- Email: [email protected]
Iron, ferritin and proteins of the methionine-centered redox cycle in young and old rat hearts
Mechanisms of Ageing and Development 130 (2009) 139–144
Contents lists available at ScienceDirect
Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev
Iron, ferritin and proteins of the methionine-centered redox cycle in young and old rat hearts Baruch Bulvik a, Leonid Grinberg a, Ron Eliashar b, Eddy Berenshtein a, Mordechai (Mottie) Chevion a,* a b
Department of Cellular Biochemistry and Human Genetics, The Hebrew University of Jerusalem, Faculties of Medicine and Dental Medicine, 91120 Jerusalem, Israel Department of Otolaryngology/Head & Neck Surgery, The Hadassah-Hebrew University Hospital, Jerusalem, Israel
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 June 2008 Received in revised form 28 September 2008 Accepted 7 October 2008 Available online 17 October 2008
Progressive oxidation of cellular components constitutes a major mechanism of the aging process. An emerging paradigm of redox signaling suggests that low level oxidants activate protective pathways resulting in prolonged cell survival. This report centers on the study of cardiac muscle in young and old rats, including (i) the expression of ferritin (Ft) the major iron storage protein, and (ii) the expression of the major proteins of the methionine-centered redox cycle (MCRC), which controls the cellular methionine redox status. Total amounts of Ft (protein) and its mRNA encoding for Ft L-subunit (Ft-L) were higher in the aged hearts, indicating that the iron-binding capacity of myocardial Ft increased with age. Among the proteins of the MCRC, methionine sulfoxide reductases A and B (MsrA, MsrB) and MsrA mRNA were significantly higher in hearts of old rats with a significant decrease in MsrA activity. The observed up-regulation of the expression of Msr and Ft-L could represent a protective response to the increased oxidative stress in the aging myocardium. ß 2008 Elsevier Ireland Ltd. All rights reserved.
Keywords: Aging Ferritin subunits Methionine sulfoxide reductase Thioredoxin Thioredoxin reductase
1. Introduction Among commonly discussed theories of aging, the ‘‘free radical mechanism’’ has earned noticeable attention (Friguet, 2006; Harman, 1956; Squier, 2001). Oxidative stress has traditionally been viewed as an imbalance between generation and neutralization of reactive oxygen-derived species (ROS) in the cell. These include, among others, the superoxide radical anion, hydrogen peroxide and hydroxyl radical. The latter is produced in the presence of redox active iron and copper which markedly aggravate the ROS-induced cell damage (Huang et al., 2004). It has been surmised that oxidation of cellular components and accumulation of oxidized products closely correlate with the process of biological aging (Kregel and Zhang, 2007; Petropoulos and Friguet, 2006). However, despite a large body of supporting evidence, a causal link between ROS and aging has still not been clearly established.
* Corresponding author at: Ganz Chair of Heart Studies, The Hebrew University of Jerusalem, P.O. Box 12272, Jerusalem IL-91120, Israel. Tel.: +972 2 675 8160; fax: +972 2 641 5848. E-mail address: [email protected] (M.(. Chevion). Abbreviations: Ft, ferritin; Ft-H and Ft-L, the H- and L- subunits of ferritin; MCRC, methionine-centered redox-cycle; Met, methionine; MetO, methionine sulfoxide; MetO2, methionine sulfone; Msr, methionine sulfoxide reductase; ROS, reactive oxygen-derived species; Trx, thioredoxin 1; TrxR, thioredoxin reductase 1. 0047-6374/$ – see front matter ß 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mad.2008.10.002
A recent new paradigm of oxidative redox signaling suggests that ROS can function as intracellular signaling molecules. Redoxsensing proteins and redox-based modulation of gene expression have emerged as governors of fundamental regulatory mechanisms in the cell (Sen and Packer, 2000; Tappia et al., 2006). Attempting to translate these views into the terms of aging, it can be hypothesized that oxidative stress plays a dual role: (i) it can cause age-related accumulation of oxidized products which are deleterious to the cell, but (ii) it can also facilitate the development of mechanisms able to protect against age-associated oxidative damage. In a normal well protected cell, 95–98% of its iron is bound to ferritin (Ft), the major iron storage and detoxifying protein, that keeps labile and redox active iron at submicromolar levels (Liu and Theil, 2005). Exceeding these levels initiates translation of new Ft subunits so that the excess iron is scavenged and neutralized. This process is regulated via the iron regulatory proteins (IRPs) in association with the iron responsive elements (IREs) on the mRNA. Therefore, an increase in Ft (protein and/or mRNA) indicates recent cellular events whereby the level of labile iron has increased (Hintze and Theil, 2006; Levenson and Tassabehji, 2004). The methionine-centered redox cycle (MCRC) has been implicated in regulating the thiol status and the dithiol-disulfide transition of cellular proteins (Fig. 1). Mild oxidation of methionine (Met) to methionine-sulfoxide (MetO) can be enzymatically reversed by methionine sulfoxide reductase (Msr), which prevents
140
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
Fig. 1. The methionine-centered redox cycle. Oxidation of free methionine or methionyl residue of a protein results in the formation of methionine(yl) sulfoxide (MetO). Further oxidation of MetO will generate methionine(yl) sulfone (MetO2); the process is almost not reversible in biological systems. The formation of MetO2 will eventually cause protein denaturation. In contrast, MetO is normally reduced by methionine sulfoxide reductase (MsrA or MsrB isoform), which, in turn, receives electrons from thioredoxin (Trx). The oxidized thioredoxin (Trxox) is reduced by thioredoxin reductase (TrxR) which is integrated into the entire cell redox system via NADP/NADP(H). The MCRC shares both antioxidant and regulatory functions with major cellular thiols.
the formation of the irreversibly oxidized product – methionine sulfone (MetO2), and presumably, denaturation of Met-containing proteins (Moskovitz, 2005; Stadtman et al., 2003). The Msr family compose of MsrA and MsrB diversed in their stereo-specific reducing activity towards oxidized substrates: MsrA for S-MetO and MsrB for R-MetO. MsrB is the predominany isomer in the heart (Hansel et al., 2005) .It is considered that cyclic inter-conversion of Met and MetO residues of proteins leads to the removal of multiple forms of ROS and may also play an important role in enzyme regulation and signal transduction. Loss of Msr activity caused in aging mice shortening in life span (Stadtman et al., 2003). Another component of the MCRC is thioredoxin (Trx), which supports the reduction of Msr to its Met – (reduced) form, by supplying two electrons, via the oxidation of its di-thiol to disulfide groups. Trx undergoes cyclic redox reactions is being oxidized by the Msr protein and then reduced by Trx-reductase (TrxR), using the reducing equivalents of NADPH (Fig. 1). It has been proposed that an age-related decrease in TrxR level in skeletal muscle and heart enhances tissue susceptibility to apoptotic stimuli (Rohrbach et al., 2006). Under certain conditions, the Trx system could serve a marker of cell proliferation and senescence (Yoshida et al., 2003). Based on a plethora of clinical observations, it has been surmised that the aging heart develops specific mechanisms of cardioprotection (Juhaszova et al., 2005). Moreover, old patients with pre-infarct angina, reportedly, suffer a lower rate of death, heart failure, shock and re-infarction as compared with old patients without angina (Kloner et al., 1998). These observations suggest that heart ischemia, manifested as angina, may precondition the heart and increase its resistance toward an acute ischemic insult. In the present study, we tested whether iron-responding cell components and ROS-responding cell components (i.e. Ft and MCRC proteins, respectively) are involved in age-related alterations of the rat myocardium. Here we report on elevated levels of Ft and Msr (both A and B isomers) in cardiac tissues of old rats, which may represent an adaptive response of the heart to ischemic risks upon aging. 2. Materials and methods 2.1. Materials All chemicals were of the highest purity available (sources indicated in the Supplementary materials). 2.2. Animals The study was approved by the Institutional Animal Ethics and Welfare Committee of the Hebrew University – Hadassah Medical School. Wistar female rats
were purchased from Harlan Laboratories, Jerusalem, Israel and kept under specific pathogen-free conditions at room temperature. The diurnal cycle consisted of 12 h of light and 12 h of dark; the animals were fed standard rat chow and water ad libitum for 9 weeks (young) and 24–25 months (old). On the day of the experiment, anesthesia was induced by injecting Xylazine (15 mg/kg, i.p.) and Ketamin (100 mg/ kg, i.p.). The heart was rapidly excised, placed in liquid nitrogen and kept until analyzed. Tissue homogenates were prepared using a Cole Parmer Teflon homogenizer. About 100 mg wet tissue was homogenized in 1.6 ml of a special lysis buffer containing Tris–HCl (50 mM), cysteine (1 mM), sodium citrate (1 mM) and MnCl2 (0.5 mM), phenyl–methyl–sulfonyl–fluoride (PMSF) (0.25 mM), digitonin (0.02%), at pH 7.6. Protein concentrations in the lysate were determined using the BCA (BiCinchonic Acid) kit according to manufacturer’s (Pierce, USA) instructions. 2.3. Ft and iron Ft concentration was quantified using an indirect ELISA assay according to a procedure earlier developed in this laboratory (Berenshtein et al., 2002). All antibodies were provided by Dr. A. M. Konijn (Department of Human Nutrition and Metabolism, Hebrew University, Jerusalem, Israel). Ft-bound iron was determined in the immuno-precipitate which had been formed by the reaction between heart Ft (in the homogenate and a specific anti-ratheart-Ft antibody. Aliquots of the heart homogenate (sample) and anti-Ft antibody diluted in the lysis buffer were mixed and incubated at 4 8C for 72 h. The samples were then centrifuged at 20,000 g for 20 min, the supernatant was discarded and the pellet dissolved in concentrated HNO3. Total amount of iron was measured using the BPS (bathophenantrolin di-sulfonic acid) reagent (Nilsson et al., 2002). From this analysis and the measured concentration of Ft, the degree of Ft saturation by iron was calculated, and presented as the number of iron atoms per Ft molecule and denoted as NFe. 2.4. MCRC proteins Msr activity was determined according to a published protocol (Moskovitz et al., 1997). The method is based on the enzymatic reduction of the substrate – dabsyl methionine sulfoxide – into dabsyl methionine, which is then determined using HPLC with spectrophotometric detection at 436 nm. The method produced the total (combined) activity of the Msr iso-forms present in the heart homogenate. MsrA specific activity was determined after immunoprecipitation of MsrB with anti-MsrB antibody. MsrB specific activity was calculated by subtracting the activity of MsrA from the total Msr activity measured. TrxR activity was assayed by the reduction of the thiol specific reagent – 5,50 dithiobis(2-nitrobenzoic acid – by NADPH; the product is spectrophotometrically measured at 412 nm (Holmgren and Bjornstedt, 1995). Authentic TrxR (Sigma) was run as the standard sample; the final results were then expressed in units of TrxR activity per mg of sample protein. In one set of experiments, heart homogenates (250 mg protein) were incubated with hydrogen peroxide (1 mM) for 30 min at 37 8C. Then the enzymatic activity of TrxR1 and the amount of TrxR1 protein (as monitored by Western blotting, as described below) were determined. Quantification of Trx1, TrxR1 MsrA and MsrB were conducted using the Western blot method (Shioji et al., 2000) with some minor modifications (see Supplementary materials for details). The primary antibodies for Trx1 and TrxR1 were generously provided by Dr. S.G. Rhee (Ewha Women University, Seoul, Korea) and those for MsrA and MsrB by Dr. J. Moskovitz (School of Pharmacy, University of Kansas, MO,
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
141
Table 1 The primers’ sequences and relevant exon numbers used in the PCR assay. Gene
Accession No.
Forward Primer
Reverse Primer
Exon
H-ferritin L-ferritin MsrA MsrB Trx TrxR
NM012848 NM022500 NM053307 NM001031660 NM053800 NM031614
ACGTCTATCTGTCCATGGTCTTG CCTACCTCTCTCTGGGCTTCT ATTTGGAATGGGCTGCTTCT GTGGTCTGCAAACAGTGTGA TGGATGACTGCCAGGATGT TCCTCACAAAATTATGGCAACA
AAAGTTCTTCAGGGCCACAT CTTCTCCTCGGCCAATTC TAGGTGGGATTGCGTGTGTA CTGTTGATGCAAAACCTTTGTC GTCGGCATGCATTTGACTT GGAACCGCTCTGCTGAGTAA
1-2:2 1-2:2 2-3:3 4-5:5 3-4:4 5-6:6
The nucleotide sequences used for primer design were obtained from the public database GenBank. Primers for the indicated genes were constructed using the Primer3 software, and designed so that the forward primer in each pair was complimentary to the exon–exon boundary (e.g., 3–4) in order to avoid genomic DNA amplification. with p 0.05 were considered statistically significant. The data are presented as mean S.D. The numbers of samples are indicated in the figure legends.
Table 2 H- and L-subunits of ferritin mRNAs in hearts of old and young rats. Group
Young
Old
Ft-H Ft-L H/L ratio
0.19 0.04 0.05 0.01 4.10 0.80
0.15 0.05 0.09 0.02* 1.74 0.50**
Real Time PCR was used to quantify the expression of genes encoding for Ft H- and Ft L-subunits. The numbers represent means S.D., in arbitrary units pertaining to the respective mRNAs obtained as indicated in Section 2. In total 8 old and 7 young rat hearts were used. * p = 0.0008. ** p = 0.0001 old versus young.
USA). In total, four experiments were conducted and analyzed by Western Blot Analysis; each gel was loaded with randomly selected ‘‘young’’ and ‘‘old’’ homogenates plus a specific ‘standard’ homogenate, which was present in each gel throughout the entire series. The densitometry data was converted into the ratio of protein concentrations in the ‘‘old’’ to that in the ‘‘young’’ samples. Expression of mRNA of the MCRC proteins and H- and L-subunits of Ft was quantified using qRT-PCR methodology (Reno et al., 1997). The nucleotide sequences used for primer design were obtained from the public database GenBank (Table 1) and purchased from Syntezza, Israel. Primers for target genes were constructed using the Primer3 software (from: http://frodo.wi.mit.edu/cgi-bin/ primer3/primer3_www.cgi), and designed so that the forward primer in each pair was complimentary to the exon–exon boundary (e.g., 3–4 in Table 1) in order to avoid genomic DNA amplification. The PCR primary data were obtained in triplicates. Expression of the H- and L-Ft genes was normalized per the expression of b-actin and presented as arbitrary units according to (Reno et al., 1997) (Table 2). Changes in the expression of the MCRC protein genes upon aging were calculated by normalizing all PCR data to the mean value in the ‘‘young’’ group (Fig. 3).
3. Results 3.1. Ft and iron Old hearts had significantly higher amounts of Ft protein than the young hearts: 5.9 0.6 versus 3.0 1.2 mg Ft/mg protein, respectively (p = 0.01). To test whether the age-related accumulation of Ft was due to increased transcription of Ft chains, the expression of the genes encoding for H- and L-ferritin subunits was monitored, as shown in Table 2. While no significant changes were observed for HFt mRNA, the levels of L-Ft mRNA were almost twice higher in the old as compared with the young hearts. The result points to increased gene expression and, possibly, accelerated transcription of Ft-L subunits in the myocardium of the aged rats. In contrast to Ft (protein) and L-Ft mRNA, we found no differences in total Ft-bound iron between old and young rat hearts: 554 (old) versus 572 (young) ng iron/mg protein. Given that the amount of Ft was twice higher in the old hearts, NFe, the average number of iron atoms within each Ft molecule was 764 (in the old) and 1592 (in the young). These data point to the presence of iron-poorer Ft in the aged hearts, which could allow the heart to cope with age-related increase in oxidative stress. The ironbinding capacity of this Ft increased with age. 3.2. MCRC proteins
2.5. Statistical analysis The data were analyzed using repeated one-way ANOVA followed by the Scheffe post hoc test, for multiple comparisons (with a = 0.05). The differences of the means
Typical Western blots obtained from heart homogenates are shown in Fig. 2A.
Fig. 2. The amounts of the proteins components of the methionine-centered redox cycle. (A) Representative Western blots. Cytosolic fractions of heart homogenates of young (9 weeks) and old (24–25 months) rats were run on SDS-PAGE, transferred to nitrocellulose membranes and then exposed to specific antibodies raised against the target proteins. The membranes were then analyzed according to the Western blot methodology (see Supplementary materials). (B) Densitometric analysis of the Western blots. In total, 15 young and 17 old hearts were analyzed. The densitometric data are expressed as the ‘‘old/young’’ ratios. *p = 0.002 for old (black bars) versus young.
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
142
Table 4 Enzymatic activity and protein content of TrxR under subjected to oxidative stress. Parameters
Treatment None
H2O2
TrxR activity (mU/mg protein) TrxR protein (A.U.)
23.1 2.5 0.66 0.3
18.8 2.4* 0.70 0.25
Five young rats heart homogenates were incubated in the presence of H2O2 (0.5 mmole/mg protein) for 30 min at 37 8C. TrxR activity was assayed using the DTNB method and the TrxR protein by Western Blot analysis. See Section 2 for details. * Denotes p < 0.02. Fig. 3. Expression of genes encoding the MCRC-proteins. RNAs were extracted from heart homogenates of young (9 weeks) and old (24–25 months) rats. One microgram RNA was used in the reverse transcription reaction. Real Time-PCR was run using primers specific for the target genes. The PCR data were normalized per expression of b-actin gene and then expressed as the ‘‘old/young’’ ratios. In total, 7 young and 8 old hearts were analyzed. * p = 0.04 old (black bars) versus young.
Table 3 Enzymatic activities of Msr isozymes and TrxR.
Total Msr MsrA MsrB MsrB/MsrA TrxR
Young
Old
p-value
60.3 3.6 19.3 1.5 41.0 11.0 2.12 23.1 2.2
50.4 2.3 16.7 0.8 33.7 5.1 2.02 16.9 3.2
0.003 0.004 >0.05 0.018
Heart homogenates were incubated with Dabsyl-MetO and spectrophotometrically analyzed by HPLC for their reduction to Dabsyl-Met. The results are in pmole/mg protein/min. MsrA activity was measured after MsrB immunoprecipitation, MsrB activity was calculated from total Msr activity minus MsrA activity. TrxR activity was assayed using the DTNB method. Results are in mU/mg protein. See Section 2 for details.
While b-actin, Trx and TrxR showed no apparent differences between the old and young hearts, MsrA and MsrB did: it was significantly higher in samples of aged hearts, by 70% for MsrA and 25% for MsrB (reaching 170 and 125%, in the aged hearts). The two other proteins averaged at similar levels for both age groups. Concentrations of the major protein components of MCRC in myocardial homogenates from young and old rats are shown in Fig. 2B. In mRNAs that encode the major protein components of MCRC, a trend towards higher mRNA concentrations in the old hearts was observed, except for MsrB. For MsrA it reached statistical significance (Fig. 3). This result is in accord with the increase in MsrA protein as detected by Western blotting (Fig. 2B). The enzymatic activities of MsrA, MsrB and TrxR were tested, in heart tissues of young and old rats. The Msr total activity, the measured activity of MsrA, and the calculated MsrB activity are shown in Table 3. It clearly demonstrates that both Msr and TrxR activities were significantly reduced in hearts of old animals, when compared to the young ones. It should be noted that the enzymatic activity of myocardial Msr decreased with age, while the amount of Msr protein increased with age. Likewise, the activity of TrxR decreased with age, while the amount of TrxR protein did not change. These discrepancies between the changes in the enzymatic activities and the amounts of proteins might be due to post translational alterations in the activities of the aged hearts, which apparently did not alter the overall immuno-detectable structure of these proteins. To test whether such asymmetric changes in protein structure and function could co-exist we used a model of oxidative stress
whereby young heart homogenates were incubated with H2O2. The results are presented in Table 4. The results suggest that such an oxidative stress induced a decrease in TrxR activity, which did not necessarily involve a decrease in the amount of immuno-detectable TrxR protein. Therefore, the decrease in TrxR activity in the older hearts did not seem to affect the detectability of the bulk of the protein, by Western blot analysis, but was probably due to specific changes affecting the activity of the enzyme. 4. Discussion Oxidative stress has been implicated in the pathogenesis of agerelated diseases. Aging was shown to be associated with an increase in ROS generation and/or a decline in cellular repair (Friguet, 2006; Squier, 2001). For example, rat cardiac myocytes showed a significant age-related increase in the rate of ROS production and oxidative DNA damage, which was accompanied by a decline in the levels of ascorbic acid (Suh et al., 2001). Iron, an essential element of all dividing cells, is a major catalyst of the formation of hydroxyl radical (OH). Iron could enhance ROS-induced damage and thus shift the redox balance from that compatible with cell survival to cell death. Therefore, binding and storing of labile and redox-active iron is important for the prevention of uncontrolled cell oxidation upon aging. In the present study, the level of Ft – the major iron storage protein – was significantly higher in hearts of aged as compared with young rats. In addition, expression of the L-Ft gene in the hearts of the old animals was also higher. These, point to gene transcription as a mechanism underlying the presence of extra Ft in the old animals. The L-subunits of Ft are highly expressed in iron storage organs, e.g., the liver (Levenson and Tassabehji, 2004) where L-Ft gene transcription is responsive to iron (Ponka et al., 1998). It can, therefore, be hypothesized that the extra Ft is mostly due to an increase in L-Ft; this, however, needs to be confirmed by direct analysis of the Ft subunits. No iron accumulation was found in the old hearts. The nature of the signal, which initiates the rise in the myocardial Ft protein and L-Ft mRNA expression upon aging, remains an open question. Interactions between the iron responsive element (IRE on the mRNA) and the iron regulatory proteins were shown to be affected by cellular concentrations of iron, hydrogen peroxide, nitric oxide and molecular oxygen. These factors influence the formation and dissociation of the IRE/IRP complex (Hintze and Theil, 2006). Peroxide, as a component of the ROS system, is both a cellular signal and a metabolite able to cause cell damage. It can, therefore, be suggested that hydrogen peroxide signals the ‘‘oxidant alert’’ and initiates additional translation of Ft upon aging. These results are on accord with an increase in liver Ft found in aged as compared with young rats (Fellet et al., 2008; Rikans et al., 1997). The role of MCRC in maintaining cellular redox status has been well recognized (Moskovitz, 2005; Rohrbach et al., 2006; Yoshida
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
et al., 2003) although this knowledge did not receive enough input from studies on age-related changes in the MCRC. Due to the presence of functional – S–CH3 groups, methionyl-containing proteins are especially sensitive to oxidative stress; the oxidation of the methionine sulfur and formation of methylsulfoxide (–CH2– SO–CH3) can lead to protein inactivation (Brot and Weissbach, 1991). Therefore, maintaining the function of MCRC proteins is essential for cell viability. In the present study, the levels of MsrA and MsrB, the major components of MCRC, was found to significantly increase in the old as compared with the young hearts. In direct correlation with this result, MsrA gene expression in the old hearts exceeded that in the young controls, while MsrB gene expression did not alter. Together, the protein and mRNA data point to increased synthesis of myocardial Msr protein in the aged rats; a process which is likely controlled at the transcriptional level. The increased amount of MsrA may be instrumental in keeping up with the accelerated cell oxidation upon aging. Moreover, if theoretic activities of the Msr proteins are calculated according to the amounts determined by Western blot analysis a sharp decrease in the activities of both isozymes was found. The amount of MsrA in old heart is 170% of that of the young heart (Fig. 2A and B); the measured activity of MsrA in the young heart is 19.3 1.5 pmole/mg protein/min (Table 3). Thus, based on the Western blot analysis (amount of MsrA protein), the activity of MsrA in the old heart should have reached 32.8 pmole/mg protein/ min. In fact, the measured activity of MsrA in the old heart was only 16.7 0.8 pmole/mg protein/min, corresponding to 51% of the expected activity. An analogous analysis was applied to MsrB activity, where the protein amount in old hearts was 1.25 times of that in the young heart. The measured activity in the young heart is 41.0 11.0 pmole/mg protein/min, and the calculated activity for old heart should have reached 51.3 pmole/mg protein/min, but the actual measured activity was only 33.7 5.1 pmole/mg protein/min, i.e., only 66% of the expected value. The present study shows that the MsrA and TrxR enzymatic activities are markedly lower in the myocardial tissue of the aged animals than expected from Western blot. Similarly, a significant decrease in Msr activity in kidneys and brains of 26 months old rats, was reported (Petropoulos et al., 2001). In summary, these lower than expected activities could contribute to the oxidation of methionine and methionyl-containing proteins in these tissues. The age-related decrease in total Msr activity apparently disagreed with the increase in the amount of MsrA and MsrB proteins and MsrA mRNA levels found in the same old hearts. Likewise, the decrease of TrxR activity with age did not correlate with the unchanged level of TrxR protein, found in the same hearts. These discrepancies could be explained by irreversible oxidations or nitrosylations of essential thiol groups in the active centers of Msr and TrxR, which would inevitably lead to a loss in the enzymatic activity. In the present study, TrxR activity decreased in heart homogenates subjected to oxidative challenge with H2O2 in vitro but the amount of Western blotting-detectable protein did not. Assuming that oxidant-induced alterations play a major role in cell senescence these in vitro results could indicate the possibility of targeted damage to the catalytic center of TrxR. Although not tested in the present study, a similar mechanism may pertain to Msr protein and its enzymatic activity. In addition, Trx protein in hearts of old rats was higher but Trx enzymatic activity was lower than those in hearts of young animals (Kregel and Zhang, 2007). The authors proposed the mechanism of post-translation nitrosylation of major di-thiol groups of Trx. In the present study, the Msr and TrxR thiols might also be nitrosylated which would affect their catalytic potential (Boschi-Muller et al., 2005). In the case of MsrA, such reduced enzymatic efficiency was compensated for by synthesis of
143
additional enzyme molecules as evidenced by the increased amounts of MsrA protein and mRNA. The components of the MCRC contain reactive SH– and –S– CH3 groups which are, likely, equilibrated with cellular reduced sulfur pool, mainly glutathione (Sen and Packer, 2000). In rats, aging was found to be associated with substantial oxidation of myocardial glutathione and a decrease in the GSH/GSSG ratio (Kumaran et al., 2004; Rebrin and Sohal, 2004). As a response, an increased transcription of genes encoding for Msr indicates activation of oxidant signaling pathways; this process may reflect a decline in the antioxidant capacity of cardiac myocytes with age. On the other hand, oxidation of critical Met residues within selected proteins may serve to down-regulate energy metabolism and generation of ROS and may, therefore, be regarded as an adaptive response to age-related oxidative stress (Squier, 2001). In conclusion, aged rat hearts express increased levels of ferritin (protein and L-Ft mRNA) and Msr (both proteins and only MsrA mRNA). These may stem from the age-related activation of the oxidant-sensitive transcription and/or translation elements triggered by ROS-induced signaling. Whether these changes in ferritin and MCRC proteins represent adaptive mechanism/s in the aging myocardium remains in the focus of this laboratory. Acknowledgements This study was supported by grants from the Israel Science Foundation (ISF 585/02 and 316/05), and from the ‘Dr. Abraham Moshe and Paula Pepka Bergman Memorial Fund’. MC is the incumbent of the Dr. William Ganz Chair for Heart Studies at the Hebrew University of Jerusalem. We appreciate the assistance of Dr. A. Reznick, of the Technion– Israel Institute of Technology. We also thank Dr. Sue Goo Rhee (Ewha Womans University, Seoul, Korea, and Dr. Jackob Moskovitz (School of Pharmacy, University of Kansas) for generously providing the Trx TrxR and MsrA and MsrB antibodies. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mad.2008.10.002. References Berenshtein, E., Vaisman, B., Goldberg-Langerman, C., Kitrossky, N., Konijn, A.M., Chevion, M., 2002. Roles of ferritin and iron in ischemic preconditioning of the heart. Mol. Cell Biochem. 234–235, 283–292. Boschi-Muller, S., Olry, A., Antoine, M., Branlant, G., 2005. The enzymology and biochemistry of methionine sulfoxide reductases. Biochim. Biophys. Acta 1703, 231–238. Brot, N., Weissbach, H., 1991. Biochemistry of methionine sulfoxide residues in proteins. Biofactors 3, 91–96. Fellet, A.L.E., Boveris, A.T., Arranz, C., Balaszczuk, A.M., 2008. Cardiac mitochondrial nitric oxide: a regulator of heart rate? Am. J. Hypertens.. Friguet, B., 2006. Oxidized protein degradation and repair in ageing and oxidative stress. FEBS Lett. 580, 2910–2916. Hansel, A., Heinemann, S.H., Hoshi, T., 2005. Heterogeneity and function of mammalian MSRs: enzymes for repair, protection and regulation. Biochim. Biophys. Acta 1703, 239–247. Harman, D., 1956. Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 11, 298–300. Hintze, K.J., Theil, E.C., 2006. Cellular regulation and molecular interactions of the ferritins. Cell Mol. Life Sci. 63, 591–600. Holmgren, A., Bjornstedt, M., 1995. Thioredoxin and thioredoxin reductase. Methods Enzymol. 252, 199–208. Huang, X., Moir, R.D., Tanzi, R.E., Bush, A.I., Rogers, J.T., 2004. Redox-active metals, oxidative stress, and Alzheimer’s disease pathology. Ann. N Y Acad. Sci. 1012, 153–163. Juhaszova, M., Rabuel, C., Zorov, D.B., Lakatta, E.G., Sollott, S.J., 2005. Protection in the aged heart: preventing the heart-break of old age? Cardiovasc. Res. 66, 233–244.
144
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
Kloner, R.A., Przyklenk, K., Shook, T., Cannon, C.P., 1998. Protection conferred by preinfarct angina is manifest in the aged heart: evidence from the TIMI 4 trial. J. Thromb. Thrombolysis 6, 89–92. Kregel, K.C., Zhang, H.J., 2007. An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am. J. Physiol Regul. Integr. Comp. Physiol. 292, R18–R36. Kumaran, S., Savitha, S., Anusuya Devi, M., Panneerselvam, C., 2004. L-carnitine and DL-alpha-lipoic acid reverse the age-related deficit in glutathione redox state in skeletal muscle and heart tissues. Mech. Ageing. Dev. 125, 507–512. Levenson, C.W., Tassabehji, N.M., 2004. Iron and ageing: an introduction to iron regulatory mechanisms. Ageing Res. Rev. 3, 251–263. Liu, X., Theil, E.C., 2005. Ferritin as an iron concentrator and chelator target. Ann. N Y Acad. Sci. 1054, 136–140. Moskovitz, J., 2005. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta 1703, 213–219. Moskovitz, J., Berlett, B.S., Poston, J.M., Stadtman, E.R., 1997. The yeast peptidemethionine sulfoxide reductase functions as an antioxidant in vivo. Proc. Natl. Acad. Sci. USA 94, 9585–9589. Nilsson, U.A., Bassen, M., Savman, K., Kjellmer, I., 2002. A simple and rapid method for the determination of ‘‘free’’ iron in biological fluids. Free Radic. Res. 36, 677–684. Petropoulos, I., Friguet, B., 2006. Maintenance of proteins and aging: the role of oxidized protein repair. Free Radic. Res. 40, 1269–1276. Petropoulos, I., Mary, J., Perichon, M., Friguet, B., 2001. Rat peptide methionine sulphoxide reductase: cloning of the cDNA, and down-regulation of gene expression and enzyme activity during aging. Biochem. J. 355, 819–825. Ponka, P., Beaumont, C., Richardson, D.R., 1998. Function and regulation of transferrin and ferritin. Semin. Hematol. 35, 35–54.
Rebrin, I., Sohal, R.S., 2004. Comparison of thiol redox state of mitochondria and homogenates of various tissues between two strains of mice with different longevities. Exp. Gerontol. 39, 1513–1519. Reno, C., Marchuk, L., Sciore, P., Frank, C.B., Hart, D.A., 1997. Rapid isolation of total RNA from small samples of hypocellular, dense connective tissues. Biotechniques 22, 1082–1086. Rikans, L.E., Ardinska, V., Hornbrook, K.R., 1997. Age-associated increase in ferritin content of male rat liver: implication for diquat-mediated oxidative injury. Arch. Biochem. Biophys. 344, 85–93. Rohrbach, S., Gruenler, S., Teschner, M., Holtz, J., 2006. The thioredoxin system in aging muscle: key role of mitochondrial thioredoxin reductase in the protective effects of caloric restriction? Am. J. Physiol. Regul Integr. Comp. Physiol. 291, R927–R935. Sen, C.K., Packer, L., 2000. Thiol homeostasis and supplements in physical exercise. Am. J. Clin. Nutr. 72, 653S–669S. Shioji, K., Kishimoto, C., Nakamura, H., Toyokuni, S., Nakayama, Y., Yodoi, J., Sasayama, S., 2000. Upregulation of thioredoxin (TRX) expression in giant cell myocarditis in rats. FEBS Lett. 472, 109–113. Squier, T.C., 2001. Oxidative stress and protein aggregation during biological aging. Exp. Gerontol. 36, 1539–1550. Stadtman, E.R., Moskovitz, J., Levine, R.L., 2003. Oxidation of methionine residues of proteins: biological consequences. Antioxid. Redox. Signal 5, 577–582. Suh, J.H., Shigeno, E.T., Morrow, J.D., Cox, B., Rocha, A.E., Frei, B., Hagen, T.M., 2001. Oxidative stress in the aging rat heart is reversed by dietary supplementation with (R)-(alpha)-lipoic acid. Faseb. J. 15, 700–706. Tappia, P.S., Dent, M.R., Dhalla, N.S., 2006. Oxidative stress and redox regulation of phospholipase D in myocardial disease. Free Radic Biol. Med. 41, 349–361. Yoshida, T., Oka, S., Masutani, H., Nakamura, H., Yodoi, J., 2003. The role of thioredoxin in the aging process: involvement of oxidative stress. Antioxid. Redox Signal 5, 563–570.
Contents lists available at ScienceDirect
Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev
Iron, ferritin and proteins of the methionine-centered redox cycle in young and old rat hearts Baruch Bulvik a, Leonid Grinberg a, Ron Eliashar b, Eddy Berenshtein a, Mordechai (Mottie) Chevion a,* a b
Department of Cellular Biochemistry and Human Genetics, The Hebrew University of Jerusalem, Faculties of Medicine and Dental Medicine, 91120 Jerusalem, Israel Department of Otolaryngology/Head & Neck Surgery, The Hadassah-Hebrew University Hospital, Jerusalem, Israel
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 June 2008 Received in revised form 28 September 2008 Accepted 7 October 2008 Available online 17 October 2008
Progressive oxidation of cellular components constitutes a major mechanism of the aging process. An emerging paradigm of redox signaling suggests that low level oxidants activate protective pathways resulting in prolonged cell survival. This report centers on the study of cardiac muscle in young and old rats, including (i) the expression of ferritin (Ft) the major iron storage protein, and (ii) the expression of the major proteins of the methionine-centered redox cycle (MCRC), which controls the cellular methionine redox status. Total amounts of Ft (protein) and its mRNA encoding for Ft L-subunit (Ft-L) were higher in the aged hearts, indicating that the iron-binding capacity of myocardial Ft increased with age. Among the proteins of the MCRC, methionine sulfoxide reductases A and B (MsrA, MsrB) and MsrA mRNA were significantly higher in hearts of old rats with a significant decrease in MsrA activity. The observed up-regulation of the expression of Msr and Ft-L could represent a protective response to the increased oxidative stress in the aging myocardium. ß 2008 Elsevier Ireland Ltd. All rights reserved.
Keywords: Aging Ferritin subunits Methionine sulfoxide reductase Thioredoxin Thioredoxin reductase
1. Introduction Among commonly discussed theories of aging, the ‘‘free radical mechanism’’ has earned noticeable attention (Friguet, 2006; Harman, 1956; Squier, 2001). Oxidative stress has traditionally been viewed as an imbalance between generation and neutralization of reactive oxygen-derived species (ROS) in the cell. These include, among others, the superoxide radical anion, hydrogen peroxide and hydroxyl radical. The latter is produced in the presence of redox active iron and copper which markedly aggravate the ROS-induced cell damage (Huang et al., 2004). It has been surmised that oxidation of cellular components and accumulation of oxidized products closely correlate with the process of biological aging (Kregel and Zhang, 2007; Petropoulos and Friguet, 2006). However, despite a large body of supporting evidence, a causal link between ROS and aging has still not been clearly established.
* Corresponding author at: Ganz Chair of Heart Studies, The Hebrew University of Jerusalem, P.O. Box 12272, Jerusalem IL-91120, Israel. Tel.: +972 2 675 8160; fax: +972 2 641 5848. E-mail address: [email protected] (M.(. Chevion). Abbreviations: Ft, ferritin; Ft-H and Ft-L, the H- and L- subunits of ferritin; MCRC, methionine-centered redox-cycle; Met, methionine; MetO, methionine sulfoxide; MetO2, methionine sulfone; Msr, methionine sulfoxide reductase; ROS, reactive oxygen-derived species; Trx, thioredoxin 1; TrxR, thioredoxin reductase 1. 0047-6374/$ – see front matter ß 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mad.2008.10.002
A recent new paradigm of oxidative redox signaling suggests that ROS can function as intracellular signaling molecules. Redoxsensing proteins and redox-based modulation of gene expression have emerged as governors of fundamental regulatory mechanisms in the cell (Sen and Packer, 2000; Tappia et al., 2006). Attempting to translate these views into the terms of aging, it can be hypothesized that oxidative stress plays a dual role: (i) it can cause age-related accumulation of oxidized products which are deleterious to the cell, but (ii) it can also facilitate the development of mechanisms able to protect against age-associated oxidative damage. In a normal well protected cell, 95–98% of its iron is bound to ferritin (Ft), the major iron storage and detoxifying protein, that keeps labile and redox active iron at submicromolar levels (Liu and Theil, 2005). Exceeding these levels initiates translation of new Ft subunits so that the excess iron is scavenged and neutralized. This process is regulated via the iron regulatory proteins (IRPs) in association with the iron responsive elements (IREs) on the mRNA. Therefore, an increase in Ft (protein and/or mRNA) indicates recent cellular events whereby the level of labile iron has increased (Hintze and Theil, 2006; Levenson and Tassabehji, 2004). The methionine-centered redox cycle (MCRC) has been implicated in regulating the thiol status and the dithiol-disulfide transition of cellular proteins (Fig. 1). Mild oxidation of methionine (Met) to methionine-sulfoxide (MetO) can be enzymatically reversed by methionine sulfoxide reductase (Msr), which prevents
140
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
Fig. 1. The methionine-centered redox cycle. Oxidation of free methionine or methionyl residue of a protein results in the formation of methionine(yl) sulfoxide (MetO). Further oxidation of MetO will generate methionine(yl) sulfone (MetO2); the process is almost not reversible in biological systems. The formation of MetO2 will eventually cause protein denaturation. In contrast, MetO is normally reduced by methionine sulfoxide reductase (MsrA or MsrB isoform), which, in turn, receives electrons from thioredoxin (Trx). The oxidized thioredoxin (Trxox) is reduced by thioredoxin reductase (TrxR) which is integrated into the entire cell redox system via NADP/NADP(H). The MCRC shares both antioxidant and regulatory functions with major cellular thiols.
the formation of the irreversibly oxidized product – methionine sulfone (MetO2), and presumably, denaturation of Met-containing proteins (Moskovitz, 2005; Stadtman et al., 2003). The Msr family compose of MsrA and MsrB diversed in their stereo-specific reducing activity towards oxidized substrates: MsrA for S-MetO and MsrB for R-MetO. MsrB is the predominany isomer in the heart (Hansel et al., 2005) .It is considered that cyclic inter-conversion of Met and MetO residues of proteins leads to the removal of multiple forms of ROS and may also play an important role in enzyme regulation and signal transduction. Loss of Msr activity caused in aging mice shortening in life span (Stadtman et al., 2003). Another component of the MCRC is thioredoxin (Trx), which supports the reduction of Msr to its Met – (reduced) form, by supplying two electrons, via the oxidation of its di-thiol to disulfide groups. Trx undergoes cyclic redox reactions is being oxidized by the Msr protein and then reduced by Trx-reductase (TrxR), using the reducing equivalents of NADPH (Fig. 1). It has been proposed that an age-related decrease in TrxR level in skeletal muscle and heart enhances tissue susceptibility to apoptotic stimuli (Rohrbach et al., 2006). Under certain conditions, the Trx system could serve a marker of cell proliferation and senescence (Yoshida et al., 2003). Based on a plethora of clinical observations, it has been surmised that the aging heart develops specific mechanisms of cardioprotection (Juhaszova et al., 2005). Moreover, old patients with pre-infarct angina, reportedly, suffer a lower rate of death, heart failure, shock and re-infarction as compared with old patients without angina (Kloner et al., 1998). These observations suggest that heart ischemia, manifested as angina, may precondition the heart and increase its resistance toward an acute ischemic insult. In the present study, we tested whether iron-responding cell components and ROS-responding cell components (i.e. Ft and MCRC proteins, respectively) are involved in age-related alterations of the rat myocardium. Here we report on elevated levels of Ft and Msr (both A and B isomers) in cardiac tissues of old rats, which may represent an adaptive response of the heart to ischemic risks upon aging. 2. Materials and methods 2.1. Materials All chemicals were of the highest purity available (sources indicated in the Supplementary materials). 2.2. Animals The study was approved by the Institutional Animal Ethics and Welfare Committee of the Hebrew University – Hadassah Medical School. Wistar female rats
were purchased from Harlan Laboratories, Jerusalem, Israel and kept under specific pathogen-free conditions at room temperature. The diurnal cycle consisted of 12 h of light and 12 h of dark; the animals were fed standard rat chow and water ad libitum for 9 weeks (young) and 24–25 months (old). On the day of the experiment, anesthesia was induced by injecting Xylazine (15 mg/kg, i.p.) and Ketamin (100 mg/ kg, i.p.). The heart was rapidly excised, placed in liquid nitrogen and kept until analyzed. Tissue homogenates were prepared using a Cole Parmer Teflon homogenizer. About 100 mg wet tissue was homogenized in 1.6 ml of a special lysis buffer containing Tris–HCl (50 mM), cysteine (1 mM), sodium citrate (1 mM) and MnCl2 (0.5 mM), phenyl–methyl–sulfonyl–fluoride (PMSF) (0.25 mM), digitonin (0.02%), at pH 7.6. Protein concentrations in the lysate were determined using the BCA (BiCinchonic Acid) kit according to manufacturer’s (Pierce, USA) instructions. 2.3. Ft and iron Ft concentration was quantified using an indirect ELISA assay according to a procedure earlier developed in this laboratory (Berenshtein et al., 2002). All antibodies were provided by Dr. A. M. Konijn (Department of Human Nutrition and Metabolism, Hebrew University, Jerusalem, Israel). Ft-bound iron was determined in the immuno-precipitate which had been formed by the reaction between heart Ft (in the homogenate and a specific anti-ratheart-Ft antibody. Aliquots of the heart homogenate (sample) and anti-Ft antibody diluted in the lysis buffer were mixed and incubated at 4 8C for 72 h. The samples were then centrifuged at 20,000 g for 20 min, the supernatant was discarded and the pellet dissolved in concentrated HNO3. Total amount of iron was measured using the BPS (bathophenantrolin di-sulfonic acid) reagent (Nilsson et al., 2002). From this analysis and the measured concentration of Ft, the degree of Ft saturation by iron was calculated, and presented as the number of iron atoms per Ft molecule and denoted as NFe. 2.4. MCRC proteins Msr activity was determined according to a published protocol (Moskovitz et al., 1997). The method is based on the enzymatic reduction of the substrate – dabsyl methionine sulfoxide – into dabsyl methionine, which is then determined using HPLC with spectrophotometric detection at 436 nm. The method produced the total (combined) activity of the Msr iso-forms present in the heart homogenate. MsrA specific activity was determined after immunoprecipitation of MsrB with anti-MsrB antibody. MsrB specific activity was calculated by subtracting the activity of MsrA from the total Msr activity measured. TrxR activity was assayed by the reduction of the thiol specific reagent – 5,50 dithiobis(2-nitrobenzoic acid – by NADPH; the product is spectrophotometrically measured at 412 nm (Holmgren and Bjornstedt, 1995). Authentic TrxR (Sigma) was run as the standard sample; the final results were then expressed in units of TrxR activity per mg of sample protein. In one set of experiments, heart homogenates (250 mg protein) were incubated with hydrogen peroxide (1 mM) for 30 min at 37 8C. Then the enzymatic activity of TrxR1 and the amount of TrxR1 protein (as monitored by Western blotting, as described below) were determined. Quantification of Trx1, TrxR1 MsrA and MsrB were conducted using the Western blot method (Shioji et al., 2000) with some minor modifications (see Supplementary materials for details). The primary antibodies for Trx1 and TrxR1 were generously provided by Dr. S.G. Rhee (Ewha Women University, Seoul, Korea) and those for MsrA and MsrB by Dr. J. Moskovitz (School of Pharmacy, University of Kansas, MO,
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
141
Table 1 The primers’ sequences and relevant exon numbers used in the PCR assay. Gene
Accession No.
Forward Primer
Reverse Primer
Exon
H-ferritin L-ferritin MsrA MsrB Trx TrxR
NM012848 NM022500 NM053307 NM001031660 NM053800 NM031614
ACGTCTATCTGTCCATGGTCTTG CCTACCTCTCTCTGGGCTTCT ATTTGGAATGGGCTGCTTCT GTGGTCTGCAAACAGTGTGA TGGATGACTGCCAGGATGT TCCTCACAAAATTATGGCAACA
AAAGTTCTTCAGGGCCACAT CTTCTCCTCGGCCAATTC TAGGTGGGATTGCGTGTGTA CTGTTGATGCAAAACCTTTGTC GTCGGCATGCATTTGACTT GGAACCGCTCTGCTGAGTAA
1-2:2 1-2:2 2-3:3 4-5:5 3-4:4 5-6:6
The nucleotide sequences used for primer design were obtained from the public database GenBank. Primers for the indicated genes were constructed using the Primer3 software, and designed so that the forward primer in each pair was complimentary to the exon–exon boundary (e.g., 3–4) in order to avoid genomic DNA amplification. with p 0.05 were considered statistically significant. The data are presented as mean S.D. The numbers of samples are indicated in the figure legends.
Table 2 H- and L-subunits of ferritin mRNAs in hearts of old and young rats. Group
Young
Old
Ft-H Ft-L H/L ratio
0.19 0.04 0.05 0.01 4.10 0.80
0.15 0.05 0.09 0.02* 1.74 0.50**
Real Time PCR was used to quantify the expression of genes encoding for Ft H- and Ft L-subunits. The numbers represent means S.D., in arbitrary units pertaining to the respective mRNAs obtained as indicated in Section 2. In total 8 old and 7 young rat hearts were used. * p = 0.0008. ** p = 0.0001 old versus young.
USA). In total, four experiments were conducted and analyzed by Western Blot Analysis; each gel was loaded with randomly selected ‘‘young’’ and ‘‘old’’ homogenates plus a specific ‘standard’ homogenate, which was present in each gel throughout the entire series. The densitometry data was converted into the ratio of protein concentrations in the ‘‘old’’ to that in the ‘‘young’’ samples. Expression of mRNA of the MCRC proteins and H- and L-subunits of Ft was quantified using qRT-PCR methodology (Reno et al., 1997). The nucleotide sequences used for primer design were obtained from the public database GenBank (Table 1) and purchased from Syntezza, Israel. Primers for target genes were constructed using the Primer3 software (from: http://frodo.wi.mit.edu/cgi-bin/ primer3/primer3_www.cgi), and designed so that the forward primer in each pair was complimentary to the exon–exon boundary (e.g., 3–4 in Table 1) in order to avoid genomic DNA amplification. The PCR primary data were obtained in triplicates. Expression of the H- and L-Ft genes was normalized per the expression of b-actin and presented as arbitrary units according to (Reno et al., 1997) (Table 2). Changes in the expression of the MCRC protein genes upon aging were calculated by normalizing all PCR data to the mean value in the ‘‘young’’ group (Fig. 3).
3. Results 3.1. Ft and iron Old hearts had significantly higher amounts of Ft protein than the young hearts: 5.9 0.6 versus 3.0 1.2 mg Ft/mg protein, respectively (p = 0.01). To test whether the age-related accumulation of Ft was due to increased transcription of Ft chains, the expression of the genes encoding for H- and L-ferritin subunits was monitored, as shown in Table 2. While no significant changes were observed for HFt mRNA, the levels of L-Ft mRNA were almost twice higher in the old as compared with the young hearts. The result points to increased gene expression and, possibly, accelerated transcription of Ft-L subunits in the myocardium of the aged rats. In contrast to Ft (protein) and L-Ft mRNA, we found no differences in total Ft-bound iron between old and young rat hearts: 554 (old) versus 572 (young) ng iron/mg protein. Given that the amount of Ft was twice higher in the old hearts, NFe, the average number of iron atoms within each Ft molecule was 764 (in the old) and 1592 (in the young). These data point to the presence of iron-poorer Ft in the aged hearts, which could allow the heart to cope with age-related increase in oxidative stress. The ironbinding capacity of this Ft increased with age. 3.2. MCRC proteins
2.5. Statistical analysis The data were analyzed using repeated one-way ANOVA followed by the Scheffe post hoc test, for multiple comparisons (with a = 0.05). The differences of the means
Typical Western blots obtained from heart homogenates are shown in Fig. 2A.
Fig. 2. The amounts of the proteins components of the methionine-centered redox cycle. (A) Representative Western blots. Cytosolic fractions of heart homogenates of young (9 weeks) and old (24–25 months) rats were run on SDS-PAGE, transferred to nitrocellulose membranes and then exposed to specific antibodies raised against the target proteins. The membranes were then analyzed according to the Western blot methodology (see Supplementary materials). (B) Densitometric analysis of the Western blots. In total, 15 young and 17 old hearts were analyzed. The densitometric data are expressed as the ‘‘old/young’’ ratios. *p = 0.002 for old (black bars) versus young.
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
142
Table 4 Enzymatic activity and protein content of TrxR under subjected to oxidative stress. Parameters
Treatment None
H2O2
TrxR activity (mU/mg protein) TrxR protein (A.U.)
23.1 2.5 0.66 0.3
18.8 2.4* 0.70 0.25
Five young rats heart homogenates were incubated in the presence of H2O2 (0.5 mmole/mg protein) for 30 min at 37 8C. TrxR activity was assayed using the DTNB method and the TrxR protein by Western Blot analysis. See Section 2 for details. * Denotes p < 0.02. Fig. 3. Expression of genes encoding the MCRC-proteins. RNAs were extracted from heart homogenates of young (9 weeks) and old (24–25 months) rats. One microgram RNA was used in the reverse transcription reaction. Real Time-PCR was run using primers specific for the target genes. The PCR data were normalized per expression of b-actin gene and then expressed as the ‘‘old/young’’ ratios. In total, 7 young and 8 old hearts were analyzed. * p = 0.04 old (black bars) versus young.
Table 3 Enzymatic activities of Msr isozymes and TrxR.
Total Msr MsrA MsrB MsrB/MsrA TrxR
Young
Old
p-value
60.3 3.6 19.3 1.5 41.0 11.0 2.12 23.1 2.2
50.4 2.3 16.7 0.8 33.7 5.1 2.02 16.9 3.2
0.003 0.004 >0.05 0.018
Heart homogenates were incubated with Dabsyl-MetO and spectrophotometrically analyzed by HPLC for their reduction to Dabsyl-Met. The results are in pmole/mg protein/min. MsrA activity was measured after MsrB immunoprecipitation, MsrB activity was calculated from total Msr activity minus MsrA activity. TrxR activity was assayed using the DTNB method. Results are in mU/mg protein. See Section 2 for details.
While b-actin, Trx and TrxR showed no apparent differences between the old and young hearts, MsrA and MsrB did: it was significantly higher in samples of aged hearts, by 70% for MsrA and 25% for MsrB (reaching 170 and 125%, in the aged hearts). The two other proteins averaged at similar levels for both age groups. Concentrations of the major protein components of MCRC in myocardial homogenates from young and old rats are shown in Fig. 2B. In mRNAs that encode the major protein components of MCRC, a trend towards higher mRNA concentrations in the old hearts was observed, except for MsrB. For MsrA it reached statistical significance (Fig. 3). This result is in accord with the increase in MsrA protein as detected by Western blotting (Fig. 2B). The enzymatic activities of MsrA, MsrB and TrxR were tested, in heart tissues of young and old rats. The Msr total activity, the measured activity of MsrA, and the calculated MsrB activity are shown in Table 3. It clearly demonstrates that both Msr and TrxR activities were significantly reduced in hearts of old animals, when compared to the young ones. It should be noted that the enzymatic activity of myocardial Msr decreased with age, while the amount of Msr protein increased with age. Likewise, the activity of TrxR decreased with age, while the amount of TrxR protein did not change. These discrepancies between the changes in the enzymatic activities and the amounts of proteins might be due to post translational alterations in the activities of the aged hearts, which apparently did not alter the overall immuno-detectable structure of these proteins. To test whether such asymmetric changes in protein structure and function could co-exist we used a model of oxidative stress
whereby young heart homogenates were incubated with H2O2. The results are presented in Table 4. The results suggest that such an oxidative stress induced a decrease in TrxR activity, which did not necessarily involve a decrease in the amount of immuno-detectable TrxR protein. Therefore, the decrease in TrxR activity in the older hearts did not seem to affect the detectability of the bulk of the protein, by Western blot analysis, but was probably due to specific changes affecting the activity of the enzyme. 4. Discussion Oxidative stress has been implicated in the pathogenesis of agerelated diseases. Aging was shown to be associated with an increase in ROS generation and/or a decline in cellular repair (Friguet, 2006; Squier, 2001). For example, rat cardiac myocytes showed a significant age-related increase in the rate of ROS production and oxidative DNA damage, which was accompanied by a decline in the levels of ascorbic acid (Suh et al., 2001). Iron, an essential element of all dividing cells, is a major catalyst of the formation of hydroxyl radical (OH). Iron could enhance ROS-induced damage and thus shift the redox balance from that compatible with cell survival to cell death. Therefore, binding and storing of labile and redox-active iron is important for the prevention of uncontrolled cell oxidation upon aging. In the present study, the level of Ft – the major iron storage protein – was significantly higher in hearts of aged as compared with young rats. In addition, expression of the L-Ft gene in the hearts of the old animals was also higher. These, point to gene transcription as a mechanism underlying the presence of extra Ft in the old animals. The L-subunits of Ft are highly expressed in iron storage organs, e.g., the liver (Levenson and Tassabehji, 2004) where L-Ft gene transcription is responsive to iron (Ponka et al., 1998). It can, therefore, be hypothesized that the extra Ft is mostly due to an increase in L-Ft; this, however, needs to be confirmed by direct analysis of the Ft subunits. No iron accumulation was found in the old hearts. The nature of the signal, which initiates the rise in the myocardial Ft protein and L-Ft mRNA expression upon aging, remains an open question. Interactions between the iron responsive element (IRE on the mRNA) and the iron regulatory proteins were shown to be affected by cellular concentrations of iron, hydrogen peroxide, nitric oxide and molecular oxygen. These factors influence the formation and dissociation of the IRE/IRP complex (Hintze and Theil, 2006). Peroxide, as a component of the ROS system, is both a cellular signal and a metabolite able to cause cell damage. It can, therefore, be suggested that hydrogen peroxide signals the ‘‘oxidant alert’’ and initiates additional translation of Ft upon aging. These results are on accord with an increase in liver Ft found in aged as compared with young rats (Fellet et al., 2008; Rikans et al., 1997). The role of MCRC in maintaining cellular redox status has been well recognized (Moskovitz, 2005; Rohrbach et al., 2006; Yoshida
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
et al., 2003) although this knowledge did not receive enough input from studies on age-related changes in the MCRC. Due to the presence of functional – S–CH3 groups, methionyl-containing proteins are especially sensitive to oxidative stress; the oxidation of the methionine sulfur and formation of methylsulfoxide (–CH2– SO–CH3) can lead to protein inactivation (Brot and Weissbach, 1991). Therefore, maintaining the function of MCRC proteins is essential for cell viability. In the present study, the levels of MsrA and MsrB, the major components of MCRC, was found to significantly increase in the old as compared with the young hearts. In direct correlation with this result, MsrA gene expression in the old hearts exceeded that in the young controls, while MsrB gene expression did not alter. Together, the protein and mRNA data point to increased synthesis of myocardial Msr protein in the aged rats; a process which is likely controlled at the transcriptional level. The increased amount of MsrA may be instrumental in keeping up with the accelerated cell oxidation upon aging. Moreover, if theoretic activities of the Msr proteins are calculated according to the amounts determined by Western blot analysis a sharp decrease in the activities of both isozymes was found. The amount of MsrA in old heart is 170% of that of the young heart (Fig. 2A and B); the measured activity of MsrA in the young heart is 19.3 1.5 pmole/mg protein/min (Table 3). Thus, based on the Western blot analysis (amount of MsrA protein), the activity of MsrA in the old heart should have reached 32.8 pmole/mg protein/ min. In fact, the measured activity of MsrA in the old heart was only 16.7 0.8 pmole/mg protein/min, corresponding to 51% of the expected activity. An analogous analysis was applied to MsrB activity, where the protein amount in old hearts was 1.25 times of that in the young heart. The measured activity in the young heart is 41.0 11.0 pmole/mg protein/min, and the calculated activity for old heart should have reached 51.3 pmole/mg protein/min, but the actual measured activity was only 33.7 5.1 pmole/mg protein/min, i.e., only 66% of the expected value. The present study shows that the MsrA and TrxR enzymatic activities are markedly lower in the myocardial tissue of the aged animals than expected from Western blot. Similarly, a significant decrease in Msr activity in kidneys and brains of 26 months old rats, was reported (Petropoulos et al., 2001). In summary, these lower than expected activities could contribute to the oxidation of methionine and methionyl-containing proteins in these tissues. The age-related decrease in total Msr activity apparently disagreed with the increase in the amount of MsrA and MsrB proteins and MsrA mRNA levels found in the same old hearts. Likewise, the decrease of TrxR activity with age did not correlate with the unchanged level of TrxR protein, found in the same hearts. These discrepancies could be explained by irreversible oxidations or nitrosylations of essential thiol groups in the active centers of Msr and TrxR, which would inevitably lead to a loss in the enzymatic activity. In the present study, TrxR activity decreased in heart homogenates subjected to oxidative challenge with H2O2 in vitro but the amount of Western blotting-detectable protein did not. Assuming that oxidant-induced alterations play a major role in cell senescence these in vitro results could indicate the possibility of targeted damage to the catalytic center of TrxR. Although not tested in the present study, a similar mechanism may pertain to Msr protein and its enzymatic activity. In addition, Trx protein in hearts of old rats was higher but Trx enzymatic activity was lower than those in hearts of young animals (Kregel and Zhang, 2007). The authors proposed the mechanism of post-translation nitrosylation of major di-thiol groups of Trx. In the present study, the Msr and TrxR thiols might also be nitrosylated which would affect their catalytic potential (Boschi-Muller et al., 2005). In the case of MsrA, such reduced enzymatic efficiency was compensated for by synthesis of
143
additional enzyme molecules as evidenced by the increased amounts of MsrA protein and mRNA. The components of the MCRC contain reactive SH– and –S– CH3 groups which are, likely, equilibrated with cellular reduced sulfur pool, mainly glutathione (Sen and Packer, 2000). In rats, aging was found to be associated with substantial oxidation of myocardial glutathione and a decrease in the GSH/GSSG ratio (Kumaran et al., 2004; Rebrin and Sohal, 2004). As a response, an increased transcription of genes encoding for Msr indicates activation of oxidant signaling pathways; this process may reflect a decline in the antioxidant capacity of cardiac myocytes with age. On the other hand, oxidation of critical Met residues within selected proteins may serve to down-regulate energy metabolism and generation of ROS and may, therefore, be regarded as an adaptive response to age-related oxidative stress (Squier, 2001). In conclusion, aged rat hearts express increased levels of ferritin (protein and L-Ft mRNA) and Msr (both proteins and only MsrA mRNA). These may stem from the age-related activation of the oxidant-sensitive transcription and/or translation elements triggered by ROS-induced signaling. Whether these changes in ferritin and MCRC proteins represent adaptive mechanism/s in the aging myocardium remains in the focus of this laboratory. Acknowledgements This study was supported by grants from the Israel Science Foundation (ISF 585/02 and 316/05), and from the ‘Dr. Abraham Moshe and Paula Pepka Bergman Memorial Fund’. MC is the incumbent of the Dr. William Ganz Chair for Heart Studies at the Hebrew University of Jerusalem. We appreciate the assistance of Dr. A. Reznick, of the Technion– Israel Institute of Technology. We also thank Dr. Sue Goo Rhee (Ewha Womans University, Seoul, Korea, and Dr. Jackob Moskovitz (School of Pharmacy, University of Kansas) for generously providing the Trx TrxR and MsrA and MsrB antibodies. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mad.2008.10.002. References Berenshtein, E., Vaisman, B., Goldberg-Langerman, C., Kitrossky, N., Konijn, A.M., Chevion, M., 2002. Roles of ferritin and iron in ischemic preconditioning of the heart. Mol. Cell Biochem. 234–235, 283–292. Boschi-Muller, S., Olry, A., Antoine, M., Branlant, G., 2005. The enzymology and biochemistry of methionine sulfoxide reductases. Biochim. Biophys. Acta 1703, 231–238. Brot, N., Weissbach, H., 1991. Biochemistry of methionine sulfoxide residues in proteins. Biofactors 3, 91–96. Fellet, A.L.E., Boveris, A.T., Arranz, C., Balaszczuk, A.M., 2008. Cardiac mitochondrial nitric oxide: a regulator of heart rate? Am. J. Hypertens.. Friguet, B., 2006. Oxidized protein degradation and repair in ageing and oxidative stress. FEBS Lett. 580, 2910–2916. Hansel, A., Heinemann, S.H., Hoshi, T., 2005. Heterogeneity and function of mammalian MSRs: enzymes for repair, protection and regulation. Biochim. Biophys. Acta 1703, 239–247. Harman, D., 1956. Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 11, 298–300. Hintze, K.J., Theil, E.C., 2006. Cellular regulation and molecular interactions of the ferritins. Cell Mol. Life Sci. 63, 591–600. Holmgren, A., Bjornstedt, M., 1995. Thioredoxin and thioredoxin reductase. Methods Enzymol. 252, 199–208. Huang, X., Moir, R.D., Tanzi, R.E., Bush, A.I., Rogers, J.T., 2004. Redox-active metals, oxidative stress, and Alzheimer’s disease pathology. Ann. N Y Acad. Sci. 1012, 153–163. Juhaszova, M., Rabuel, C., Zorov, D.B., Lakatta, E.G., Sollott, S.J., 2005. Protection in the aged heart: preventing the heart-break of old age? Cardiovasc. Res. 66, 233–244.
144
B. Bulvik et al. / Mechanisms of Ageing and Development 130 (2009) 139–144
Kloner, R.A., Przyklenk, K., Shook, T., Cannon, C.P., 1998. Protection conferred by preinfarct angina is manifest in the aged heart: evidence from the TIMI 4 trial. J. Thromb. Thrombolysis 6, 89–92. Kregel, K.C., Zhang, H.J., 2007. An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am. J. Physiol Regul. Integr. Comp. Physiol. 292, R18–R36. Kumaran, S., Savitha, S., Anusuya Devi, M., Panneerselvam, C., 2004. L-carnitine and DL-alpha-lipoic acid reverse the age-related deficit in glutathione redox state in skeletal muscle and heart tissues. Mech. Ageing. Dev. 125, 507–512. Levenson, C.W., Tassabehji, N.M., 2004. Iron and ageing: an introduction to iron regulatory mechanisms. Ageing Res. Rev. 3, 251–263. Liu, X., Theil, E.C., 2005. Ferritin as an iron concentrator and chelator target. Ann. N Y Acad. Sci. 1054, 136–140. Moskovitz, J., 2005. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta 1703, 213–219. Moskovitz, J., Berlett, B.S., Poston, J.M., Stadtman, E.R., 1997. The yeast peptidemethionine sulfoxide reductase functions as an antioxidant in vivo. Proc. Natl. Acad. Sci. USA 94, 9585–9589. Nilsson, U.A., Bassen, M., Savman, K., Kjellmer, I., 2002. A simple and rapid method for the determination of ‘‘free’’ iron in biological fluids. Free Radic. Res. 36, 677–684. Petropoulos, I., Friguet, B., 2006. Maintenance of proteins and aging: the role of oxidized protein repair. Free Radic. Res. 40, 1269–1276. Petropoulos, I., Mary, J., Perichon, M., Friguet, B., 2001. Rat peptide methionine sulphoxide reductase: cloning of the cDNA, and down-regulation of gene expression and enzyme activity during aging. Biochem. J. 355, 819–825. Ponka, P., Beaumont, C., Richardson, D.R., 1998. Function and regulation of transferrin and ferritin. Semin. Hematol. 35, 35–54.
Rebrin, I., Sohal, R.S., 2004. Comparison of thiol redox state of mitochondria and homogenates of various tissues between two strains of mice with different longevities. Exp. Gerontol. 39, 1513–1519. Reno, C., Marchuk, L., Sciore, P., Frank, C.B., Hart, D.A., 1997. Rapid isolation of total RNA from small samples of hypocellular, dense connective tissues. Biotechniques 22, 1082–1086. Rikans, L.E., Ardinska, V., Hornbrook, K.R., 1997. Age-associated increase in ferritin content of male rat liver: implication for diquat-mediated oxidative injury. Arch. Biochem. Biophys. 344, 85–93. Rohrbach, S., Gruenler, S., Teschner, M., Holtz, J., 2006. The thioredoxin system in aging muscle: key role of mitochondrial thioredoxin reductase in the protective effects of caloric restriction? Am. J. Physiol. Regul Integr. Comp. Physiol. 291, R927–R935. Sen, C.K., Packer, L., 2000. Thiol homeostasis and supplements in physical exercise. Am. J. Clin. Nutr. 72, 653S–669S. Shioji, K., Kishimoto, C., Nakamura, H., Toyokuni, S., Nakayama, Y., Yodoi, J., Sasayama, S., 2000. Upregulation of thioredoxin (TRX) expression in giant cell myocarditis in rats. FEBS Lett. 472, 109–113. Squier, T.C., 2001. Oxidative stress and protein aggregation during biological aging. Exp. Gerontol. 36, 1539–1550. Stadtman, E.R., Moskovitz, J., Levine, R.L., 2003. Oxidation of methionine residues of proteins: biological consequences. Antioxid. Redox. Signal 5, 577–582. Suh, J.H., Shigeno, E.T., Morrow, J.D., Cox, B., Rocha, A.E., Frei, B., Hagen, T.M., 2001. Oxidative stress in the aging rat heart is reversed by dietary supplementation with (R)-(alpha)-lipoic acid. Faseb. J. 15, 700–706. Tappia, P.S., Dent, M.R., Dhalla, N.S., 2006. Oxidative stress and redox regulation of phospholipase D in myocardial disease. Free Radic Biol. Med. 41, 349–361. Yoshida, T., Oka, S., Masutani, H., Nakamura, H., Yodoi, J., 2003. The role of thioredoxin in the aging process: involvement of oxidative stress. Antioxid. Redox Signal 5, 563–570.