactivation of Yes by calcium. Initially, I tested whether c-Src and c-Yes were regulated by Ca2+ in MDCK cells. I found that the regulation of the kinase activity of Src and Yes by Ca2+, as demonstrated in other cell types [2,3] is also present in MDCK cells (Fig. 2A). Because the regulation of Src and Yes kinases is dependent not only on Ca2+ but also on the presence of cytosolic factors it was conceivable that cells overexpressing the chimeras would not display the regulation by calcium due to limiting amount of cytosolic factors. Thus, I confirmed that cells overexpressing Src and Yes displayed the regulation by treating cells with Ca2+ and Ca2+-ionophore and performing IVKA (Fig. 2B). These data suggest that the regulatory factors are present in excess in the cytoplasm. Having demonstrated that MDCK display Src and Yes regulation by Ca2+ even when these kinases were overexpressed, I generated MDCK cells stably expressing the constructs described in Fig. 1. Ten clones of each cell lines were isolated and screened for levels of ectopic expression. Expression varied from 1.5-fold to 30-fold in various constructs and the

clones expressing the highest levels were chosen. Interestingly, I only saw significant increase in phosphotyrosine levels in cells overexpressing c-Src by more than 10-fold over endogenous levels while no other clone expressing any of the other constructs displayed significant higher levels of phosphotyrosine (not shown). This is in agreement with earlier studies showing that only very high levels of c-Src overexpression lead to increased phosphotyrosine levels [16]. Past reports have shown that elevated levels of c-Src cause modification of cell morphology [17,18], but although several clones displayed a spindle-shaped phenotype we failed to see any correlation with levels of expression or construct being expressed (not shown). Overexpression was also not sufficient to promote MDCK invasion of a collagen gel matrix when plated on top of the matrix (not shown). The main difference between Src and Yes lies in their unique domain. Therefore, I initially hypothesized that the regulation by Ca2+ was mediated by their respective unique domains. However, these swaps failed to reverse the Ca2+mediated regulation of kinase activity (Fig. 3). Next I tested whether the chimeras containing the swaps of both the SH3 and the unique domain displayed reversed regulation. Interestingly, a Src chimera containing the Yes unique and SH3 domains (pYU3S2K) was inactivated by Ca2+ (Fig. 3). Conversely, a Yes chimera containing the unique and SH3 domains of

Fig. 2. IVRA and kinase assays. A. Regulation of endogenous c-Src and c-Yes by calcium can be demonstrated by IVRA in MDCK cells. B. Regulation of c-Src and c-Yes by calcium can be demonstrated in MDCK cells overexpressing Src and Yes by in vivo treatment of cells with 2 mM CaCl2 calcium and 2 μM A23187 calcium ionophore (or mock treated with DMSO) followed by immunoprecipitation and IVKA.

A.N.A. Monteiro / Biochimie 88 (2006) 905–911

909

Fig. 3. Calcium regulation is mediated by the SH3 domain. Kinase activity in cells overexpressing the kinases was determined by mock treating (–) or treating cells with calcium-ionophore and calcium (Ca2+). RIPA extracts were immunoprecipitated with the indicated antibodies and an IVKA was performed. Because the antibodies used to immunoprecipitate the overexpressed chimeras could also precipitate the endogenous proteins two sets of controls were performed. A parallel reaction was done using the same amount of protein in extracts from parental cells which express only the endogenous. In all cases tested, no signal was detected suggesting that the signal detected in cells overexpressing the chimeras could be ascribed solely to the chimeras (not shown). In addition we also performed depletion of the endogenous proteins from the lysates using a different antibody. Again no difference was seen suggesting that the signal detected could be ascribed solely to the chimeras.

Src (pSU3Y2K) was activated by Ca2+ (Fig. 3). These results suggested that the combination of the unique and SH3 domains or the SH3 domain alone were necessary to confer regulation. To determine whether the presence of the unique domain was required for efficient regulation, I tested chimeric molecules with swapped SH3 domains (pSrc[Y3]; pYes[S3]). These assays indicate that the SH3 domains are necessary and sufficient to confer the Ca2+-mediated regulation of kinase activity (Fig. 3). SH3 domains mediate protein–protein interactions through the recognition of proline rich sequence motifs [19,20]. Interestingly, the SH3 domains of Src and Yes have a high identity (~80%) with very few non-conservative changes between them. Nevertheless, several examples of differences in binding specificity have been demonstrated among members of the Src family kinases [21,22]. Most of the published data available indicates that Src and Yes have overlapping roles but evidence from different model systems suggest that Yes also performs specific cellular functions [7,23–26]. While Src has a role in actin cytoskeleton regulation that cannot be compensated by Yes [27–29], Yes seems to have a specific role in the regulation of cellular junctions [30–32]. In particular, Yes has been

implicated in the regulation of tight junction dynamics through phosphorylation of occludins [32]. However, in a model system different from the one used here also using MDCK cells but comparing Ca2+-rich and Ca2+-depleted medium the presence of Ca2+ was correlated with diminished occluding phosphorylation [32]. It is possible that Ca2+-mediated regulation of Yes may impinge on a complex pattern reorganization of cell junctions during differentiation that still needs further clarification. Other examples of differential regulation of Src and Yes have been found in colon carcinoma cells, where Src activity is increased and Yes decreased [9]. Previous studies addressing the role of the SH3 domain have relied on deletion or point mutations of the SH3 domain [33,34]. It has been shown that the SH3 domain is also required for the stabilization of the intramolecular interaction between the SH2 domain and the phosphorylated tail and that it interacts with the linker region between the SH2 and the kinase domain small lobe [34–37] findings that were confirmed by the crystal structures of Src and Hck kinases [38–42]. The fact that the SH3 domain represses kinase activity by interacting with the linker region raises the possibility that antibodies against the SH3 domain may induce changes in kinase activity intro-

910

A.N.A. Monteiro / Biochimie 88 (2006) 905–911

ducing a confounding factor in the experiments. However, this is unlikely given that when antibodies reactive against the unique domains were used (α-c-Yes unique and Mab 2-17) they generated identical results. At this point the mechanism by which binding of a Ca2+regulated protein(s) confers opposite regulation to Src and Yes is unknown. Regulation of Src family kinase activity has been shown to depend primarily on the interaction between the SH2 domain and the carboxy-terminal tyrosine [43,44]. A role for the SH3 has also been demonstrated in the case of HIV-1 Nef interaction to Hck [45]. It is possible that the protein(s) that mediate regulation are the same for Src and Yes, as their SH3 domains share significant specificity in binding (LXXXRPLPXψP for Src and ψXXXRPLPXLP for Yes; where ψ is any aliphatic amino acid) [25], but their effects on the structural conformation are differently translated to the catalytic domain. Alternatively, different protein(s) may mediate the effects via the different SH3 domains. The SH3 domain only swaps seem to argue against the former scenario although it is difficult to rule out the possibility that the presence of a heterologous SH3 domain may impart different properties to the molecule.

[7]

[8] [9]

[10]

[11]

[12]

[13] [14]

[15]

4. Conclusion

[16]

In conclusion, I investigated the nature of c-Src kinase activation and c-Yes kinase inactivation mediated by calcium and confirmed that calcium regulation is indirect, depending on soluble factors present in the cytoplasm. By using a strategy that relied on a series of chimeric molecules with swaps of different domains of c-Src and c-Yes I demonstrate that the SH3 domains are necessary and sufficient for this regulation.

[17]

Acknowledgements

[20]

I wish to thank Hidesaburo Hanafusa, Marius Sudol and Raymond Birge for helpful suggestions. This work was supported in part by a fellowship from the Pew Charitable Trusts and by the Molecular Imaging Core at the H.L. Moffitt Cancer Center. References [1] [2]

[3]

[4]

[5]

[6]

R. Jove, H. Hanafusa, Cell transformation by the viral src oncogene, Annu. Rev. Cell Biol. 3 (1987) 31–56. Y. Zhao, H. Uyttendaele, J.G. Krueger, M. Sudol, H. Hanafusa, Inactivation of c-Yes tyrosine kinase by elevation of intracellular calcium levels, Mol. Cell. Biol. 13 (1993) 7507–7514. Y. Zhao, M. Sudol, H. Hanafusa, J. Krueger, Increased tyrosine kinase activity of c-Src during calcium-induced keratinocyte differentiation, Proc. Natl. Acad. Sci. USA 89 (1992) 8298–8302. M.J. Bouchard, L.H. Wang, R.J. Schneider, Calcium signaling by HBx protein in hepatitis B virus DNA replication, Science 294 (2001) 2376– 2378. G. Rusanescu, H. Qi, S.M. Thomas, J.S. Brugge, S. Halegoua, Calcium influx induces neurite growth through a Src-Ras signaling cassette, Neuron 15 (1995) 1415–1425. S. Lev, H. Moreno, R. Martinez, P. Canoll, E. Peles, J.M. Musacchio, G.D. Plowman, B. Rudy, J. Schlessinger, Protein tyrosine kinase PYK2

[18]

[19]

[21]

[22] [23] [24]

[25]

[26]

[27]

[28]

involved in Ca(2+)-induced regulation of ion channel and MAP kinase functions, Nature 376 (1995) 737–745. J.M. Summy, M. Sudol, M.J. Eck, A.N. Monteiro, A. Gatesman, D.C. Flynn, Specificity in signaling by c-Yes, Front. Biosci. 8 (2003) s185– s205. A.Y. Tsygankov, Non-receptor protein tyrosine kinases, Front. Biosci. 8 (2003) s595–s635. J. Park, C.A. Cartwright, Src activity increases and Yes activity decreases during mitosis of human colon carcinoma cells, Mol. Cell. Biol. 15 (1995) 2374–2382. J.B. Levy, H. Iba, H. Hanafusa, Activation of the transforming potential of p60c-Src by a single amino acid change, Proc. Natl. Acad. Sci. USA 83 (1986) 4228–4232. M. Sudol, C. Kieswetter, Y.H. Zhao, T. Dorai, L.H. Wang, H. Hanafusa, Nucleotide sequence of a cDNA for the chick yes proto-oncogene: comparison with the viral yes gene, Nucleic Acids Res. 16 (1988) 9876. R. Higuchi, P.C.R. Recombinant, in: M.A. Innis, D.H. Gelfand, J.J. Sininski, T.J. White (Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, 1990, pp. 177–183. Y.H. Zhao, J.G. Krueger, M. Sudol, Expression of cellular-yes protein in mammalian tissues, Oncogene 5 (1990) 1629–1635. L.A. Lipsich, A.J. Lewis, J.S. Brugge, Isolation of monoclonal antibodies that recognize the transforming proteins of avian sarcoma viruses, J. Virol. 48 (1983) 352–360. C. Bourassa, A. Chapdelaine, K.D. Roberts, S. Chevalier, Enhancement of the detection of alkali-resistant phosphoproteins in polyacrylamide gels, Anal. Biochem. 169 (1988) 356–362. H. Iba, F.R. Cross, E.A. Garber, H. Hanafusa, Low level of cellular protein phosphorylation by nontransforming overproduced p60c-src, Mol. Cell. Biol. 5 (1985) 1058–1066. S.L. Warren, L.M. Handel, W.J. Nelson, Elevated expression of pp60csrc alters a selective morphogenetic property of epithelial cells in vitro without a mitogenic effect, Mol. Cell. Biol. 8 (1988) 632–646. S.L. Warren, W.J. Nelson, Nonmitogenic morphoregulatory action of pp60v-src on multicellular epithelial structures, Mol. Cell. Biol. 7 (1987) 1326–1337. R. Ren, B.J. Mayer, P. Cicchetti, D. Baltimore, Identification of a tenamino acid proline-rich SH3 binding site, Science 259 (1993) 1157– 1161. T.J. Boggon, M.J. Eck, Structure and regulation of Src family kinases, Oncogene 23 (2004) 7918–7927. Z. Weng, S.M. Thomas, R.J. Rickles, J.A. Taylor, A.W. Brauer, C. Seidel-Dugan, W.M. Michael, G. Dreyfuss, J.S. Brugge, Identification of Src, Fyn, and Lyn SH3-binding proteins: implications for a function of SH3 domains, Mol. Cell. Biol. 14 (1994) 4509–4521. C.S. Abrams, W. Zhao, SH3 domains specifically regulate kinase activity of expressed Src family proteins, J. Biol. Chem. 270 (1995) 333–339. P.L. Stein, H. Vogel, P. Soriano, Combined deficiencies of Src, Fyn, and Yes tyrosine kinases in mutant mice, Genes Dev. 8 (1994) 1999–2007. J.M. Summy, A.C. Guappone, M. Sudol, D.C. Flynn, The SH3 and SH2 domains are capable of directing specificity in protein interactions between the non-receptor tyrosine kinases cSrc and cYes, Oncogene 19 (2000) 155–160. A.B. Sparks, J.E. Rider, N.G. Hoffman, D.M. Fowlkes, L.A. Quilliam, B.K. Kay, Distinct ligand preferences of Src homology 3 domains from Src, Yes, Abl, Cortactin, p53bp2, PLCgamma, Crk, and Grb2, Proc. Natl. Acad. Sci. USA 93 (1996) 1540–1544. R.J. Rickles, M.C. Botfield, X. Zhou, P.A. Henry, J.S. Brugge, Phage display selection of ligand residues important for Src homology 3 domain binding specificity, Proc. Natl. Acad. Sci. USA 92 (1995) 10909– 10913. P. Soriano, C. Montgomery, R. Geske, A. Bradley, Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice, Cell 64 (1991) 693–702. B.F. Boyce, T. Yoneda, C. Lowe, P. Soriano, G.R. Mundy, Requirement of pp60c-src expression for osteoclasts to form ruffled borders and resorb bone in mice, J. Clin. Invest. 90 (1992) 1622–1627.

A.N.A. Monteiro / Biochimie 88 (2006) 905–911 [29] K.B. Kaplan, J.R. Swedlow, D.O. Morgan, H.E. Varmus, c-Src enhances the spreading of src–/– fibroblasts on fibronectin by a kinase-independent mechanism, Genes Dev. 9 (1995) 1505–1517. [30] S. Tsukita, K. Oishi, T. Akiyama, Y. Yamanashi, T. Yamamoto, S. Tsukita, Specific proto-oncogenic tyrosine kinases of src family are enriched in cell-to-cell adherens junctions where the level of tyrosine phosphorylation is elevated, J. Cell Biol. 113 (1991) 867–879. [31] A. Nusrat, J.A. Chen, C.S. Foley, T.W. Liang, J. Tom, M. Cromwell, C. Quan, R.J. Mrsny, The coiled-coil domain of occludin can act to organize structural and functional elements of the epithelial tight junction, J. Biol. Chem. 275 (2000) 29816–29822. [32] Y.H. Chen, Q. Lu, D.A. Goodenough, B. Jeansonne, Nonreceptor tyrosine kinase c-Yes interacts with occludin during tight junction formation in canine kidney epithelial cells, Mol. Biol. Cell 13 (2002) 1227–1237. [33] C. Seidel-Dugan, B.E. Meyer, S.M. Thomas, J.S. Brugge, Effects of SH2 and SH3 deletions on the functional activities of wild-type and transforming variants of c-Src, Mol. Cell. Biol. 12 (1992) 1835–1845. [34] M. Okada, B.W. Howell, M.A. Broome, J.A. Cooper, Deletion of the SH3 domain of Src interferes with regulation by the phosphorylated carboxyl-terminal tyrosine, J. Biol. Chem. 268 (1993) 18070–18075. [35] S.M. Murphy, M. Bergman, D.O. Morgan, Suppression of c-Src activity by C-terminal Src kinase involves the c-Src SH2 and SH3 domains: analysis with Saccharomyces cerevisiae, Mol. Cell. Biol. 13 (1993) 5290– 5300. [36] T. Erpel, G. Superti-Furga, S.A. Courtneidge, Mutational analysis of the Src SH3 domain: the same residues of the ligand binding surface are im-

[37]

[38]

[39] [40] [41]

[42] [43]

[44] [45]

911

portant for intra- and intermolecular interactions, EMBO J. 14 (1995) 963–975. G. Superti-Furga, S. Fumagalli, M. Koegl, S.A. Courtneidge, G. Draetta, Csk inhibition of c-Src activity requires both the SH2 and SH3 domains of Src, EMBO J. 12 (1993) 2625–2634. W. Xu, A. Doshi, M. Lei, M.J. Eck, S.C. Harrison, Crystal structures of c-Src reveal features of its autoinhibitory mechanism, Mol. Cell 3 (1999) 629–638. W. Xu, S.C. Harrison, M.J. Eck, Three-dimensional structure of the tyrosine kinase c-Src, Nature 385 (1997) 595–602. S.C. Harrison, Variation on an Src-like theme, Cell 112 (2003) 737–740. J.C. Williams, A. Weijland, S. Gonfloni, A. Thompson, S.A. Courtneidge, G. Superti-Furga, R.K. Wierenga, The 2.35 Å crystal structure of the inactivated form of chicken Src: a dynamic molecule with multiple regulatory interactions, J. Mol. Biol. 274 (1997) 757–775. F. Sicheri, I. Moarefi, J. Kuriyan, Crystal structure of the Src family tyrosine kinase Hck, Nature 385 (1997) 602–609. M. Matsuda, B.J. Mayer, Y. Fukui, H. Hanafusa, Binding of transforming protein, P47gag-crk, to a broad range of phosphotyrosine-containing proteins, Science 248 (1990) 1537–1539. T. Pawson, New impressions of Src and Hck, Nature 385 (585) (1997) 582–583. I. Moarefi, M. LaFevre-Bernt, F. Sicheri, M. Huse, C.H. Lee, J. Kuriyan, W.T. Miller, Activation of the Src-family tyrosine kinase Hck by SH3 domain displacement, Nature 385 (1997) 650–653.