- Email: [email protected]
Irbesartan attenuates production of high-mobility group box 1 in response to lipopolysaccharide via downregulation of interferon-β production
International Immunopharmacology 26 (2015) 97–102
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Irbesartan attenuates production of high-mobility group box 1 in response to lipopolysaccharide via downregulation of interferon-β production Yoshiro Kato a,⁎, Hideki Kamiya a, Naoki Koide b, Erdenezaya Odkhuu b, Takayuki Komatsu b, Atsuko Watarai a, Masaki Kondo a, Koichi Kato c, Jiro Nakamura a, Takashi Yokochi b a b c
Division of Diabetes, Department of Internal Medicine, Aichi Medical University School of Medicine, Nagakute Aichi 480-1195, Japan Department of Microbiology and Immunology, Aichi Medical University School of Medicine, Nagakute, Aichi 480-1195, Japan Laboratory of Medicine, Aichi Gakuin University School of Pharmacy, Nagoya 464-0037, Japan
a r t i c l e
i n f o
Article history: Received 7 October 2014 Received in revised form 10 March 2015 Accepted 11 March 2015 Available online 24 March 2015 Keywords: High-mobility group box 1 Interferon-β Irbesartan Lipopolysaccharide Nitric oxide
a b s t r a c t High-mobility group box 1 (HMGB1) is suggested to participate in development of local and systemic inflammatory disorders. Irbesartan (IRB), an angiotensin II type1 receptor blocker, is widely used for treatment of hypertension, especially in patients with diabetic nephropathy. The effect of IRB on lipopolysaccharide (LPS)-induced HMGB1 and nitric oxide (NO) production was examined using RAW 264.7 macrophage-like cells. IRB inhibited LPS-induced HMGB1 production. IRB also reduced LPS-induced expression of an inducible NO synthase, and inhibited LPS-induced NO production. The expression levels of IFN-β protein and mRNA, which is a key molecule in MyD88-independent pathway of LPS signaling, were exclusively inhibited by IRB. Peroxisome proliferatoractivated receptor-γ and angiotensin II type 1 receptor were not involved in the inhibitory action of IRB on LPS-induced HMGB1 and NO production. Collectively, IRB was suggested to inhibit LPS-induced HMGB1 production via downregulation of IFN-β production in the MyD88-independent pathway. © 2015 Elsevier B.V. All rights reserved.
1. Introduction High-mobility group box 1 (HMGB1) is a nuclear DNA-binding protein involved in maintenance of nucleosome structure and regulation of gene transcription [1]. HMGB1 can be released into the extracellular space from immune and non-immune cells in response to various stimuli and acts as a pro-inflammatory late mediator through the receptor for advanced glycation endproducts, and toll-like receptor (TLR) 2/4 [2]. HMGB1 is suggested to play an important role in local and systemic inflammatory disorders, such as sepsis, lung injury, intestinal barrier dysfunction, arthritis, endotoxemia and death [3]. Administration of HMGB1 antagonist is reported to reduce lethality of established sepsis in mice even when administration of HMGB1 antagonist is delayed 2 h after lipopolysaccharide (LPS) stimulation [3,4]. Therefore, HMGB1 is considered as a potential therapeutic target for local and systemic inflammatory disorders. Irbesartan (IRB), an angiotensin II type1 receptor (AR) blocker, is widely used for treatment of hypertension, especially in patients with
⁎ Corresponding author at: Division of Diabetes, Department of Internal Medicine, Aichi Medical University School of Medicine, 1-1 Yazakokarimata, Nagakute, Aichi 480-1195, Japan. Tel.: +81 561 63 1683; fax: +81 561 63 1276. E-mail address: [email protected] (Y. Kato).
http://dx.doi.org/10.1016/j.intimp.2015.03.015 1567-5769/© 2015 Elsevier B.V. All rights reserved.
diabetic nephropathy. Interestingly, the number of HMGB1-producing macrophages is reported to significantly increase in atherosclerotic lesions [5]. The serum HMGB1 concentrations are significantly increased in type 1 and type 2 diabetic patients [6,7]. Therefore, it is of interest to elucidate the effect of IRB on the production of HMGB1 as a pro-inflammatory late mediator. In the present study, we investigated the effect of IRB on the production of HMGB1 in RAW 264.7 macrophage cells in response to LPS. Here, we report that IRB inhibits LPS-induced HMGB1 production via downregulation of interferon (IFN)-β production. 2. Materials and methods 2.1. Materials IRB and losartan (LOS) were obtained from Shionogi & Co., Ltd., (Osaka, Japan) and LKT Laboratories, Inc. (St. Paul, MN, USA), respectively. LPS from Escherichia coli O55:B5, poly I:C, and 2-chloro-5nitrobenzanilide (GW9662) were purchased from Sigma Chemicals Co. (St. Louis, MO, USA). An antibody to p65 NF-κB or the phosphorylated form (Ser276) was purchased from Cell signaling Technology (Beverly, MA, USA). IRB was dissolved at a concentration of 20 mM in dimethyl sulfoxide (DMSO) and the negative control medium contained 0.25% DMSO in any experiment unless otherwise stated. LPS and LOS was dissolved in phosphate buffered saline (PBS).
98
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
2.2. Cell culture The murine macrophage cell line, RAW 264.7 cells, was obtained from Riken Cell Bank (Tsukuba, Japan). Peritoneal cells were obtained by washing out the peritoneal cavities of C57BL/6 mice with RPMI 1640 medium. Peritoneal cells were cultured in RPMI 1640 medium containing 5% heat-inactivated fetal calf serum (Gibco-BRL, Gaitherburg, MD, USA) in the 96-well plate (BD Biosciences, San Jose, CA, USA) for 1 h and adherent cells were used as macrophages. RAW 264.7 cells were also maintained in RPMI 1640 medium containing 5% heat-inactivated fetal calf serum and antibiotics at 37 °C under 5% CO2 at a cell density of 5 × 104 cells/ml in a petri dish (Nissui Pharmaceutical Co., Tokyo, Japan). All animal experiments were approved by the Animal Care Committee of Aichi Medical University and carried out under the guide for care and use of laboratory animals. 2.3. Determination of nitrite concentration Nitrite, the end product of nitric oxide (NO) metabolism, was measured by using Griess reagent [8]. RAW 264.7 cells (2 × 104 cells/ 100 μl/well in a 96-well plate) were cultured in the presence or absence of IRB (0.1 μM to 50 μM) for 1 h and then stimulated with LPS (100 ng/ml) for 24 h.
was reverse-transcribed using a RT system with random hexamers (Toyobo, Tokyo, Japan). After cDNA synthesis, quantitative real-time PCR was performed using StepOne real-time PCR (Applied Biosystems, Foster City, CA, USA). The reaction mixture consists of SYBR Green PCR Matrix mix (Toyobo) and sequence-specific primers: β-actin sense, 5′-ATGACCCAGATCATGTTTGA-3′, antisense, 5′-TACGACCAGAGGCATA CAG-3′; an inducible NO synthase sense, GTCTTGCAAGCTGATGGTCA, antisense, ACCACTCGTACTTGGGATGC, interferon (IFN)-β sense, 5′-AAACAATTTCTCCAGCACTG-3′, antisense, 5′-ATTCTGAGGCATCAAC TGAC-3′. The expression levels of iNOS and IFN-β mRNA were normalized to β-actin using the ΔΔCt method. Parallelism of standard curves of the test and control was confirmed. 2.8. Statistical analysis Data were expressed as mean ± S.D. of values from at least three independent experiments and statistical significance was evaluated using the unpaired t-test. A value of p b 0.05 was considered statistically significant. 3. Results 3.1. The inhibitory effect of IRB on LPS-induced HMGB1 production in RAW 264.7 cells
2.4. Determination of HMGB1 and IFN-β levels RAW 264.7 cells (2 × 104 cells/100 μl/well in a 96-well plate) were pretreated with or without IRB (0.1 μM to 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 48 h (HMGB1 determination) or 3 h (IFN-β determination), respectively. The concentrations of HMGB1 and IFN-β in the culture supernatant were determined by an enzyme-linked immunosorbent assay kit from (Shino-Test Corporation, Tokyo, Japan) and PBL Biomedical Laboratories (Piscataway, NJ), respectively.
First, the effect of IRB at various concentrations on LPS-induced HMGB1 production was examined (Fig. 1A). RAW 264.7 cells were
2.5. Cell viability Cell viability was determined by the method to measure reduction of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) (Chemicon, Temecula, CA, USA) [9]. 2.6. Immunoblotting RAW 264.7 cells were pretreated with IRB (0, 25 or 50 μM) for 1 h and stimulated with or without LPS (100 ng/ml) for 30 min. Cells were lysed in a lysis buffer (50 mM Tris–HCl at pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10 mM sodium fluoride, 1 mM sodium orthovanadate) containing a protease inhibitor cocktail (Sigma, St Louis, MO, USA). Proteins (20 μg) in cell lysates were separated by sodium dodecyl sulfate-polyacrylamide (8 to 15%) gel electrophoresis and then electroblotted onto membranes (Durapore, Merck Millipore, Billerica, MA, USA) [10,11]. The membrane was placed in PBS containing 5% skim milk and 0.05% Tween 20 for 1 h, followed by incubation for 16 h in the presence of the first antibody to p65 NF-κB or the phosphorylated form (Ser276) at 1:2000 at 4 °C. The membrane was then incubated for 1 h with horseradish peroxidase-conjugated anti-rabbit IgG antibody as a second antibody at 1:2000 (Pierce, Rockford, IL, USA). Finally, immunoreactive protein bands were visualized by using a chemiluminescence reagent, supersignal west dura (Pierce, Rockford, IL, USA) and an AE6955 light capture system with a CS analyzer (Atto, Tokyo, Japan). 2.7. Quantitative real-time reverse transcription (RT)-polymerase chain reaction (PCR) Total RNA was extracted from RAW 264.7 cells using the TriPure Isolation reagent (Roche diagnostic, Grand Island, NY, USA). Total RNA
Fig. 1. Effect of IRB on LPS-induced HMGB1 production. A, RAW 264.7 cells were pretreated with various concentrations of IRB for1 h and stimulated with LPS (100 ng/ml) for 48 h. *p b 0.05 and **p b 0.005 vs LPS alone. B, Cells were treated with IRB at 50 μM 1 h before LPS stimulation (−1), at the same time (0), or 2 h after LPS stimulation (2). N.S., not significant. Data were obtained from 3 independent experiments.
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
treated with various concentrations of IRB for 1 h before LPS stimulation. IRB at the concentrations ranging from 0.1 to 50 μM significantly inhibited LPS-induced HMGB1 production. The degree of inhibition was dose-dependent on the concentrations of IRB. Second, the cells were treated with IRB simultaneously with LPS or post-treated with IRB 2 h after LPS stimulation. There was no significant difference in the inhibitory effect of IRB among pretreatment, simultaneous treatment and post-treatment (Fig. 1B). 3.2. The inhibitory effect of IRB on production of NO in response to LPS LPS induces the release of HMGB1 via the MyD88-independent signal pathway and it also triggers the production of NO via the same signal pathway [12]. Therefore, the effect of IRB on LPS-induced NO production was examined in RAW 264.7 cells. The cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. IRB at the concentrations ranging from 1 to 50 μM inhibited LPS-induced NO production and the degree of
99
inhibition was dose-dependent on the concentrations of IRB (Fig. 2A). The effect of IRB on the expression of iNOS mRNA was also examined. Quantitative real-time RT-PCR analysis demonstrated that IRB at 50 μM significantly inhibited LPS-induced iNOS mRNA expression (Fig. 2B), suggesting that IRB inhibits the iNOS expression at the transcriptional level. Further, the effect of IRB on LPS-induced NO production was examined by using murine peritoneal macrophages. IRB at 50 μM inhibited LPS-induced NO production in murine peritoneal macrophages as well as RAW 264.7 cells (Fig. 2C). To exclude a possibility that the inhibition of LPS-induced HMGB1 and NO production is due to a cytotoxic action of IRB, the effect of IRB on the MTT activity of RAW 264.7 cells in the presence or absence of LPS was examined. IRB at 25 or 50 μM did not reduce the viability of RAW 264.7 cells even in the presence of LPS (100 ng/ml), indicating that the inhibition of LPS-induced HMGB1 and NO production by IBR was not due to cell death. 3.3. The effect of IRB on phosphorylation of p65 NF-κB in response to LPS LPS triggers both the MyD88-dependent and independent pathways and LPS-induced NO production is mediated by the MyD88-dependent pathway, especially NF-κB and also by the MyD88-independent pathway [13]. The effect of IRB on LPS-induced NF-κB activation in the MyD88-dependent pathway was examined. RAW 264.7 cells were pretreated with IRB (25 or 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 30 min. The phosphorylation of p65 NF-κB was determined by immunoblotting using an antibody to p65 NF-κB or its phosphorylated form. LPS clearly induced phosphorylation of p65 NF-κB and IRB at 25 or 50 μM did not affect LPS-induced p65 NF-κB phosphorylation (Fig. 3), suggesting that IRB does not affect LPS-induced NF-κB activation. 3.4. The inhibitory effect of IRB on production of NO in response to poly I:C Poly I:C exclusively activates the MyD88-independent pathway via TLR3 [14,15] and leads to the NO production. The experiment was performed using poly I:C in place of LPS to confirm a possibility that IRB might inhibit LPS-induced NO and HMGB1 production via inactivation of the MyD88-independent pathway of LPS signaling. IRB at the concentrations ranging from 0.1 to 50 μM inhibited poly I:C-induced NO production (Fig. 4). The inhibition of IRB at 50 μM was stronger than that of IRB at 0.1 μM. IRB was suggested to inhibit LPS-induced HMGB1 and NO production through impairing the MyD88-independent pathway of LPS signaling. 3.5. The inhibitory effect of IRB on the expression of IFN-β protein and mRNA in MyD88-independent pathway In the MyD88-independent pathway LPS induces the production of IFN-β via activation of TRIF and interferon regulatory factor (IRF) 3, and IFN-β leads to the NO production [14]. To characterize the inhibitory mechanism of IRB on the MyD88-independent pathway, the effect of IRB
Fig. 2. Effect of IRB on LPS-induced NO production. A, RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. *p b 0.01 vs LPS alone. B, RAW 264.7 cells were pretreated with or without 50 μM IRB for 1 h and stimulated with LPS (100 ng/ml) for 3 h. The iNOS mRNA expression was analyzed with quantitative real-time RT-PCR. The expression of β-actin mRNA was used as internal control. *p b 0.01 vs LPS alone. C, Murine peritoneal macrophages were pretreated with or without 50 μM IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. *p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
Fig. 3. Effect of IRB on LPS-induced NF-κB activation. RAW 264.7 cells were pretreated with IRB (25 or 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 30 min. Expression of p65 NF-κB and the phosphorylated form was analyzed by immunoblotting. A typical result in three independent experiments is shown.
100
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
3.6. Independence of the inhibitory effect of IRB on LPS-induced HBGB1 and NO production from peroxisome proliferator-activated receptor (PPAR)-γ and AR
Fig. 4. Effect of IRB on poly I:C-induced NO production. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with poly I:C (50 μg/ml) for 24 h. *p b 0.01 vs poly I:C alone. Data were obtained from 3 independent experiments.
on the expression of IFN-β protein and mRNA was examined. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml). The expression of IFN-β protein (A) and mRNA (B) were determined 3 h and 1 h after LPS treatment, respectively. IRB at the concentrations ranging from 1 to 50 μM inhibited the production of IFN-β protein (Fig. 5A) and the expression of IFN-β mRNA (Fig. 5B), suggesting that the inhibitory effect of IRB on LPSinduced HMGB1 and NO production might be mediated by downregulation of the IFN-β production in the MyD88-independent pathway.
Fig. 5. Effect of IRB on LPS-induced IFN-β protein and mRNA expression. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml). The expression of IFN-β protein (A) and mRNA (B) were determined 3 h and 1 h after LPS treatment, respectively. *p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
IRB is known to have an agonistic effect on PPAR-γ [16]. To examine involvement of PPAR-γ in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production, the effect of GW9662, a PPAR-γ antagonist [17], on IRB-induced HMGB1 and NO inhibition was examined. RAW 264.7 cells were pretreated with GW9662 as a PPAR-γ selective antagonist for 30 min, treated with IRB for 1 h, and then stimulated with LPS. GW9662 did not affect the inhibitory effect of IRB on LPS-induced HMGB1 (Fig. 6A) or NO production (Fig. 6B), suggesting that IRB inhibited LPS-induced HMGB1 and NO production independently of PPAR-γ. To examine involvement of AR in the inhibitory effect of IRB on LPS-induced production of HMGB1 and NO, the effect of losartan (LOS), another AR blocker, on LPS-induced HMGB1 and NO production was examined. IRB at 50 μM inhibited LPS-induced HMGB1 and NO production whereas LOS at 50 μM did not inhibit them (Fig. 7A, B), suggesting that the inhibitory effect of IRB was exhibited independently of AR as well as PPAR-γ. 4. Discussion The present study has demonstrated that IRB inhibits LPS-induced HMGB1 and NO production via reduced production of IFN-β in MyD88-independent pathway in RAW 264.7 macrophage-like cells. The evidences supporting this conclusion are as follows; IRB did not inhibit LPS-induced NF-κB activation that is mainly dependent on
Fig. 6. No involvement of PPAR-γ in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production. RAW 264.7 cells were pretreated with GW9662 (10 μM) as a PPAR-γ antagonist for 30 min, treated with IRB (25 or 50 μM) for 1 h, and then stimulated with LPS (100 ng/ml). HMGB1 (A) and NO (B) were determined 48 or 24 h after LPS treatment, respectively. NS, not significant. Data were obtained from 3 independent experiments.
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
101
Fig. 8. A schematic diagram explaining the mechanism underlying the inhibition of LPS-induced production of HMGB1 by IRB. Fig. 7. No involvement of AR in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production. RAW 264.7 cells were pretreated with LOS (50 μM) as an AR blocker or IRB (50 μM) for 1 h and then stimulated with LPS (100 ng/ml). HMGB1 (A) and NO (B) were determined 48 or 24 h after LPS treatment, respectively.* p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
MyD88-dependent pathway, IRB inhibited poly I:C-induced NO production that is mediated only by MyD88-independent pathway via TLR3, and IRB downregulated the expression of IFN-β protein and mRNA as an critical factor in MyD88-independent pathway of LPS signaling. A schematic diagram explaining the mechanism underlying the inhibition of LPS-induced production of HMGB1 by IRB is shown in Fig. 8. We for the first time demonstrate that IRB inhibits the production of HMGB1 or NO in response to LPS as TLR ligands, such as LPS and poly I:C. Therefore, IRB is suggested to inhibit inflammatory responses caused by innate immunity using TLRs. Several reports indicate that HMGB1 is a pro-inflammatory cytokine which may contribute to the pathogenesis of micro- and macrovascular complications in diabetes [18–23]. Circulating HMGB1 is positively associated with body mass index, while adipose HMGB1 mRNA levels correlate with the expression of inflammatory markers [24]. Insulin resistance modifies the intracellular distribution of HMGB1 in human adipocytes, with HMGB1 being predominantly nuclear in lean and obese normoglycemic individuals while localized to the cytosol in obese type 2 diabetic patients, and HMGB1 acts as a stimulatory factor of insulin secretion of β-cells [24]. HMGB1 is suggested to act as an adipokine contributing to low-grade inflammation in fat tissue [25]. Hyperglycemia induces the expression and production of HMGB1 in human aortic endothelial cells [26]. These findings suggest that HMGB1 plays an important role in the development of diabetic complications through inflammatory processes. However, the therapeutic effect of IRB on diabetic complications is a matter of speculation.
The inhibitory effect of IRB is not responsible for an agonist of PPARγ and AR. In this study LOS does not inhibit LPS-induced HMGB1 production in RAW 264.7 cells. On the other hand, Hagiwara et al. have reported that LOS attenuates LPS-induced HMGB1 production in RAW 264.7 cells via inhibition of NF-κB pathway [27]. The reason for the difference between the two reports is unknown. In addition, resveratrol inhibits LPS-induced expression of HMGB1 and TLR 4 in RAW 264.7 cells [28]. Shikonin as a naphthoquinone, which is from the root of medical herb, reduces LPS-induced HMGB1 production via IFN and NF-κB in RAW 264.7 cells [29]. The precise mechanism for inhibition of LPS-induced production of IFN-β by IRB is unclear. Based on the reduced IFN-β mRNA expression, the IFN-β production must be inhibited at a transcriptional level. It was technically difficult to examine the effect of IRB on the IRF 3 expression in response to LPS or poly I:C. Further, the inhibitory effect of IRB is not responsible for an agonist of PPAR-γ and AR. HMGB1 plays an important role in endotoxic shock or septic shock at a late stage pro-inflammatory mediator and NO also functions as a proinflammatory mediator for LPS-induced cell death and tissue injury. IRB inhibits the production of NO as well as HMGB1 in response to LPS. The inhibition of both NO and HMGB1 production by IRB is reasonable since IRB inhibits the production of IFN-β as an important molecule in the MyD88-independent pathway of LPS signaling. Moreover, LPS-induced HMGB1 production is reported to depend on the NO production [12], suggesting that IRB-induced IFN-β inhibition causes the downregulation of HMGB1 via reduced NO production. Thus, we demonstrate that IRB inhibits the production of late pro-inflammatory mediators in response to LPS. Although IRB is reported to exhibit an antiinflammatory action [30,31], there is no report on the effectiveness of IRB on LPS-mediated inflammatory responses. It is of interest to clarify the therapeutic effectiveness of IRB against LPS-related inflammatory disorders.
102
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
Conflict of interest The authors have no conflict of interest to report in relation to this manuscript. References [1] M.E. Bianchi, M. Beltrame, Flexing DNA: HMG-box proteins and their partners, Am. J. Hum. Genet. 63 (1998) 1573–1577. [2] H. Yang, H. Wang, C.J. Czura, et al., The cytokine activity of HMGB1, J. Leukoc. Biol. 78 (2005) 1–8. [3] H. Wang, O. Bloom, M. Zhang, et al., HMG-1 as a late mediator of endotoxin lethality in mice, Science 285 (1999) 248–251. [4] H. Yang, M. Ochani, J. Li, et al., Reversing established sepsis with antagonists of endogenous high-mobility group box 1, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 296–301. [5] N. Kalinina, A. Agrotis, Y. Antropova, et al., Increased expression of the DNA-binding cytokine HMGB1 in human atherosclerotic lesions: role of activated macrophages and cytokines, Arterioscler. Thromb. Vasc. Biol. 24 (2004) 2320–2325. [6] S. Devaraj, M.R. Dasu, S.H. Park, et al., Increased levels of ligands of Toll-like receptors 2 and 4 in type 1 diabetes, Diabetologia 52 (2009) 1665–1668. [7] M.R. Dasu, S. Devaraj, S. Park, et al., Increased toll-like receptor (TLR) activation and TLR ligands in recently diagnosed type 2 diabetic subjects, Diabetes Care 33 (2010) 861–868. [8] L.C. Green, D.A. Wagner, J. Glogowski, et al., Analysis of nitrate, nitrite, and [15 N]nitrate in biological fluids, Anal. Biochem. 126 (1982) 131–138. [9] M. Hanelt, M. Gareis, B. Kollarczik, Cytotoxicity of mycotoxins evaluated by the MTT-cell culture assay, Mycopathologia 128 (1994) 167–174. [10] W.N. Burnette, “Western blotting”: electrophoretic transfer of proteins from sodium dodecyl sulfate–polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A, Anal. Biochem. 112 (1981) 195–203. [11] G. Tumurkhuu, N. Koide, J. Dagvadorj, et al., The inhibition of lipopolysaccharideinduced tumor necrosis factor-alpha and nitric oxide production by Clostridium perfringens alpha-toxin and its relation to alpha-toxin-induced intracellular ceramide generation, Int. J. Med. Microbiol. 299 (2009) 554–562. [12] J.H. Kim, S.J. Kim, I.S. Lee, et al., Bacterial endotoxin induces the release of high mobility group box 1 via the IFN-beta signaling pathway, J. Immunol. 182 (2009) 2458–2466. [13] S. Akira, Toll-like receptor signaling, J. Biol. Chem. 278 (2003) 38105–38108. [14] S. Akira, K. Takeda, Toll-like receptor signalling, Nat. Rev. Immunol. 4 (2004) 499–511. [15] J. Pindado, J. Balsinde, M.A. Balboa, TLR3-dependent induction of nitric oxide synthase in RAW 264.7 macrophage-like cells via a cytosolic phospholipase A2/cyclooxygenase-2 pathway, J. Immunol. 179 (2007) 4821–4828. [16] M. Schupp, J. Janke, R. Clasen, et al., Angiotensin type 1 receptor blockers induce peroxisome proliferator-activated receptor-gamma activity, Circulation 109 (2004) 2054–2057.
[17] R. Clasen, M. Schupp, A. Foryst-Ludwig, et al., PPARgamma-activating angiotensin type-1 receptor blockers induce adiponectin, Hypertension 46 (2005) 137–143. [18] X.X. Yan, L. Lu, W.H. Peng, et al., Increased serum HMGB1 level is associated with coronary artery disease in nondiabetic and type 2 diabetic patients, Atherosclerosis 205 (2009) 544–548. [19] J. Kim, E. Sohn, C.S. Kim, et al., The role of high-mobility group box-1 protein in the development of diabetic nephropathy, Am. J. Nephrol. 33 (2011) 524–529. [20] G. Mohammad, M.M. Siddiquei, A. Othman, et al., High-mobility group box-1 protein activates inflammatory signaling pathway components and disrupts retinal vascular-barrier in the diabetic retina, Exp. Eye Res. 107 (2013) 101–109. [21] J.W. Nin, I. Ferreira, C.G. Schalkwijk, et al., Higher plasma high-mobility group box 1 levels are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes: a 12 year follow-up study, Diabetologia 55 (2012) 2489–2493. [22] X.L. Chen, X.D. Zhang, Y.Y. Li, et al., Involvement of HMGB1 mediated signalling pathway in diabetic retinopathy: evidence from type 2 diabetic rats and ARPE-19 cells under diabetic condition, Br. J. Ophthalmol. 97 (2013) 1598–1603. [23] A.M. Abu El-Asrar, M.M. Siddiquei, M.I. Nawaz, et al., The proinflammatory cytokine high-mobility group box-1 mediates retinal neuropathy induced by diabetes, Mediat. Inflamm. 2014 (2014) 746415. [24] R. Guzman-Ruiz, F. Ortega, A. Rodriguez, et al., Alarmin high-mobility group B1 (HMGB1) is regulated in human adipocytes in insulin resistance and influences insulin secretion in beta-cells, Int. J. Obes. 38 (2014) 1545–1554. [25] B. Nativel, M. Marimoutou, V.G. Thon-Hon, et al., Soluble HMGB1 is a novel adipokine stimulating IL-6 secretion through RAGE receptor in SW872 preadipocyte cell line: contribution to chronic inflammation in fat tissue, PLoS One 8 (2013) e76039. [26] D. Yao, M. Brownlee, Hyperglycemia-induced reactive oxygen species increase expression of the receptor for advanced glycation end products (RAGE) and RAGE ligands, Diabetes 59 (2010) 249–255. [27] S. Hagiwara, H. Iwasaka, S. Hidaka, et al., Antagonist of the type-1 ANG II receptor prevents against LPS-induced septic shock in rats, Intensive Care Med. 35 (2009) 1471–1478. [28] Y. Yang, S. Li, Q. Yang, et al., Resveratrol reduces the proinflammatory effects and lipopolysaccharide-induced expression of HMGB1 and TLR4 in RAW264.7 cells, Cell. Physiol. Biochem. 33 (2014) 1283–1292. [29] Y. Yang, J. Wang, Q. Yang, et al., Shikonin inhibits the lipopolysaccharide-induced release of HMGB1 in RAW264.7 cells via IFN and NF-kappaB signaling pathways, Int. Immunopharmacol. 19 (2014) 81–87. [30] F. Persson, P. Rossing, P. Hovind, et al., Irbesartan treatment reduces biomarkers of inflammatory activity in patients with type 2 diabetes and microalbuminuria: an IRMA 2 substudy, Diabetes 55 (2006) 3550–3555. [31] S. Tsuruoka, H. Kai, J. Usui, et al., Effects of irbesartan on inflammatory cytokine concentrations in patients with chronic glomerulonephritis, Intern. Med. 52 (2013) 303–308.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Irbesartan attenuates production of high-mobility group box 1 in response to lipopolysaccharide via downregulation of interferon-β production Yoshiro Kato a,⁎, Hideki Kamiya a, Naoki Koide b, Erdenezaya Odkhuu b, Takayuki Komatsu b, Atsuko Watarai a, Masaki Kondo a, Koichi Kato c, Jiro Nakamura a, Takashi Yokochi b a b c
Division of Diabetes, Department of Internal Medicine, Aichi Medical University School of Medicine, Nagakute Aichi 480-1195, Japan Department of Microbiology and Immunology, Aichi Medical University School of Medicine, Nagakute, Aichi 480-1195, Japan Laboratory of Medicine, Aichi Gakuin University School of Pharmacy, Nagoya 464-0037, Japan
a r t i c l e
i n f o
Article history: Received 7 October 2014 Received in revised form 10 March 2015 Accepted 11 March 2015 Available online 24 March 2015 Keywords: High-mobility group box 1 Interferon-β Irbesartan Lipopolysaccharide Nitric oxide
a b s t r a c t High-mobility group box 1 (HMGB1) is suggested to participate in development of local and systemic inflammatory disorders. Irbesartan (IRB), an angiotensin II type1 receptor blocker, is widely used for treatment of hypertension, especially in patients with diabetic nephropathy. The effect of IRB on lipopolysaccharide (LPS)-induced HMGB1 and nitric oxide (NO) production was examined using RAW 264.7 macrophage-like cells. IRB inhibited LPS-induced HMGB1 production. IRB also reduced LPS-induced expression of an inducible NO synthase, and inhibited LPS-induced NO production. The expression levels of IFN-β protein and mRNA, which is a key molecule in MyD88-independent pathway of LPS signaling, were exclusively inhibited by IRB. Peroxisome proliferatoractivated receptor-γ and angiotensin II type 1 receptor were not involved in the inhibitory action of IRB on LPS-induced HMGB1 and NO production. Collectively, IRB was suggested to inhibit LPS-induced HMGB1 production via downregulation of IFN-β production in the MyD88-independent pathway. © 2015 Elsevier B.V. All rights reserved.
1. Introduction High-mobility group box 1 (HMGB1) is a nuclear DNA-binding protein involved in maintenance of nucleosome structure and regulation of gene transcription [1]. HMGB1 can be released into the extracellular space from immune and non-immune cells in response to various stimuli and acts as a pro-inflammatory late mediator through the receptor for advanced glycation endproducts, and toll-like receptor (TLR) 2/4 [2]. HMGB1 is suggested to play an important role in local and systemic inflammatory disorders, such as sepsis, lung injury, intestinal barrier dysfunction, arthritis, endotoxemia and death [3]. Administration of HMGB1 antagonist is reported to reduce lethality of established sepsis in mice even when administration of HMGB1 antagonist is delayed 2 h after lipopolysaccharide (LPS) stimulation [3,4]. Therefore, HMGB1 is considered as a potential therapeutic target for local and systemic inflammatory disorders. Irbesartan (IRB), an angiotensin II type1 receptor (AR) blocker, is widely used for treatment of hypertension, especially in patients with
⁎ Corresponding author at: Division of Diabetes, Department of Internal Medicine, Aichi Medical University School of Medicine, 1-1 Yazakokarimata, Nagakute, Aichi 480-1195, Japan. Tel.: +81 561 63 1683; fax: +81 561 63 1276. E-mail address: [email protected] (Y. Kato).
http://dx.doi.org/10.1016/j.intimp.2015.03.015 1567-5769/© 2015 Elsevier B.V. All rights reserved.
diabetic nephropathy. Interestingly, the number of HMGB1-producing macrophages is reported to significantly increase in atherosclerotic lesions [5]. The serum HMGB1 concentrations are significantly increased in type 1 and type 2 diabetic patients [6,7]. Therefore, it is of interest to elucidate the effect of IRB on the production of HMGB1 as a pro-inflammatory late mediator. In the present study, we investigated the effect of IRB on the production of HMGB1 in RAW 264.7 macrophage cells in response to LPS. Here, we report that IRB inhibits LPS-induced HMGB1 production via downregulation of interferon (IFN)-β production. 2. Materials and methods 2.1. Materials IRB and losartan (LOS) were obtained from Shionogi & Co., Ltd., (Osaka, Japan) and LKT Laboratories, Inc. (St. Paul, MN, USA), respectively. LPS from Escherichia coli O55:B5, poly I:C, and 2-chloro-5nitrobenzanilide (GW9662) were purchased from Sigma Chemicals Co. (St. Louis, MO, USA). An antibody to p65 NF-κB or the phosphorylated form (Ser276) was purchased from Cell signaling Technology (Beverly, MA, USA). IRB was dissolved at a concentration of 20 mM in dimethyl sulfoxide (DMSO) and the negative control medium contained 0.25% DMSO in any experiment unless otherwise stated. LPS and LOS was dissolved in phosphate buffered saline (PBS).
98
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
2.2. Cell culture The murine macrophage cell line, RAW 264.7 cells, was obtained from Riken Cell Bank (Tsukuba, Japan). Peritoneal cells were obtained by washing out the peritoneal cavities of C57BL/6 mice with RPMI 1640 medium. Peritoneal cells were cultured in RPMI 1640 medium containing 5% heat-inactivated fetal calf serum (Gibco-BRL, Gaitherburg, MD, USA) in the 96-well plate (BD Biosciences, San Jose, CA, USA) for 1 h and adherent cells were used as macrophages. RAW 264.7 cells were also maintained in RPMI 1640 medium containing 5% heat-inactivated fetal calf serum and antibiotics at 37 °C under 5% CO2 at a cell density of 5 × 104 cells/ml in a petri dish (Nissui Pharmaceutical Co., Tokyo, Japan). All animal experiments were approved by the Animal Care Committee of Aichi Medical University and carried out under the guide for care and use of laboratory animals. 2.3. Determination of nitrite concentration Nitrite, the end product of nitric oxide (NO) metabolism, was measured by using Griess reagent [8]. RAW 264.7 cells (2 × 104 cells/ 100 μl/well in a 96-well plate) were cultured in the presence or absence of IRB (0.1 μM to 50 μM) for 1 h and then stimulated with LPS (100 ng/ml) for 24 h.
was reverse-transcribed using a RT system with random hexamers (Toyobo, Tokyo, Japan). After cDNA synthesis, quantitative real-time PCR was performed using StepOne real-time PCR (Applied Biosystems, Foster City, CA, USA). The reaction mixture consists of SYBR Green PCR Matrix mix (Toyobo) and sequence-specific primers: β-actin sense, 5′-ATGACCCAGATCATGTTTGA-3′, antisense, 5′-TACGACCAGAGGCATA CAG-3′; an inducible NO synthase sense, GTCTTGCAAGCTGATGGTCA, antisense, ACCACTCGTACTTGGGATGC, interferon (IFN)-β sense, 5′-AAACAATTTCTCCAGCACTG-3′, antisense, 5′-ATTCTGAGGCATCAAC TGAC-3′. The expression levels of iNOS and IFN-β mRNA were normalized to β-actin using the ΔΔCt method. Parallelism of standard curves of the test and control was confirmed. 2.8. Statistical analysis Data were expressed as mean ± S.D. of values from at least three independent experiments and statistical significance was evaluated using the unpaired t-test. A value of p b 0.05 was considered statistically significant. 3. Results 3.1. The inhibitory effect of IRB on LPS-induced HMGB1 production in RAW 264.7 cells
2.4. Determination of HMGB1 and IFN-β levels RAW 264.7 cells (2 × 104 cells/100 μl/well in a 96-well plate) were pretreated with or without IRB (0.1 μM to 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 48 h (HMGB1 determination) or 3 h (IFN-β determination), respectively. The concentrations of HMGB1 and IFN-β in the culture supernatant were determined by an enzyme-linked immunosorbent assay kit from (Shino-Test Corporation, Tokyo, Japan) and PBL Biomedical Laboratories (Piscataway, NJ), respectively.
First, the effect of IRB at various concentrations on LPS-induced HMGB1 production was examined (Fig. 1A). RAW 264.7 cells were
2.5. Cell viability Cell viability was determined by the method to measure reduction of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) (Chemicon, Temecula, CA, USA) [9]. 2.6. Immunoblotting RAW 264.7 cells were pretreated with IRB (0, 25 or 50 μM) for 1 h and stimulated with or without LPS (100 ng/ml) for 30 min. Cells were lysed in a lysis buffer (50 mM Tris–HCl at pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10 mM sodium fluoride, 1 mM sodium orthovanadate) containing a protease inhibitor cocktail (Sigma, St Louis, MO, USA). Proteins (20 μg) in cell lysates were separated by sodium dodecyl sulfate-polyacrylamide (8 to 15%) gel electrophoresis and then electroblotted onto membranes (Durapore, Merck Millipore, Billerica, MA, USA) [10,11]. The membrane was placed in PBS containing 5% skim milk and 0.05% Tween 20 for 1 h, followed by incubation for 16 h in the presence of the first antibody to p65 NF-κB or the phosphorylated form (Ser276) at 1:2000 at 4 °C. The membrane was then incubated for 1 h with horseradish peroxidase-conjugated anti-rabbit IgG antibody as a second antibody at 1:2000 (Pierce, Rockford, IL, USA). Finally, immunoreactive protein bands were visualized by using a chemiluminescence reagent, supersignal west dura (Pierce, Rockford, IL, USA) and an AE6955 light capture system with a CS analyzer (Atto, Tokyo, Japan). 2.7. Quantitative real-time reverse transcription (RT)-polymerase chain reaction (PCR) Total RNA was extracted from RAW 264.7 cells using the TriPure Isolation reagent (Roche diagnostic, Grand Island, NY, USA). Total RNA
Fig. 1. Effect of IRB on LPS-induced HMGB1 production. A, RAW 264.7 cells were pretreated with various concentrations of IRB for1 h and stimulated with LPS (100 ng/ml) for 48 h. *p b 0.05 and **p b 0.005 vs LPS alone. B, Cells were treated with IRB at 50 μM 1 h before LPS stimulation (−1), at the same time (0), or 2 h after LPS stimulation (2). N.S., not significant. Data were obtained from 3 independent experiments.
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
treated with various concentrations of IRB for 1 h before LPS stimulation. IRB at the concentrations ranging from 0.1 to 50 μM significantly inhibited LPS-induced HMGB1 production. The degree of inhibition was dose-dependent on the concentrations of IRB. Second, the cells were treated with IRB simultaneously with LPS or post-treated with IRB 2 h after LPS stimulation. There was no significant difference in the inhibitory effect of IRB among pretreatment, simultaneous treatment and post-treatment (Fig. 1B). 3.2. The inhibitory effect of IRB on production of NO in response to LPS LPS induces the release of HMGB1 via the MyD88-independent signal pathway and it also triggers the production of NO via the same signal pathway [12]. Therefore, the effect of IRB on LPS-induced NO production was examined in RAW 264.7 cells. The cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. IRB at the concentrations ranging from 1 to 50 μM inhibited LPS-induced NO production and the degree of
99
inhibition was dose-dependent on the concentrations of IRB (Fig. 2A). The effect of IRB on the expression of iNOS mRNA was also examined. Quantitative real-time RT-PCR analysis demonstrated that IRB at 50 μM significantly inhibited LPS-induced iNOS mRNA expression (Fig. 2B), suggesting that IRB inhibits the iNOS expression at the transcriptional level. Further, the effect of IRB on LPS-induced NO production was examined by using murine peritoneal macrophages. IRB at 50 μM inhibited LPS-induced NO production in murine peritoneal macrophages as well as RAW 264.7 cells (Fig. 2C). To exclude a possibility that the inhibition of LPS-induced HMGB1 and NO production is due to a cytotoxic action of IRB, the effect of IRB on the MTT activity of RAW 264.7 cells in the presence or absence of LPS was examined. IRB at 25 or 50 μM did not reduce the viability of RAW 264.7 cells even in the presence of LPS (100 ng/ml), indicating that the inhibition of LPS-induced HMGB1 and NO production by IBR was not due to cell death. 3.3. The effect of IRB on phosphorylation of p65 NF-κB in response to LPS LPS triggers both the MyD88-dependent and independent pathways and LPS-induced NO production is mediated by the MyD88-dependent pathway, especially NF-κB and also by the MyD88-independent pathway [13]. The effect of IRB on LPS-induced NF-κB activation in the MyD88-dependent pathway was examined. RAW 264.7 cells were pretreated with IRB (25 or 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 30 min. The phosphorylation of p65 NF-κB was determined by immunoblotting using an antibody to p65 NF-κB or its phosphorylated form. LPS clearly induced phosphorylation of p65 NF-κB and IRB at 25 or 50 μM did not affect LPS-induced p65 NF-κB phosphorylation (Fig. 3), suggesting that IRB does not affect LPS-induced NF-κB activation. 3.4. The inhibitory effect of IRB on production of NO in response to poly I:C Poly I:C exclusively activates the MyD88-independent pathway via TLR3 [14,15] and leads to the NO production. The experiment was performed using poly I:C in place of LPS to confirm a possibility that IRB might inhibit LPS-induced NO and HMGB1 production via inactivation of the MyD88-independent pathway of LPS signaling. IRB at the concentrations ranging from 0.1 to 50 μM inhibited poly I:C-induced NO production (Fig. 4). The inhibition of IRB at 50 μM was stronger than that of IRB at 0.1 μM. IRB was suggested to inhibit LPS-induced HMGB1 and NO production through impairing the MyD88-independent pathway of LPS signaling. 3.5. The inhibitory effect of IRB on the expression of IFN-β protein and mRNA in MyD88-independent pathway In the MyD88-independent pathway LPS induces the production of IFN-β via activation of TRIF and interferon regulatory factor (IRF) 3, and IFN-β leads to the NO production [14]. To characterize the inhibitory mechanism of IRB on the MyD88-independent pathway, the effect of IRB
Fig. 2. Effect of IRB on LPS-induced NO production. A, RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. *p b 0.01 vs LPS alone. B, RAW 264.7 cells were pretreated with or without 50 μM IRB for 1 h and stimulated with LPS (100 ng/ml) for 3 h. The iNOS mRNA expression was analyzed with quantitative real-time RT-PCR. The expression of β-actin mRNA was used as internal control. *p b 0.01 vs LPS alone. C, Murine peritoneal macrophages were pretreated with or without 50 μM IRB for 1 h and stimulated with LPS (100 ng/ml) for 24 h. *p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
Fig. 3. Effect of IRB on LPS-induced NF-κB activation. RAW 264.7 cells were pretreated with IRB (25 or 50 μM) for 1 h and stimulated with LPS (100 ng/ml) for 30 min. Expression of p65 NF-κB and the phosphorylated form was analyzed by immunoblotting. A typical result in three independent experiments is shown.
100
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
3.6. Independence of the inhibitory effect of IRB on LPS-induced HBGB1 and NO production from peroxisome proliferator-activated receptor (PPAR)-γ and AR
Fig. 4. Effect of IRB on poly I:C-induced NO production. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with poly I:C (50 μg/ml) for 24 h. *p b 0.01 vs poly I:C alone. Data were obtained from 3 independent experiments.
on the expression of IFN-β protein and mRNA was examined. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml). The expression of IFN-β protein (A) and mRNA (B) were determined 3 h and 1 h after LPS treatment, respectively. IRB at the concentrations ranging from 1 to 50 μM inhibited the production of IFN-β protein (Fig. 5A) and the expression of IFN-β mRNA (Fig. 5B), suggesting that the inhibitory effect of IRB on LPSinduced HMGB1 and NO production might be mediated by downregulation of the IFN-β production in the MyD88-independent pathway.
Fig. 5. Effect of IRB on LPS-induced IFN-β protein and mRNA expression. RAW 264.7 cells were pretreated with various concentrations of IRB for 1 h and stimulated with LPS (100 ng/ml). The expression of IFN-β protein (A) and mRNA (B) were determined 3 h and 1 h after LPS treatment, respectively. *p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
IRB is known to have an agonistic effect on PPAR-γ [16]. To examine involvement of PPAR-γ in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production, the effect of GW9662, a PPAR-γ antagonist [17], on IRB-induced HMGB1 and NO inhibition was examined. RAW 264.7 cells were pretreated with GW9662 as a PPAR-γ selective antagonist for 30 min, treated with IRB for 1 h, and then stimulated with LPS. GW9662 did not affect the inhibitory effect of IRB on LPS-induced HMGB1 (Fig. 6A) or NO production (Fig. 6B), suggesting that IRB inhibited LPS-induced HMGB1 and NO production independently of PPAR-γ. To examine involvement of AR in the inhibitory effect of IRB on LPS-induced production of HMGB1 and NO, the effect of losartan (LOS), another AR blocker, on LPS-induced HMGB1 and NO production was examined. IRB at 50 μM inhibited LPS-induced HMGB1 and NO production whereas LOS at 50 μM did not inhibit them (Fig. 7A, B), suggesting that the inhibitory effect of IRB was exhibited independently of AR as well as PPAR-γ. 4. Discussion The present study has demonstrated that IRB inhibits LPS-induced HMGB1 and NO production via reduced production of IFN-β in MyD88-independent pathway in RAW 264.7 macrophage-like cells. The evidences supporting this conclusion are as follows; IRB did not inhibit LPS-induced NF-κB activation that is mainly dependent on
Fig. 6. No involvement of PPAR-γ in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production. RAW 264.7 cells were pretreated with GW9662 (10 μM) as a PPAR-γ antagonist for 30 min, treated with IRB (25 or 50 μM) for 1 h, and then stimulated with LPS (100 ng/ml). HMGB1 (A) and NO (B) were determined 48 or 24 h after LPS treatment, respectively. NS, not significant. Data were obtained from 3 independent experiments.
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
101
Fig. 8. A schematic diagram explaining the mechanism underlying the inhibition of LPS-induced production of HMGB1 by IRB. Fig. 7. No involvement of AR in the inhibitory effect of IRB on LPS-induced HMGB1 and NO production. RAW 264.7 cells were pretreated with LOS (50 μM) as an AR blocker or IRB (50 μM) for 1 h and then stimulated with LPS (100 ng/ml). HMGB1 (A) and NO (B) were determined 48 or 24 h after LPS treatment, respectively.* p b 0.01 vs LPS alone. Data were obtained from 3 independent experiments.
MyD88-dependent pathway, IRB inhibited poly I:C-induced NO production that is mediated only by MyD88-independent pathway via TLR3, and IRB downregulated the expression of IFN-β protein and mRNA as an critical factor in MyD88-independent pathway of LPS signaling. A schematic diagram explaining the mechanism underlying the inhibition of LPS-induced production of HMGB1 by IRB is shown in Fig. 8. We for the first time demonstrate that IRB inhibits the production of HMGB1 or NO in response to LPS as TLR ligands, such as LPS and poly I:C. Therefore, IRB is suggested to inhibit inflammatory responses caused by innate immunity using TLRs. Several reports indicate that HMGB1 is a pro-inflammatory cytokine which may contribute to the pathogenesis of micro- and macrovascular complications in diabetes [18–23]. Circulating HMGB1 is positively associated with body mass index, while adipose HMGB1 mRNA levels correlate with the expression of inflammatory markers [24]. Insulin resistance modifies the intracellular distribution of HMGB1 in human adipocytes, with HMGB1 being predominantly nuclear in lean and obese normoglycemic individuals while localized to the cytosol in obese type 2 diabetic patients, and HMGB1 acts as a stimulatory factor of insulin secretion of β-cells [24]. HMGB1 is suggested to act as an adipokine contributing to low-grade inflammation in fat tissue [25]. Hyperglycemia induces the expression and production of HMGB1 in human aortic endothelial cells [26]. These findings suggest that HMGB1 plays an important role in the development of diabetic complications through inflammatory processes. However, the therapeutic effect of IRB on diabetic complications is a matter of speculation.
The inhibitory effect of IRB is not responsible for an agonist of PPARγ and AR. In this study LOS does not inhibit LPS-induced HMGB1 production in RAW 264.7 cells. On the other hand, Hagiwara et al. have reported that LOS attenuates LPS-induced HMGB1 production in RAW 264.7 cells via inhibition of NF-κB pathway [27]. The reason for the difference between the two reports is unknown. In addition, resveratrol inhibits LPS-induced expression of HMGB1 and TLR 4 in RAW 264.7 cells [28]. Shikonin as a naphthoquinone, which is from the root of medical herb, reduces LPS-induced HMGB1 production via IFN and NF-κB in RAW 264.7 cells [29]. The precise mechanism for inhibition of LPS-induced production of IFN-β by IRB is unclear. Based on the reduced IFN-β mRNA expression, the IFN-β production must be inhibited at a transcriptional level. It was technically difficult to examine the effect of IRB on the IRF 3 expression in response to LPS or poly I:C. Further, the inhibitory effect of IRB is not responsible for an agonist of PPAR-γ and AR. HMGB1 plays an important role in endotoxic shock or septic shock at a late stage pro-inflammatory mediator and NO also functions as a proinflammatory mediator for LPS-induced cell death and tissue injury. IRB inhibits the production of NO as well as HMGB1 in response to LPS. The inhibition of both NO and HMGB1 production by IRB is reasonable since IRB inhibits the production of IFN-β as an important molecule in the MyD88-independent pathway of LPS signaling. Moreover, LPS-induced HMGB1 production is reported to depend on the NO production [12], suggesting that IRB-induced IFN-β inhibition causes the downregulation of HMGB1 via reduced NO production. Thus, we demonstrate that IRB inhibits the production of late pro-inflammatory mediators in response to LPS. Although IRB is reported to exhibit an antiinflammatory action [30,31], there is no report on the effectiveness of IRB on LPS-mediated inflammatory responses. It is of interest to clarify the therapeutic effectiveness of IRB against LPS-related inflammatory disorders.
102
Y. Kato et al. / International Immunopharmacology 26 (2015) 97–102
Conflict of interest The authors have no conflict of interest to report in relation to this manuscript. References [1] M.E. Bianchi, M. Beltrame, Flexing DNA: HMG-box proteins and their partners, Am. J. Hum. Genet. 63 (1998) 1573–1577. [2] H. Yang, H. Wang, C.J. Czura, et al., The cytokine activity of HMGB1, J. Leukoc. Biol. 78 (2005) 1–8. [3] H. Wang, O. Bloom, M. Zhang, et al., HMG-1 as a late mediator of endotoxin lethality in mice, Science 285 (1999) 248–251. [4] H. Yang, M. Ochani, J. Li, et al., Reversing established sepsis with antagonists of endogenous high-mobility group box 1, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 296–301. [5] N. Kalinina, A. Agrotis, Y. Antropova, et al., Increased expression of the DNA-binding cytokine HMGB1 in human atherosclerotic lesions: role of activated macrophages and cytokines, Arterioscler. Thromb. Vasc. Biol. 24 (2004) 2320–2325. [6] S. Devaraj, M.R. Dasu, S.H. Park, et al., Increased levels of ligands of Toll-like receptors 2 and 4 in type 1 diabetes, Diabetologia 52 (2009) 1665–1668. [7] M.R. Dasu, S. Devaraj, S. Park, et al., Increased toll-like receptor (TLR) activation and TLR ligands in recently diagnosed type 2 diabetic subjects, Diabetes Care 33 (2010) 861–868. [8] L.C. Green, D.A. Wagner, J. Glogowski, et al., Analysis of nitrate, nitrite, and [15 N]nitrate in biological fluids, Anal. Biochem. 126 (1982) 131–138. [9] M. Hanelt, M. Gareis, B. Kollarczik, Cytotoxicity of mycotoxins evaluated by the MTT-cell culture assay, Mycopathologia 128 (1994) 167–174. [10] W.N. Burnette, “Western blotting”: electrophoretic transfer of proteins from sodium dodecyl sulfate–polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A, Anal. Biochem. 112 (1981) 195–203. [11] G. Tumurkhuu, N. Koide, J. Dagvadorj, et al., The inhibition of lipopolysaccharideinduced tumor necrosis factor-alpha and nitric oxide production by Clostridium perfringens alpha-toxin and its relation to alpha-toxin-induced intracellular ceramide generation, Int. J. Med. Microbiol. 299 (2009) 554–562. [12] J.H. Kim, S.J. Kim, I.S. Lee, et al., Bacterial endotoxin induces the release of high mobility group box 1 via the IFN-beta signaling pathway, J. Immunol. 182 (2009) 2458–2466. [13] S. Akira, Toll-like receptor signaling, J. Biol. Chem. 278 (2003) 38105–38108. [14] S. Akira, K. Takeda, Toll-like receptor signalling, Nat. Rev. Immunol. 4 (2004) 499–511. [15] J. Pindado, J. Balsinde, M.A. Balboa, TLR3-dependent induction of nitric oxide synthase in RAW 264.7 macrophage-like cells via a cytosolic phospholipase A2/cyclooxygenase-2 pathway, J. Immunol. 179 (2007) 4821–4828. [16] M. Schupp, J. Janke, R. Clasen, et al., Angiotensin type 1 receptor blockers induce peroxisome proliferator-activated receptor-gamma activity, Circulation 109 (2004) 2054–2057.
[17] R. Clasen, M. Schupp, A. Foryst-Ludwig, et al., PPARgamma-activating angiotensin type-1 receptor blockers induce adiponectin, Hypertension 46 (2005) 137–143. [18] X.X. Yan, L. Lu, W.H. Peng, et al., Increased serum HMGB1 level is associated with coronary artery disease in nondiabetic and type 2 diabetic patients, Atherosclerosis 205 (2009) 544–548. [19] J. Kim, E. Sohn, C.S. Kim, et al., The role of high-mobility group box-1 protein in the development of diabetic nephropathy, Am. J. Nephrol. 33 (2011) 524–529. [20] G. Mohammad, M.M. Siddiquei, A. Othman, et al., High-mobility group box-1 protein activates inflammatory signaling pathway components and disrupts retinal vascular-barrier in the diabetic retina, Exp. Eye Res. 107 (2013) 101–109. [21] J.W. Nin, I. Ferreira, C.G. Schalkwijk, et al., Higher plasma high-mobility group box 1 levels are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes: a 12 year follow-up study, Diabetologia 55 (2012) 2489–2493. [22] X.L. Chen, X.D. Zhang, Y.Y. Li, et al., Involvement of HMGB1 mediated signalling pathway in diabetic retinopathy: evidence from type 2 diabetic rats and ARPE-19 cells under diabetic condition, Br. J. Ophthalmol. 97 (2013) 1598–1603. [23] A.M. Abu El-Asrar, M.M. Siddiquei, M.I. Nawaz, et al., The proinflammatory cytokine high-mobility group box-1 mediates retinal neuropathy induced by diabetes, Mediat. Inflamm. 2014 (2014) 746415. [24] R. Guzman-Ruiz, F. Ortega, A. Rodriguez, et al., Alarmin high-mobility group B1 (HMGB1) is regulated in human adipocytes in insulin resistance and influences insulin secretion in beta-cells, Int. J. Obes. 38 (2014) 1545–1554. [25] B. Nativel, M. Marimoutou, V.G. Thon-Hon, et al., Soluble HMGB1 is a novel adipokine stimulating IL-6 secretion through RAGE receptor in SW872 preadipocyte cell line: contribution to chronic inflammation in fat tissue, PLoS One 8 (2013) e76039. [26] D. Yao, M. Brownlee, Hyperglycemia-induced reactive oxygen species increase expression of the receptor for advanced glycation end products (RAGE) and RAGE ligands, Diabetes 59 (2010) 249–255. [27] S. Hagiwara, H. Iwasaka, S. Hidaka, et al., Antagonist of the type-1 ANG II receptor prevents against LPS-induced septic shock in rats, Intensive Care Med. 35 (2009) 1471–1478. [28] Y. Yang, S. Li, Q. Yang, et al., Resveratrol reduces the proinflammatory effects and lipopolysaccharide-induced expression of HMGB1 and TLR4 in RAW264.7 cells, Cell. Physiol. Biochem. 33 (2014) 1283–1292. [29] Y. Yang, J. Wang, Q. Yang, et al., Shikonin inhibits the lipopolysaccharide-induced release of HMGB1 in RAW264.7 cells via IFN and NF-kappaB signaling pathways, Int. Immunopharmacol. 19 (2014) 81–87. [30] F. Persson, P. Rossing, P. Hovind, et al., Irbesartan treatment reduces biomarkers of inflammatory activity in patients with type 2 diabetes and microalbuminuria: an IRMA 2 substudy, Diabetes 55 (2006) 3550–3555. [31] S. Tsuruoka, H. Kai, J. Usui, et al., Effects of irbesartan on inflammatory cytokine concentrations in patients with chronic glomerulonephritis, Intern. Med. 52 (2013) 303–308.