- Email: [email protected]
Iron-induced neuronal damage in a rat model of post-traumatic stress disorder
Accepted Manuscript Iron-induced neuronal damage in a rat model of post-traumatic stress disorder Ming Zhao, Zhibo Yu, Yang Zhang, Xueling Huang, Jingming Hou, YanGang Zhao, Wei Luo, Lin Chen, Lan Ou, Haitao Li, Jiqiang Zhang PII: DOI: Reference:
S0306-4522(16)30174-9 http://dx.doi.org/10.1016/j.neuroscience.2016.05.025 NSC 17111
To appear in:
Neuroscience
Accepted Date:
11 May 2016
Please cite this article as: M. Zhao, Z. Yu, Y. Zhang, X. Huang, J. Hou, Y. Zhao, W. Luo, L. Chen, L. Ou, H. Li, J. Zhang, Iron-induced neuronal damage in a rat model of post-traumatic stress disorder, Neuroscience (2016), doi: http://dx.doi.org/10.1016/j.neuroscience.2016.05.025
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Iron-induced neuronal damage in a rat model of post-traumatic stress disorder Running title: Iron-induced neuronal damage in PTSD
Ming Zhaoa#, Zhibo Yua,b#, Yang Zhanga, Xueling Huangc, Jingming Houd, YanGang Zhao e, Wei Luoa, Lin Chena, Lan Oua, Haitao Li a*, Jiqiang Zhange* a
Department of Radiology， Southwest Hospital， Third Military Medical University，
Chongqing 400038, P. R. China b
Department of Medical Imaging，PLA No.324 Hospital，Chongqing 400020，China
c
Chongqing Three Gorges Medical College, Chongqing, 404100, China
d
Department of Rehabilitation, Southwest Hospital, Third Military Medical University，
Chongqing 400038, P. R. China e
Department of Neurobiology, Chongqing Key Laboratory of Neurobiology, Third Military
Medical University, Chongqing 400038, P. R. China
#
These authors contributed equally to this work
*Corresponding to: Haitao Li, Department of Radiology，Southwest Hospital，Third Military Medical University， Chongqing 400038, P. R. China. Email ：[email protected]; Tel: +8613883818704
Jiqiang Zhang, Department of Neurobiology, Chongqing Key Laboratory of Neurobiology, Third Military Medical University, Chongqing 400038, China. Email: [email protected]; Tel: +8613228686343
1
Abstract Previous studies have shown that iron redistribution and deposition in the brain occurs in some neurodegenerative diseases, and oxidative damage due to abnormal iron level is a primary cause of neuronal death. In the present study, we used the single prolonged stress (SPS) model to mimic post-traumatic stress disorder (PTSD), and examined whether iron was involved in the progression of PTSD. The anxiety-like behaviors of the SPS group were assessed by the elevated plus maze (EPM) and open field tests, and iron levels were measured by inductively coupled plasma optical emission spectrometer (ICP-OES). Expression of glucocorticoid receptors and transferrin receptor 1 (TfR1) and ferritin (Fn) was detected by Western blot and immunohistochemistry in selected brain areas; TfR1 and Fn mRNA expression were detected by Q-PCR. Ultrastructures of the hippocampus were observed under a transmission electron microscope. Our results showed that SPS exposure induced anxiety-like symptoms and increased the level of serum cortisol and the concentration of iron in key brain areas such as the hippocampus, prefrontal cortex, and striatum. The stress induced region-specific changes in both protein and mRNA levels of TfR1 and Fn. Moreover, swelling mitochondria and cell apoptosis were observed in neurons in brain regions with iron accumulation. We concluded that SPS stress increased iron in some cognition-related brain regions and subsequently cause neuronal injury, indicating that the iron may function in the pathology of PTSD. Keywords: post-traumatic stress disorder; cognition; iron; ferritin; transferrin receptor
2
INTRODUCTION Post-traumatic stress disorder (PTSD) is a disabling neuropsychiatric disorder characterized by intrusion of the event, avoidance of reminding it, alterations in cognition and mood, and hyperarousal based on the Diagnostic and Statistical Manual of Mental Disorders (Fifth Edition, DSM-Ⅴ). The overall lifetime prevalence rate of PTSD is approximately 13% of women and 6% of men in the United States, making it one of the most common psychiatric disorders (Spoont et al., 2015). Despite high morbidity associated with PTSD, the pathophysiology of PTSD remains largely unclear. Previous animal studies have shown that abnormalities of the hippocampus, prefrontal cortex, and amygdala may contribute to the pathogenesis of PTSD (Pitman et al., 2012). A recent study indicated that the hippocampus was critical for regulation of stress responses and was especially vulnerable to elevated glucocorticoids (Kim et al., 2015). Prior work has suggested that hippocampal atrophy was affected by the neurotoxicity of excitatory amino acids and intracellular calcium overloading (Gao et al., 2014; Han et al., 2013); However, additional studies are necessary to elucidate changes in other brain areas during the pathogenesis of PTSD. Maintenance of functional activity of the central nervous system requires the participation of many metal ions, and the function of iron is most prominent (Crichton et al., 2011). Although the activity mediated by iron is very important, cells require highly sophisticated and precise regulatory mechanisms due to the high oxidative activity of iron, potentially resulting in cytotoxic effects (Hare et al., 2013). In recent years, many studies have shown the redistribution and deposition of iron in the brains of some neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease and multiple sclerosis (Zhu et al., 2009; Wieler et al., 2015; Hare et al., 2013). Recently, iron accumulation was observed prior to plaque formation in an animal model of AD (Leskovjan et al., 2011). Moreover, gene mutations were discovered in neuroferritinopathy (Curtis et al., 2001). These studies suggest that elevated iron level may be one of the initial factors contributing to neuronal death. Two key components of the iron regulatory system in the brain are transferrin receptor 1 (TfR1) and ferritin (Fn). Studies have shown that iron crosses the blood brain barrier and 3
neuronal cellular membranes primarily through a transferrin receptor-mediated endocytotic mechanism (Hare et al., 2013). Some researchers have found that the high density of TfR1 in the hippocampus and basal ganglia region indicated sensitivity to degeneration in AD (Morris et al., 1994a; Sumbria et al., 2013). TfR1 expression has been reported to change in animal models of PD and is involved in cellular apoptosis (Kalivendi et al., 2003). Fn is a main intracellular protein storing excess iron within its shell, and is considered a pro-oxidant as well as an antioxidant (Arosio et al., 2009). Alterations in levels of Fn have been reported in the brains of subjects with AD and PD, and are associated with neurodegeneration (Grunblatt et al., 2011; Connor et al., 1995). Recently, Fn in mitochondrion was observed to be increased and act as an important protective protein in AD (Gao and Chang, 2014). During oxidative stress, Fn is the main source of iron and reactive oxygen species; However, whether iron, TfR1 and Fn are involved in the progression of PTSD remains unclear. Some studies have recently shown a disorder of iron metabolism in the serum and brains of rats with psychological stress (Wang et al., 2008; Chen et al., 2009; Yu et al., 2011). Notably, the iron level has been shown to be significantly higher in areas of the brain that are very similar to brain regions affected by PTSD, such as the prefrontal cortex, hippocampus, and striatum (Wang et al., 2008). Therefore, we hypothesized that abnormal metabolism of iron in the brain may exist in rats after strong traumatic stress. To address this question, we assessed iron level and iron-related proteins by using a single prolonged stress (SPS)-induced paradigm, which is a reliable model and has been extensively applied in the investigation of PTSD (Wu et al., 2016b; Lee et al., 2016; Yamamoto et al., 2009).
EXPERIMENTAL PROCEDURES Animals and Establishment of SPS Model All animal-related procedures in this study were conducted in strict compliance with approved institutional animal care and use protocols of Third Military Medical University. Specific-pathogen-free (SPF) grade Sprague-Dawley rats were purchased from the Experimental Animal Center of this University, group housed, given free access to water and lab chow, and kept on a 12-hour light/dark cycle. A total of 120 male rats (10-12 weeks age, 200-220 g) were randomly divided into a control group (n=60) or SPS group (n=60). The rat 4
model of PTSD was established by using SPS as determined by international PTSD Scientific Meetings in Japan (Liberzon et al., 1997). The procedure (as indicated in Fig. 1) was as follows: The SPS rats were bound for two hours by using the plastic rigid bound device (diameter: 6 cm, length: 20 cm) and forced swimming was performed for 20 minutes (20 ℃, deep: 50 cm). Next, rats had a rest for 15 minutes and were then anesthetized with ether to a deep coma. Finally, they were placed in their home cages without disturbance for 7 days. The rats in the control group remained in their home cages as routine without any treatment.
Elevated Plus Maze Test On the eighth day, animals from each group (n=10) were placed in the center of the elevated plus maze (Arm length: 50cm, arm width: 10cm, height of baffle plate: 40cm, Height of device: 1.5m) and oriented into one of the open arms. A digital camera was used to record the activity of rats for 5 minutes (min). The percentage (%) of time spent in the open arms and distance travelled during the 5 min were recorded. In addition, the number of entries into the open arms as a percentage (%) of the total number of entries into all arms was recorded and analyzed by a computer.
Open Field Test The animals from each group (n=10) were placed in the central area of the open field (diameter: 100 cm, baffle high: 40 cm) and a digital camera was used to record the rats’ activity over a 15 min period. The site was cleaned by using a cloth with 70% ethanol after each experiment. Activity parameters including movement, distance, and time of each interval were analyzed by a computer. The crossing distance and time in the central area were considered measures of anxiety (Prut and Belzung, 2003).
Enzyme-linked Immunosorbent Assay The rats from each group (n=10) were intraperitoneally injected with 4% chloral hydrate, and blood was collected from the aortaventralis. The samples were placed at room temperature and centrifuged, and then the supernatant liquid was collected. The standard reagent (k7430, Biovine, USA) was diluted as 120 µg/L, 80 µg/L, 40 µg/L, 20 µg/L and 10 5
µg/L, and then 50µL was added to each well along with the serum samples. After incubation for 30 min at 37 ℃, the liquid was removed and washed 5 times. The detection regent (k7430, Biovine) was added in each well to incubate and was then washed again.
Fifty
microliters of substrate solution was added to each well and incubated for 15 min at room temperature, followed by 50 µL of stop solution. The optical density of each well was determined within 15 min by using a microplate reader (iMark, BIO-RAD) set at 450 nm.
Inductively Coupled Plasma Optical Emission Spectrometer (ICP-OES) Samples from the hippocampus, striatum and prefrontal cortex from each group (n=10) were dissected and weighted, diluted to a ratio of 1:20 with HEPES buffer (20 mmoL/L) (weight/volume) and then homogenized. Each sample was mixed with an equal volume of ultrapure nitric acid, digested in a 50 ℃ warm water bath for 48 hours and then diluted by nitrate (3.12 mmol/L) to a ratio of 1:10. The standard iron solution (50 mg/L) was diluted with nitric acid (5%) by 100, 50, 25 and 12.5 times and it was measured on the ICP-OES (Ash IRIS/AP, Thermo Jarell, USA) to draw the standard curved line. The atomic emission spectrometry of iron in the samples was determined by using the ICP-OES with a combination of a charged injection device detector and an axial viewing mode. The data were analyzed and recorded by a computer.
Western Blot Analysis (WB) Bilateral prefrontal cortex, striatum, hippocampus, and cerebellum from the rats in each group (n=5) were dissected individually. A Protein Extract Kit (P0027, Beyotime Biotech, Beijing, P. R. China) was used to isolate protein, and the protein concentration was determined using a BCA Assay Kit (P0010, Beyotime Biotech). Protein samples containing 50 µg were diluted in loading buffer, and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to polyvinylidene fluoride (PVDF) membranes. After being blocked the blots were washed with TBST and incubated in a solution of rabbit polyclonal anti-glucocorticoid receptor antibody (1:500; ab3578, Abcam, San Francisco, USA), mouse monoclonal anti-transferrin receptor antibody (1:500; ab1086, Abcam), and rabbit monoclonal anti-ferritin antibody (1:500; ab75973, Abcam) at 4 °C 6
overnight. Next, the blots were washed with the TBST 3 times and incubated with biotin-labeled anti-rabbit antibody (1:2000; ZB2301, Zhongshan Biotech, Beijing, P. R. China) and biotin-labeled anti-mouse antibody (1:2000; ZB2305, Zhongshan Biotech) for 90 min at 37 ℃. Monoclonal anti-β-actin antibody (1:1000; AA128, Zhongshan Biotech) was used as an internal standard. The blots were washed again and detected by the chemiluminescence ECL Western blotting system. Quantity One software was applied to analyze the relative optical density.
Immunohistochemistry (IHC) After intraperitoneal 4% chloral hydrate (1 ml/kg) solution, animals from each group (n=4) were perfused with 200 mL 0.9% saline, followed by 400 mL 4% paraformaldehyde in phosphate buffer (pH 7.4). The brains was carefully dissected, removed, post-fixed, and then transferred to 30% sucrose for dehydration for a week. The brains were cut frozen into 30-µm-thick coronal sections with every sixth section being placed in the same well. The sections were washed and quenched for 15 min in 3% H2O2, and then incubated overnight at 4°C with the rabbit polyclonal anti-glucocorticoid receptor antibody (1:200, ab3578, Abcam, USA), mouse monoclonal anti-transferritin receptor antibody (1:200; ab1086, Abcam) and rabbit monoclonal anti-ferritin antibody (1:200; ab75973, Abcam) diluted with antibody diluent (ZLI-9028; Zhongshan Biotech). Next, they were incubated with biotinylated secondary goat anti-rabbit IgG (1:200; ZB2010, Zhongshan Biotech) and biotin-labelled horse anti-mouse IgG (1:200; ZB2020, Zhongshan Biotech) for 1 h. After being washed in PBS 3 times, the sections were incubated in horseradish peroxidase (HRP)-labeled streptavidin reagent (1:200; ZB2404, Zhongshan Biotech) for 1 h at room temperature and then stained with a DAB kit (SK-4100; VECTOR) for 5 min. Finally, the sections were dehydrated and mounted. Five sections of the hippocampus between plates 54 (Bregma –2.52) and 59 (Bregma –3.12) were used to represent the region of expression in each brain. Images were taken using an Olympus microscope (DX60, Olympus, Japan) with a Leica digital camera (DP70, Leica, Germany). The average optical density of IHC was measured by Image Pro Plus software 6.0. 7
Q- PCR Analysis (Q-PCR) The hippocampi were separated from each group (n=4) and were homogenized under liquid nitrogen, and the total RNA was extracted by TRIzol (Invitrogen) reagent according to the manufacturer’s protocol. One thousand nanograms per sample was traversed to cDNA by a transcription kit (Invitrogen, superscript III) according to the manufacturer’s instructions. Primers
were
designed
as
follow:
5-GTGAATGCAATGGAGTGTGC-3;
Primer
Forward
Reverse
5-TCTTGCGTAAGTAAGTTGGTCACG-3; CGGCCTATATGCTTGGGTAGGA; R:
Fn
Tfr1:
(F): (R):
Primer
F:
TATGACAATGGCTCCCCTCCA. GAPDH:
Primer F: 5-GTTACCAGGGCTGCCTTCTC-3; R: 5-GGGTTTCCCGTTGATGACC-3. The PCR system was operated at 95 ℃ for 2 min, 40 cycles of 94 ℃ for 20 seconds (sec), 65 ℃ for 20 sec, and 72 ℃ for 30 sec. The Q-RT-PCR data were then recorded and analyzed by using the 2 -△△Ct method (Livak and Schmittgen, 2001).
Hematoxylin & eosin (H&E) staining and transmission electron microscopic observations The hippocampus, frontal cortex and striatum were dissected individually for HE staining (n=3). A 5-µm-thick paraffin section was prepared and stained with hematoxylin for 15 min after being dewaxed by xylene. The section was then screened with 1% hydrochloric acid alcohol under a microscope, washed by distilled water for 30 sec and then stained with 5% eosin for 3 min. The sections were washed and mounted with resinene. They were finally observed and recorded under an Olympus microscope (DX60, Olympus, Japan) with a Leica digital camera (DP70, Leica, Germany). The hippocampal tissue from the two group (n=4) was trimmed at a size of 1 mm × 1 mm square and stored in a1.5 mL EP tube. Tissue was then fixed in 2.5% glutaraldehyde for 2h at 4 ℃ and immersed in 1 % osmium tetroxide for 30 min. After being washed by PBS, the fixed tissues were dehydrated by acetone and then embedded. 1-nm-thick sections were stained with methylene blue for 30 sec at 60 ℃, washed with distilled water and then stained with 0.25% sodium borate and 0.5% basic fuchsin for 10 sec. 50-nm-thick sections were stained with uranyl acetate and citric acid lead, and then observed under a transmission 8
electron microscope.
Statistical Analysis The measurement data were collected as previously described. All results were evaluated by SPSS13.0 software and describe as mean ± SE and the median（P25,P75). Non-paired t-tests and non-parametric tests were applied according to the distribution form of the data in the experiment and a level of p < 0.05 was considered statistically significant.
RESULTS SPS exposure induced anxiety-like symptoms The results of the EPM behavioral analysis are shown in Figure 1. Compared with the control group, the SPS paradigm dramatically decreased the percentage of open arm time by 49% (p < 0.05, independent samples T test). The corresponding percentage of distance was decreased by 30.2% (p < 0.05, independent samples T test), and the percent of entries was reduced by 36.5% (p < 0.05, independent samples T test). The open field test showed a significant decrease in central time (decreased by 61.3%), and an accompanying distance was decreased of 66.1% (Fig. 1) in the SPS group (p < 0.05, independent samples T test).
SPS exposure increased the level of the serum cortisol Our results show that the level of serum cortisol in the control group was about 12.5 (12.2; 12.8) µg/L and about 26.1(20.9; 27.3) µg/L in the SPS group, which reflect the state of stress in the rats. The level of cortisol in the SPS group was approximately 2.1-fold higher than that of the controls (p < 0.05, non-parametric test).
SPS exposure increased the concentrations of iron in the brain In order to test whether iron content was altered by the SPS paradigm, we examined iron content in the hippocampus, frontal cortex, and striatum with an ICP-OES method. Our results demonstrated that iron accumulated in the brain areas after acute stress (p < 0.05, independent samples T test). In the SPS group, levels of iron were increased by 3.1 fold in the hippocampus. Iron accumulation in the prefrontal cortex and striatum in the SPS paradigm 9
was increased by 2.5-fold and 3.4-fold, respectively, compared with the control group (Fig. 1).
SPS exposure caused region-specific changes in TfR1 expression The results of Western blot analysis of TfR1 protein were shown in Figure 2. Our results showed that differences were evident in the hippocampus and prefrontal cortex (p<0.05, independent samples T test). TfR1 immunoreactivity in the hippocampus was decreased by 38.6% in the SPS group. The expression of TfR1 was increased by 38.9% in the prefrontal cortex. However, the results of Western blot analysis showed no significant difference in the striatum or cerebellum compared with the controls (p > 0.05, independent samples T test; Fig. 2).
SPS exposure caused region-specific changes of Fn expression Western blot analysis of Fn expression showed a decreased trend, similar to TfR1 in the hippocampus, and the expression of Fn was decreased by 43.5% in the SPS group compared with the control (p<0.05, independent samples T test). Immunoreactivity of ferritin in the striatum was increased by 29.4% of the SPS-exposed rats. There were no obvious differences in expression within the prefrontal cortex or cerebellum (p > 0.05, independent samples T test; Fig. 3).
SPS exposure changed the GR, TfR1, and Fn expression in the hippocampus Results of the IHC analysis of GR in the hippocampus showed that positive immunoreactivity was localized in the cytoplasm of pyramidal and Purkinje neurons (Fig. 4). Glucocorticoid receptor (GR) immunoreactivity in the SPS-exposed group was increased by 22.0% (Table1). IHC analysis of TfR1 and Fn showed results similar to the Western blot analysis. TfR1 was distributed mainly in large pyramidal neurons and located mainly on the membrane (Fig. 4), as described previously (Dickinson and Connor, 1998). TfR1 immunoreactivity in the SPS-exposed group was decreased by 26.1% (Table1) as compared with the control. Fn was obviously located in the cytoplasm and nucleus of the pyramidal neurons in the hippocampus of the SPS group (Fig. 4), but was decreased by 20.6% compared 10
with the control group (Table1). The expression of the three proteins in hippocampal neurons was significantly different (p < 0.05, non-parametric test; Table 1).
SPS exposure decreased the expression of Fn and TfR1mRNA in the hippocampus Q-PCR results showed that Fn mRNA level in the control group were about 2.05±2.85 and 0.260±0.302 in the SPS group which reflected a significant decrease of 87.4% (p < 0.05, independent samples T test). TfR1 mRNA levels were significantly inhibited by 41.6% (4.66±1.71 vs 2.72±0.504, p < 0.05, independent samples T test).
SPS exposure induce morphology changes of cells in the brain Compared with the control group, the SPS group showed more injured cells in the hippocampus, prefrontal cortex and
striatum,
which showed
heterogeneous and
hyperchromatic neurons (Fig. 5). The neurons in the hippocampus of the SPS group, observed under the transmission electron microscope, showed marked swelling of the mitochondria, crista degranulation, and cell apoptosis in the SPS group (Fig. 5).
DISCUSSION To our knowledge, this is the first report that abnormal iron metabolism involving in the brain injury in the SPS rat model. Our results demonstrated the following: (1) the SPS model led to behavioral changes as compared with the control animals; (2) the serum cortisol level and GR immunoreactivity in the hippocampus was increased after stress; (3) iron was accumulated in brain areas such as the hippocampus, prefrontal cortex, and striatum of SPS rats; (4) cells showed region-specific reaction to iron deposition, and mRNA expression of TfR1 and Fn in the hippocampus was decreased in SPS rats; (5) and by morphological observation, the neurons were injured in the areas of iron accumulation. Among various animal models of PTSD, the SPS model has been validated to mimic the pathophysiological abnormalities and behavioral characteristics of PTSD, such as enhanced anxiety-like behavior, elevated glucocorticoid negative feedback, and exaggerated acoustic startle response (Yamamoto et al., 2009; Wu et al., 2016a). Furthermore, studies have shown that the SPS model was well-established for investigation of abnormal metabolism of the 11
nervous system (Yamamoto et al., 2008; Lee et al., 2016). Our results showed that the rats had a higher degree of anxiety and fear in both behavioral tests, which was consistent with a previous study (Gao et al., 2014). Cortisol is the most representative hormone in response to stress. A study showed that injection of glucocorticoids into the hippocampus induced PTSD-like memory impairments in mice, which emphasized the importance of this hormone involved in the pathology of PTSD (Kaouane et al., 2012). In our study, the serum cortisol level and GR immunoreactivity in the hippocampus were markedly increased, which was in agreement with previous findings (Ganon-Elazar and Akirav, 2013; Liberzon et al., 1999). As hippocampal glucocorticoid receptors function in glucocorticoid negative feedback regulation, all these data suggest that changes in the expression of GR may represent the primary level of dysfunction in glucocorticoid signaling. Combined with behavioral evidence, our data may indicate the rats in the morbid state were affected by severe stress and can simulate the conditions of PTSD patients to some extent (van Zuiden et al., 2012). Iron is the essential coenzyme responsible for oxygen transportation in mitochondrial respiration metabolism (Beard, 2001). Iron is also very important for brain cell activities but has highly oxidizing activity producing reactive free radical species such as the hydroxyl radical (OH) reported by the Fenton and Haber–Weiss reaction (Kehrer, 2000; Liochev, 1999). Previous animal studies suggested that systemic iron status in mammals may be altered during different kinds of physiological stress such as swimming, aerobic exercise and surgical trauma (Konig et al., 1998; Lukaski et al., 1990; Nikolova-Todorova and Troic, 2003; Lyle et al., 1992). Recent studies have shown that both psychological and somatic stress can lead to increase brain iron content in some brain regions (Wang et al., 2008; An et al., 2013; Ma et al., 2008). By using the highly sensitive ICP-OES method, our data clearly showed iron accumulation in the hippocampus, prefrontal cortex, and striatum after the SPS stress and may do harm to the neurons in these areas. With respect to emotional behaviors, previous research has shown that iron overload could induce anxiety-like behaviors and mood disorder (Maaroufi et al., 2009), which were corroborated in our tests. These findings support the idea that imbalanced iron metabolism functions in modulating anxiety and emotional behaviors (Kim and Wessling-Resnick, 2014). Recent studies have indicated that iron accumulation, even in trace amounts, can result in the 12
Fenton reaction (Alexandrov et al., 2005) and leads to cell apoptosis through lipid peroxidation (Zhang et al., 2003). In fact, we observed significant heterogeneous and hyperchromatic neurons in the three brain regions when compared with the control group. On the other hand, by using the transmission electron microscope, we found that hippocampal neurons showed marked mitochondrial swelling and cell apoptosis in the SPS animals, suggesting that iron is an important factor leading to neuronal injury. Normal physiological function has a stringent regulatory mechanism to guarantee the net turnover of dietary iron, which primarily depends on TfR1 and Fn (Hare et al., 2013). In our study, TfR1 was decreased in the hippocampus, which is in agreement with some previous reports showing iron deposition in neurodegenerative diseases such as AD and PD (Morris et al., 1994a; Crespo et al., 2014; Morris et al., 1994b). Fn is a main intracellular protein that stores excess iron, and is considered a pro-oxidant as well as an antioxidant (Arosio et al., 2009). Our study demonstrated that Fn was decreased in the hippocampus. Similar results were reported in a recent study of Fn transcript investigated in PD brains (Faucheux et al., 2002). The down-regulation of TfR1 suggests increased levels of free iron in this region (Hare et al., 2013). Furthermore, we hypothesized that decreased ferritin may result in subsequent cellular free iron accumulation which aggravates neuronal damage, eventually leading to apoptosis. There is a significant increase in ferritin in the striatum, which could potentially lead to a net reduction in the level of free iron. A deficit in bioavailable iron would activate microglia to damage the neurons through inflammation (Block et al., 2007). Our finding suggested that TfR1 may be increased in the prefrontal cortex inducing excess iron endocytosis, which could lead to cytotoxicity. The heterogeneity between these areas may be a reflection of differences in the regional susceptibility of iron accumulation and the hippocampus may be the most vulnerable area (Erikson et al., 1997; Ke and Gibson, 2004). When intracellular iron is accumulated, the iron regulatory proteins (IRP) regulate protein is expressed through the iron responsive element (IRE) binding, leading to the elevated TfR1 and consequently, decreasing ferritin expression (Kuhn, 2015). Our data showed that TfR1 and FnmRNA in the hippocampus were significantly decreased, and demonstrated the stress affects iron metabolism at the genome level. Because the expression of both ferritin and TfR1 is controlled by this same mechanism, and both ferritin and TfR1 were decreased, this 13
suggests that these two key homeostatic proteins are influenced by more than just iron bioavailability (Cairo et al., 1998). An alternative explanation for the apparently paradoxical alterations in ferritin and TfR1 in the hippocampus involves the stress hormone glucocorticoids (GCs) and nitricoxide synthase (NOS), which has been demonstrated in other cell experiments (data not shown, not published). Since we just conducted a preliminary experiment to test whether iron may be a high risk factor in the SPS model, it is unclear whether iron accumulation is a causative factor or a result of the disease process itself. Additional studies, such as in vivo injection of deferoxamine to observe animal behavior, will be very helpful to demonstrate the exact role of iron accumulation in this model. I would be necessary to examine the roles of other iron proteins such as iron regulated protein (IRP), divalent metal transporter-1 (DMT1) and ferroportin (FpN) in our future study.
CONCLUSIONS In summary, this study indicated that iron was involved in the brain injury in the PTSD model, suggesting that iron may be a potential candidate for therapeutic interventions targeting PTSD.
ACKNOWLEDGEMENTS The authors want to thank the editors of Medjaden Bioscience, who edited and proofread this manuscript. Jiqiang Zhang and Haitao Li designed the study. Ming Zhao and Zhibo Yu conducted all searches, Jingming Hou appraised all potential studies and Ming Zhao wrote the draft manuscript and subsequent manuscripts. Yang Zhang, Xueling Huang, Jingming Hou and Luo Wei assisted with searches. Wei Luo carried out the cytology experiment. Lin Chen and Lan Ou assisted with the presentation of findings. Jiqiang Zhang and Haitao Li assisted with revising the manuscript. All authors read and approved the final manuscript.
Funding This work was supported predominantly by the National Nature Science Foundation of China 14
No. 81171283 and No. 81301679, and in part by Funds for Young Scientists of Southwest Hospital No 291289554.
Conflict of interest None
15
References Alexandrov PN, Zhao Y, Pogue AI, Tarr MA, Kruck TP, Percy ME, Cui JG, Lukiw WJ (2005) Synergistic effects of iron and aluminum on stress-related gene expression in primary human neural cells. J Alzheimers Dis 8:117-127; discussion 209-115. An LN, Yue Y, Guo WZ, Miao YL, Mi WD, Zhang H, Lei ZL, Han SJ, Dong L (2013) Surgical trauma induces iron accumulation and oxidative stress in a rodent model of postoperative cognitive dysfunction. Biol Trace Elem Res 151:277-283. Arosio P, Ingrassia R, Cavadini P (2009) Ferritins: a family of molecules for iron storage, antioxidation and more. Biochim Biophys Acta 1790:589-599. Beard JL (2001) Iron biology in immune function, muscle metabolism and neuronal functioning. J Nutr 131:568S-579S; discussion 580S. Block ML, Zecca L, Hong JS (2007) Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 8:57-69. Cairo G, Tacchini L, Pietrangelo A (1998) Lack of coordinate control of ferritin and transferrin receptor expression during rat liver regeneration. Hepatology 28:173-178. Chen J, Shen H, Chen C, Wang W, Yu S, Zhao M, Li M (2009) The effect of psychological stress on iron absorption in rats. BMC Gastroenterol 9:83. Connor JR, Snyder BS, Arosio P, Loeffler DA, LeWitt P (1995) A quantitative analysis of isoferritins in select regions of aged, parkinsonian, and Alzheimer's diseased brains. J Neurochem 65:717-724. Crespo AC, Silva B, Marques L, Marcelino E, Maruta C, Costa S, Timoteo A, Vilares A, Couto FS, Faustino P, Correia AP, Verdelho A, Porto G, Guerreiro M, Herrero A, Costa C, de Mendonca A, Costa L, Martins M (2014) Genetic and biochemical markers in patients with Alzheimer's disease support a concerted systemic iron homeostasis dysregulation. Neurobiol Aging 35:777-785. Crichton RR, Dexter DT, Ward RJ (2011) Brain iron metabolism and its perturbation in neurological diseases. J Neural Transm (Vienna) 118:301-314. Curtis AR, Fey C, Morris CM, Bindoff LA, Ince PG, Chinnery PF, Coulthard A, Jackson MJ, Jackson AP, McHale DP, Hay D, Barker WA, Markham AF, Bates D, Curtis A, Burn J (2001) Mutation in the gene encoding ferritin light polypeptide causes dominant 16
adult-onset basal ganglia disease. Nat Genet 28:350-354. Dickinson TK, Connor JR (1998) Immunohistochemical analysis of transferrin receptor: regional and cellular distribution in the hypotransferrinemic (hpx) mouse brain. Brain Res 801:171-181. Erikson KM, Pinero DJ, Connor JR, Beard JL (1997) Regional brain iron, ferritin and transferrin concentrations during iron deficiency and iron repletion in developing rats. J Nutr 127:2030-2038. Faucheux BA, Martin ME, Beaumont C, Hunot S, Hauw JJ, Agid Y, Hirsch EC (2002) Lack of up-regulation of ferritin is associated with sustained iron regulatory protein-1 binding activity in the substantia nigra of patients with Parkinson's disease. J Neurochem 83:320-330. Ganon-Elazar E, Akirav I (2013) Cannabinoids and traumatic stress modulation of contextual fear extinction and GR expression in the amygdala-hippocampal-prefrontal circuit. Psychoneuroendocrinology 38:1675-1687. Gao G, Chang YZ (2014) Mitochondrial ferritin in the regulation of brain iron homeostasis and neurodegenerative diseases. Front Pharmacol 5:19. Gao J, Wang H, Liu Y, Li YY, Chen C, Liu LM, Wu YM, Li S, Yang C (2014) Glutamate and GABA imbalance promotes neuronal apoptosis in hippocampus after stress. Med Sci Monit 20:499-512. Grunblatt E, Bartl J, Riederer P (2011) The link between iron, metabolic syndrome, and Alzheimer's disease. J Neural Transm (Vienna) 118:371-379. Han F, Yan S, Shi Y (2013) Single-prolonged stress induces endoplasmic reticulum-dependent apoptosis in the hippocampus in a rat model of post-traumatic stress disorder. PLoS One 8:e69340. Hare D, Ayton S, Bush A, Lei P (2013) A delicate balance: Iron metabolism and diseases of the brain. Front Aging Neurosci 5:34. Kalivendi SV, Kotamraju S, Cunningham S, Shang T, Hillard CJ, Kalyanaraman B (2003) 1-Methyl-4-phenylpyridinium (MPP+)-induced apoptosis and mitochondrial oxidant generation: role of transferrin-receptor-dependent iron and hydrogen peroxide. Biochem J 371:151-164. 17
Kaouane N, Porte Y, Vallee M, Brayda-Bruno L, Mons N, Calandreau L, Marighetto A, Piazza PV, Desmedt A (2012) Glucocorticoids can induce PTSD-like memory impairments in mice. Science 335:1510-1513. Ke ZJ, Gibson GE (2004) Selective response of various brain cell types during neurodegeneration induced by mild impairment of oxidative metabolism. Neurochem Int 45:361-369. Kehrer JP (2000) The Haber-Weiss reaction and mechanisms of toxicity. Toxicology 149:43-50. Kim EJ, Pellman B, Kim JJ (2015) Stress effects on the hippocampus: a critical review. Learn Mem 22:411-416. Kim J, Wessling-Resnick M (2014) Iron and mechanisms of emotional behavior. J Nutr Biochem 25:1101-1107. Konig D, Weinstock C, Keul J, Northoff H, Berg A (1998) Zinc, iron, and magnesium status in athletes--influence on the regulation of exercise-induced stress and immune function. Exerc Immunol Rev 4:2-21. Kuhn LC (2015) Iron regulatory proteins and their role in controlling iron metabolism. Metallomics 7:232-243. Lee B, Sur B, Cho SG, Yeom M, Shim I, Lee H, Hahm DH (2016) Ginsenoside Rb1 rescues anxiety-like responses in a rat model of post-traumatic stress disorder. J Nat Med 70:133-144. Leskovjan AC, Kretlow A, Lanzirotti A, Barrea R, Vogt S, Miller LM (2011) Increased brain iron coincides with early plaque formation in a mouse model of Alzheimer's disease. Neuroimage 55:32-38. Liberzon I, Krstov M, Young EA (1997) Stress-restress: effects on ACTH and fast feedback. Psychoneuroendocrinology 22:443-453. Liberzon I, Lopez JF, Flagel SB, Vazquez DM, Young EA (1999) Differential regulation of hippocampal glucocorticoid receptors mRNA and fast feedback: relevance to post-traumatic stress disorder. J Neuroendocrinol 11:11-17. Liochev SI (1999) The mechanism of "Fenton-like" reactions and their importance for biological systems. A biologist's view. Met Ions Biol Syst 36:1-39. 18
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. Lukaski HC, Hoverson BS, Gallagher SK, Bolonchuk WW (1990) Physical training and copper, iron, and zinc status of swimmers. Am J Clin Nutr 51:1093-1099. Lyle RM, Weaver CM, Sedlock DA, Rajaram S, Martin B, Melby CL (1992) Iron status in exercising women: the effect of oral iron therapy vs increased consumption of muscle foods. Am J Clin Nutr 56:1049-1055. Ma L, Wang W, Zhao M, Li M (2008) Foot-shock stress-induced regional iron accumulation and altered iron homeostatic mechanisms in rat brain. Biol Trace Elem Res 126:204-213. Maaroufi K, Ammari M, Jeljeli M, Roy V, Sakly M, Abdelmelek H (2009) Impairment of emotional behavior and spatial learning in adult Wistar rats by ferrous sulfate. Physiol Behav 96:343-349. Morris CM, Candy JM, Kerwin JM, Edwardson JA (1994a) Transferrin receptors in the normal human hippocampus and in Alzheimer's disease. Neuropathol Appl Neurobiol 20:473-477. Morris CM, Candy JM, Omar S, Bloxham CA, Edwardson JA (1994b) Transferrin receptors in the parkinsonian midbrain. Neuropathol Appl Neurobiol 20:468-472. Nikolova-Todorova Z, Troic T (2003) [Effect of surgical trauma on patient nutritional status]. Med Arh 57:29-31. Pitman RK, Rasmusson AM, Koenen KC, Shin LM, Orr SP, Gilbertson MW, Milad MR, Liberzon I (2012) Biological studies of post-traumatic stress disorder. Nat Rev Neurosci 13:769-787. Prut L, Belzung C (2003) The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharmacol 463:3-33. Spoont MR, Williams JW, Jr., Kehle-Forbes S, Nieuwsma JA, Mann-Wrobel MC, Gross R (2015) Does This Patient Have Posttraumatic Stress Disorder?: Rational Clinical Examination Systematic Review. JAMA 314:501-510. Sumbria RK, Hui EK, Lu JZ, Boado RJ, Pardridge WM (2013) Disaggregation of amyloid plaque in brain of Alzheimer's disease transgenic mice with daily subcutaneous 19
administration of a tetravalent bispecific antibody that targets the transferrin receptor and the Abeta amyloid peptide. Mol Pharm 10:3507-3513. van Zuiden M, Geuze E, Willemen HL, Vermetten E, Maas M, Amarouchi K, Kavelaars A, Heijnen CJ (2012) Glucocorticoid receptor pathway components predict posttraumatic stress disorder symptom development: a prospective study. Biol Psychiatry 71:309-316. Wang L, Wang W, Zhao M, Ma L, Li M (2008) Psychological stress induces dysregulation of iron metabolism in rat brain. Neuroscience 155:24-30. Wieler M, Gee M, Martin WR (2015) Longitudinal midbrain changes in early Parkinson's disease: iron content estimated from R2*/MRI. Parkinsonism Relat Disord 21:179-183. Wu Z, Tian Q, Li F, Gao J, Liu Y, Mao M, Liu J, Wang S, Li G, Ge D, Mao Y, Zhang W, Liu Z, Song Y (2016a) Behavioral changes over time in post-traumatic stress disorder: Insights from a rat model of single prolonged stress. Behav Processes 124:123-129. Wu ZM, Zheng CH, Zhu ZH, Wu FT, Ni GL, Liang Y (2016b) SiRNA-mediated serotonin transporter knockdown in the dorsal raphe nucleus rescues single prolonged stress-induced hippocampal autophagy in rats. J Neurol Sci 360:133-140. Yamamoto S, Morinobu S, Fuchikami M, Kurata A, Kozuru T, Yamawaki S (2008) Effects of single prolonged stress and D-cycloserine on contextual fear extinction and hippocampal NMDA receptor expression in a rat model of PTSD. Neuropsychopharmacology 33:2108-2116. Yamamoto S, Morinobu S, Takei S, Fuchikami M, Matsuki A, Yamawaki S, Liberzon I (2009) Single prolonged stress: toward an animal model of posttraumatic stress disorder. Depress Anxiety 26:1110-1117. Yu S, Feng Y, Shen Z, Li M (2011) Diet supplementation with iron augments brain oxidative stress status in a rat model of psychological stress. Nutrition 27:1048-1052. Zhang Z, Wei T, Hou J, Li G, Yu S, Xin W (2003) Iron-induced oxidative damage and apoptosis in cerebellar granule cells: attenuation by tetramethylpyrazine and ferulic acid. Eur J Pharmacol 467:41-47. Zhu WZ, Zhong WD, Wang W, Zhan CJ, Wang CY, Qi JP, Wang JZ, Lei T (2009) 20
Quantitative MR phase-corrected imaging to investigate increased brain iron deposition of patients with Alzheimer disease. Radiology 253:497-504.
21
Figure legends Figure 1. Behavioral changes in the SPS model and altered brain iron content. A diagrammatic representation of the SPS paradigm. The SPS model involves serial stressors including restraint, forced swim, and anesthetization by ether, followed by a week no touching period. B-D: The data of the elevated plus maze test (EPM) are shown. The open arm time (B), open arm distance (C), and open arm entries (D) of the SPS group showed significant decreases using the independent samples T test. Data are expressed as the mean ± S.E.M (*: p<0.05). E and F: The data of the open field tests are shown. The central area time (E) and central distance (F) of the SPS group decreased significantly compared with the control group (*: p<0.05). G: The iron content in different brain areas by using the ICP-OES. PFC: prefrontal cortex; Str: striatum; Hip: hippocampus. The results showed that iron accumulated in these three areas in the SPS group compared with the control group (*:p<0.05). Figure 2. Transferrin receptor1 (TfR1) as shown by Western blot analysis (WB) in brain regions. PFC: prefrontal cortex. Str: striatum. Hip: hippocampus. Cer: cerebellum. The results showed TfR1 immunoreactivity in the hippocampus was decreased, and the expression of TfR1 was increased in the prefrontal cortex significantly in the SPS group (Results are expressed as the mean ± S.E.M. *:p < 0.05; independent samples T test). Results of Western blot analysis showed no significant difference in the striatum or cerebellum compared with the controls (p > 0.05; independent samples T test). Figure 3. Ferritin (Fn) as shown by Western blot analysis (WB) in brain regions. PFC: prefrontal cortex. Str: striatum. Hip: hippocampus. Cer: cerebellum. Fn expression showed a decreasing trend, and immunoreactivity of ferritin in the striatum was increased in the SPS group compared with control (p<0.05, independent samples T test). There was no obvious difference in expression between the prefrontal cortex and cerebellum (p > 0.05, independent samples T test). Figure 4. Immunohistochemistry (IHC) detected the expression of glucocorticoid receptor (GR), transferrin receptor (TfR1), and Ferritin (Fn) in the hippocampus. Glucocorticoid receptor (GR) immunoreactivity in the SPS-exposed group was increased significantly, and both the TfR1 and Fn immunoreactivity in the SPS-exposed group was decreased compared 22
with the control according to non-parametric tests. Figure 5. Morphology of cells observed by the H&E staining and transmission electron microscope. A and B: staining of the prefrontal cortex. C and D: staining of the hippocampus. E and F: staining of the striatum. B, D and F show that there are more heterogeneous and hyperchromatic neurons in these three areas in the SPS group compared with the control group. H and J show normal neurons as detected by the transmission electron microscope. I shows the marked swelling of mitochondria and crista degranulation in the neurons of the SPS group. K shows cell apoptosis in the SPS group.
23
Table 1 Immunohistochemistry (IHC) Results (n=4) CON
PTSD
GR in hippocampus
0.309(0.291;0.337)
0.376(0.374;0.410)*
TfR1 in hippocampus
0.474 (0.459;0.481)
0.350(0.303;0.367)*
Fn in hippocampus
0.28(0.277;0.292)
0.222(0.216;0.246)*
Data are described as the median (P25, P75), *: p<0.05, when compared to the control; Nonparametric test.
24
25
26
27
28
29
Highlights •
SPS is a model which induced anxiety-like symptoms and increased GR in
hippocampus. •
Iron was increased in the hippocampus, prefrontal cortex and striatum after stress.
•
Cells showed region-specific reaction to iron deposition.
•
The neurons were injured in the areas of iron accumulation.
30
S0306-4522(16)30174-9 http://dx.doi.org/10.1016/j.neuroscience.2016.05.025 NSC 17111
To appear in:
Neuroscience
Accepted Date:
11 May 2016
Please cite this article as: M. Zhao, Z. Yu, Y. Zhang, X. Huang, J. Hou, Y. Zhao, W. Luo, L. Chen, L. Ou, H. Li, J. Zhang, Iron-induced neuronal damage in a rat model of post-traumatic stress disorder, Neuroscience (2016), doi: http://dx.doi.org/10.1016/j.neuroscience.2016.05.025
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Iron-induced neuronal damage in a rat model of post-traumatic stress disorder Running title: Iron-induced neuronal damage in PTSD
Ming Zhaoa#, Zhibo Yua,b#, Yang Zhanga, Xueling Huangc, Jingming Houd, YanGang Zhao e, Wei Luoa, Lin Chena, Lan Oua, Haitao Li a*, Jiqiang Zhange* a
Department of Radiology， Southwest Hospital， Third Military Medical University，
Chongqing 400038, P. R. China b
Department of Medical Imaging，PLA No.324 Hospital，Chongqing 400020，China
c
Chongqing Three Gorges Medical College, Chongqing, 404100, China
d
Department of Rehabilitation, Southwest Hospital, Third Military Medical University，
Chongqing 400038, P. R. China e
Department of Neurobiology, Chongqing Key Laboratory of Neurobiology, Third Military
Medical University, Chongqing 400038, P. R. China
#
These authors contributed equally to this work
*Corresponding to: Haitao Li, Department of Radiology，Southwest Hospital，Third Military Medical University， Chongqing 400038, P. R. China. Email ：[email protected]; Tel: +8613883818704
Jiqiang Zhang, Department of Neurobiology, Chongqing Key Laboratory of Neurobiology, Third Military Medical University, Chongqing 400038, China. Email: [email protected]; Tel: +8613228686343
1
Abstract Previous studies have shown that iron redistribution and deposition in the brain occurs in some neurodegenerative diseases, and oxidative damage due to abnormal iron level is a primary cause of neuronal death. In the present study, we used the single prolonged stress (SPS) model to mimic post-traumatic stress disorder (PTSD), and examined whether iron was involved in the progression of PTSD. The anxiety-like behaviors of the SPS group were assessed by the elevated plus maze (EPM) and open field tests, and iron levels were measured by inductively coupled plasma optical emission spectrometer (ICP-OES). Expression of glucocorticoid receptors and transferrin receptor 1 (TfR1) and ferritin (Fn) was detected by Western blot and immunohistochemistry in selected brain areas; TfR1 and Fn mRNA expression were detected by Q-PCR. Ultrastructures of the hippocampus were observed under a transmission electron microscope. Our results showed that SPS exposure induced anxiety-like symptoms and increased the level of serum cortisol and the concentration of iron in key brain areas such as the hippocampus, prefrontal cortex, and striatum. The stress induced region-specific changes in both protein and mRNA levels of TfR1 and Fn. Moreover, swelling mitochondria and cell apoptosis were observed in neurons in brain regions with iron accumulation. We concluded that SPS stress increased iron in some cognition-related brain regions and subsequently cause neuronal injury, indicating that the iron may function in the pathology of PTSD. Keywords: post-traumatic stress disorder; cognition; iron; ferritin; transferrin receptor
2
INTRODUCTION Post-traumatic stress disorder (PTSD) is a disabling neuropsychiatric disorder characterized by intrusion of the event, avoidance of reminding it, alterations in cognition and mood, and hyperarousal based on the Diagnostic and Statistical Manual of Mental Disorders (Fifth Edition, DSM-Ⅴ). The overall lifetime prevalence rate of PTSD is approximately 13% of women and 6% of men in the United States, making it one of the most common psychiatric disorders (Spoont et al., 2015). Despite high morbidity associated with PTSD, the pathophysiology of PTSD remains largely unclear. Previous animal studies have shown that abnormalities of the hippocampus, prefrontal cortex, and amygdala may contribute to the pathogenesis of PTSD (Pitman et al., 2012). A recent study indicated that the hippocampus was critical for regulation of stress responses and was especially vulnerable to elevated glucocorticoids (Kim et al., 2015). Prior work has suggested that hippocampal atrophy was affected by the neurotoxicity of excitatory amino acids and intracellular calcium overloading (Gao et al., 2014; Han et al., 2013); However, additional studies are necessary to elucidate changes in other brain areas during the pathogenesis of PTSD. Maintenance of functional activity of the central nervous system requires the participation of many metal ions, and the function of iron is most prominent (Crichton et al., 2011). Although the activity mediated by iron is very important, cells require highly sophisticated and precise regulatory mechanisms due to the high oxidative activity of iron, potentially resulting in cytotoxic effects (Hare et al., 2013). In recent years, many studies have shown the redistribution and deposition of iron in the brains of some neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease and multiple sclerosis (Zhu et al., 2009; Wieler et al., 2015; Hare et al., 2013). Recently, iron accumulation was observed prior to plaque formation in an animal model of AD (Leskovjan et al., 2011). Moreover, gene mutations were discovered in neuroferritinopathy (Curtis et al., 2001). These studies suggest that elevated iron level may be one of the initial factors contributing to neuronal death. Two key components of the iron regulatory system in the brain are transferrin receptor 1 (TfR1) and ferritin (Fn). Studies have shown that iron crosses the blood brain barrier and 3
neuronal cellular membranes primarily through a transferrin receptor-mediated endocytotic mechanism (Hare et al., 2013). Some researchers have found that the high density of TfR1 in the hippocampus and basal ganglia region indicated sensitivity to degeneration in AD (Morris et al., 1994a; Sumbria et al., 2013). TfR1 expression has been reported to change in animal models of PD and is involved in cellular apoptosis (Kalivendi et al., 2003). Fn is a main intracellular protein storing excess iron within its shell, and is considered a pro-oxidant as well as an antioxidant (Arosio et al., 2009). Alterations in levels of Fn have been reported in the brains of subjects with AD and PD, and are associated with neurodegeneration (Grunblatt et al., 2011; Connor et al., 1995). Recently, Fn in mitochondrion was observed to be increased and act as an important protective protein in AD (Gao and Chang, 2014). During oxidative stress, Fn is the main source of iron and reactive oxygen species; However, whether iron, TfR1 and Fn are involved in the progression of PTSD remains unclear. Some studies have recently shown a disorder of iron metabolism in the serum and brains of rats with psychological stress (Wang et al., 2008; Chen et al., 2009; Yu et al., 2011). Notably, the iron level has been shown to be significantly higher in areas of the brain that are very similar to brain regions affected by PTSD, such as the prefrontal cortex, hippocampus, and striatum (Wang et al., 2008). Therefore, we hypothesized that abnormal metabolism of iron in the brain may exist in rats after strong traumatic stress. To address this question, we assessed iron level and iron-related proteins by using a single prolonged stress (SPS)-induced paradigm, which is a reliable model and has been extensively applied in the investigation of PTSD (Wu et al., 2016b; Lee et al., 2016; Yamamoto et al., 2009).
EXPERIMENTAL PROCEDURES Animals and Establishment of SPS Model All animal-related procedures in this study were conducted in strict compliance with approved institutional animal care and use protocols of Third Military Medical University. Specific-pathogen-free (SPF) grade Sprague-Dawley rats were purchased from the Experimental Animal Center of this University, group housed, given free access to water and lab chow, and kept on a 12-hour light/dark cycle. A total of 120 male rats (10-12 weeks age, 200-220 g) were randomly divided into a control group (n=60) or SPS group (n=60). The rat 4
model of PTSD was established by using SPS as determined by international PTSD Scientific Meetings in Japan (Liberzon et al., 1997). The procedure (as indicated in Fig. 1) was as follows: The SPS rats were bound for two hours by using the plastic rigid bound device (diameter: 6 cm, length: 20 cm) and forced swimming was performed for 20 minutes (20 ℃, deep: 50 cm). Next, rats had a rest for 15 minutes and were then anesthetized with ether to a deep coma. Finally, they were placed in their home cages without disturbance for 7 days. The rats in the control group remained in their home cages as routine without any treatment.
Elevated Plus Maze Test On the eighth day, animals from each group (n=10) were placed in the center of the elevated plus maze (Arm length: 50cm, arm width: 10cm, height of baffle plate: 40cm, Height of device: 1.5m) and oriented into one of the open arms. A digital camera was used to record the activity of rats for 5 minutes (min). The percentage (%) of time spent in the open arms and distance travelled during the 5 min were recorded. In addition, the number of entries into the open arms as a percentage (%) of the total number of entries into all arms was recorded and analyzed by a computer.
Open Field Test The animals from each group (n=10) were placed in the central area of the open field (diameter: 100 cm, baffle high: 40 cm) and a digital camera was used to record the rats’ activity over a 15 min period. The site was cleaned by using a cloth with 70% ethanol after each experiment. Activity parameters including movement, distance, and time of each interval were analyzed by a computer. The crossing distance and time in the central area were considered measures of anxiety (Prut and Belzung, 2003).
Enzyme-linked Immunosorbent Assay The rats from each group (n=10) were intraperitoneally injected with 4% chloral hydrate, and blood was collected from the aortaventralis. The samples were placed at room temperature and centrifuged, and then the supernatant liquid was collected. The standard reagent (k7430, Biovine, USA) was diluted as 120 µg/L, 80 µg/L, 40 µg/L, 20 µg/L and 10 5
µg/L, and then 50µL was added to each well along with the serum samples. After incubation for 30 min at 37 ℃, the liquid was removed and washed 5 times. The detection regent (k7430, Biovine) was added in each well to incubate and was then washed again.
Fifty
microliters of substrate solution was added to each well and incubated for 15 min at room temperature, followed by 50 µL of stop solution. The optical density of each well was determined within 15 min by using a microplate reader (iMark, BIO-RAD) set at 450 nm.
Inductively Coupled Plasma Optical Emission Spectrometer (ICP-OES) Samples from the hippocampus, striatum and prefrontal cortex from each group (n=10) were dissected and weighted, diluted to a ratio of 1:20 with HEPES buffer (20 mmoL/L) (weight/volume) and then homogenized. Each sample was mixed with an equal volume of ultrapure nitric acid, digested in a 50 ℃ warm water bath for 48 hours and then diluted by nitrate (3.12 mmol/L) to a ratio of 1:10. The standard iron solution (50 mg/L) was diluted with nitric acid (5%) by 100, 50, 25 and 12.5 times and it was measured on the ICP-OES (Ash IRIS/AP, Thermo Jarell, USA) to draw the standard curved line. The atomic emission spectrometry of iron in the samples was determined by using the ICP-OES with a combination of a charged injection device detector and an axial viewing mode. The data were analyzed and recorded by a computer.
Western Blot Analysis (WB) Bilateral prefrontal cortex, striatum, hippocampus, and cerebellum from the rats in each group (n=5) were dissected individually. A Protein Extract Kit (P0027, Beyotime Biotech, Beijing, P. R. China) was used to isolate protein, and the protein concentration was determined using a BCA Assay Kit (P0010, Beyotime Biotech). Protein samples containing 50 µg were diluted in loading buffer, and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to polyvinylidene fluoride (PVDF) membranes. After being blocked the blots were washed with TBST and incubated in a solution of rabbit polyclonal anti-glucocorticoid receptor antibody (1:500; ab3578, Abcam, San Francisco, USA), mouse monoclonal anti-transferrin receptor antibody (1:500; ab1086, Abcam), and rabbit monoclonal anti-ferritin antibody (1:500; ab75973, Abcam) at 4 °C 6
overnight. Next, the blots were washed with the TBST 3 times and incubated with biotin-labeled anti-rabbit antibody (1:2000; ZB2301, Zhongshan Biotech, Beijing, P. R. China) and biotin-labeled anti-mouse antibody (1:2000; ZB2305, Zhongshan Biotech) for 90 min at 37 ℃. Monoclonal anti-β-actin antibody (1:1000; AA128, Zhongshan Biotech) was used as an internal standard. The blots were washed again and detected by the chemiluminescence ECL Western blotting system. Quantity One software was applied to analyze the relative optical density.
Immunohistochemistry (IHC) After intraperitoneal 4% chloral hydrate (1 ml/kg) solution, animals from each group (n=4) were perfused with 200 mL 0.9% saline, followed by 400 mL 4% paraformaldehyde in phosphate buffer (pH 7.4). The brains was carefully dissected, removed, post-fixed, and then transferred to 30% sucrose for dehydration for a week. The brains were cut frozen into 30-µm-thick coronal sections with every sixth section being placed in the same well. The sections were washed and quenched for 15 min in 3% H2O2, and then incubated overnight at 4°C with the rabbit polyclonal anti-glucocorticoid receptor antibody (1:200, ab3578, Abcam, USA), mouse monoclonal anti-transferritin receptor antibody (1:200; ab1086, Abcam) and rabbit monoclonal anti-ferritin antibody (1:200; ab75973, Abcam) diluted with antibody diluent (ZLI-9028; Zhongshan Biotech). Next, they were incubated with biotinylated secondary goat anti-rabbit IgG (1:200; ZB2010, Zhongshan Biotech) and biotin-labelled horse anti-mouse IgG (1:200; ZB2020, Zhongshan Biotech) for 1 h. After being washed in PBS 3 times, the sections were incubated in horseradish peroxidase (HRP)-labeled streptavidin reagent (1:200; ZB2404, Zhongshan Biotech) for 1 h at room temperature and then stained with a DAB kit (SK-4100; VECTOR) for 5 min. Finally, the sections were dehydrated and mounted. Five sections of the hippocampus between plates 54 (Bregma –2.52) and 59 (Bregma –3.12) were used to represent the region of expression in each brain. Images were taken using an Olympus microscope (DX60, Olympus, Japan) with a Leica digital camera (DP70, Leica, Germany). The average optical density of IHC was measured by Image Pro Plus software 6.0. 7
Q- PCR Analysis (Q-PCR) The hippocampi were separated from each group (n=4) and were homogenized under liquid nitrogen, and the total RNA was extracted by TRIzol (Invitrogen) reagent according to the manufacturer’s protocol. One thousand nanograms per sample was traversed to cDNA by a transcription kit (Invitrogen, superscript III) according to the manufacturer’s instructions. Primers
were
designed
as
follow:
5-GTGAATGCAATGGAGTGTGC-3;
Primer
Forward
Reverse
5-TCTTGCGTAAGTAAGTTGGTCACG-3; CGGCCTATATGCTTGGGTAGGA; R:
Fn
Tfr1:
(F): (R):
Primer
F:
TATGACAATGGCTCCCCTCCA. GAPDH:
Primer F: 5-GTTACCAGGGCTGCCTTCTC-3; R: 5-GGGTTTCCCGTTGATGACC-3. The PCR system was operated at 95 ℃ for 2 min, 40 cycles of 94 ℃ for 20 seconds (sec), 65 ℃ for 20 sec, and 72 ℃ for 30 sec. The Q-RT-PCR data were then recorded and analyzed by using the 2 -△△Ct method (Livak and Schmittgen, 2001).
Hematoxylin & eosin (H&E) staining and transmission electron microscopic observations The hippocampus, frontal cortex and striatum were dissected individually for HE staining (n=3). A 5-µm-thick paraffin section was prepared and stained with hematoxylin for 15 min after being dewaxed by xylene. The section was then screened with 1% hydrochloric acid alcohol under a microscope, washed by distilled water for 30 sec and then stained with 5% eosin for 3 min. The sections were washed and mounted with resinene. They were finally observed and recorded under an Olympus microscope (DX60, Olympus, Japan) with a Leica digital camera (DP70, Leica, Germany). The hippocampal tissue from the two group (n=4) was trimmed at a size of 1 mm × 1 mm square and stored in a1.5 mL EP tube. Tissue was then fixed in 2.5% glutaraldehyde for 2h at 4 ℃ and immersed in 1 % osmium tetroxide for 30 min. After being washed by PBS, the fixed tissues were dehydrated by acetone and then embedded. 1-nm-thick sections were stained with methylene blue for 30 sec at 60 ℃, washed with distilled water and then stained with 0.25% sodium borate and 0.5% basic fuchsin for 10 sec. 50-nm-thick sections were stained with uranyl acetate and citric acid lead, and then observed under a transmission 8
electron microscope.
Statistical Analysis The measurement data were collected as previously described. All results were evaluated by SPSS13.0 software and describe as mean ± SE and the median（P25,P75). Non-paired t-tests and non-parametric tests were applied according to the distribution form of the data in the experiment and a level of p < 0.05 was considered statistically significant.
RESULTS SPS exposure induced anxiety-like symptoms The results of the EPM behavioral analysis are shown in Figure 1. Compared with the control group, the SPS paradigm dramatically decreased the percentage of open arm time by 49% (p < 0.05, independent samples T test). The corresponding percentage of distance was decreased by 30.2% (p < 0.05, independent samples T test), and the percent of entries was reduced by 36.5% (p < 0.05, independent samples T test). The open field test showed a significant decrease in central time (decreased by 61.3%), and an accompanying distance was decreased of 66.1% (Fig. 1) in the SPS group (p < 0.05, independent samples T test).
SPS exposure increased the level of the serum cortisol Our results show that the level of serum cortisol in the control group was about 12.5 (12.2; 12.8) µg/L and about 26.1(20.9; 27.3) µg/L in the SPS group, which reflect the state of stress in the rats. The level of cortisol in the SPS group was approximately 2.1-fold higher than that of the controls (p < 0.05, non-parametric test).
SPS exposure increased the concentrations of iron in the brain In order to test whether iron content was altered by the SPS paradigm, we examined iron content in the hippocampus, frontal cortex, and striatum with an ICP-OES method. Our results demonstrated that iron accumulated in the brain areas after acute stress (p < 0.05, independent samples T test). In the SPS group, levels of iron were increased by 3.1 fold in the hippocampus. Iron accumulation in the prefrontal cortex and striatum in the SPS paradigm 9
was increased by 2.5-fold and 3.4-fold, respectively, compared with the control group (Fig. 1).
SPS exposure caused region-specific changes in TfR1 expression The results of Western blot analysis of TfR1 protein were shown in Figure 2. Our results showed that differences were evident in the hippocampus and prefrontal cortex (p<0.05, independent samples T test). TfR1 immunoreactivity in the hippocampus was decreased by 38.6% in the SPS group. The expression of TfR1 was increased by 38.9% in the prefrontal cortex. However, the results of Western blot analysis showed no significant difference in the striatum or cerebellum compared with the controls (p > 0.05, independent samples T test; Fig. 2).
SPS exposure caused region-specific changes of Fn expression Western blot analysis of Fn expression showed a decreased trend, similar to TfR1 in the hippocampus, and the expression of Fn was decreased by 43.5% in the SPS group compared with the control (p<0.05, independent samples T test). Immunoreactivity of ferritin in the striatum was increased by 29.4% of the SPS-exposed rats. There were no obvious differences in expression within the prefrontal cortex or cerebellum (p > 0.05, independent samples T test; Fig. 3).
SPS exposure changed the GR, TfR1, and Fn expression in the hippocampus Results of the IHC analysis of GR in the hippocampus showed that positive immunoreactivity was localized in the cytoplasm of pyramidal and Purkinje neurons (Fig. 4). Glucocorticoid receptor (GR) immunoreactivity in the SPS-exposed group was increased by 22.0% (Table1). IHC analysis of TfR1 and Fn showed results similar to the Western blot analysis. TfR1 was distributed mainly in large pyramidal neurons and located mainly on the membrane (Fig. 4), as described previously (Dickinson and Connor, 1998). TfR1 immunoreactivity in the SPS-exposed group was decreased by 26.1% (Table1) as compared with the control. Fn was obviously located in the cytoplasm and nucleus of the pyramidal neurons in the hippocampus of the SPS group (Fig. 4), but was decreased by 20.6% compared 10
with the control group (Table1). The expression of the three proteins in hippocampal neurons was significantly different (p < 0.05, non-parametric test; Table 1).
SPS exposure decreased the expression of Fn and TfR1mRNA in the hippocampus Q-PCR results showed that Fn mRNA level in the control group were about 2.05±2.85 and 0.260±0.302 in the SPS group which reflected a significant decrease of 87.4% (p < 0.05, independent samples T test). TfR1 mRNA levels were significantly inhibited by 41.6% (4.66±1.71 vs 2.72±0.504, p < 0.05, independent samples T test).
SPS exposure induce morphology changes of cells in the brain Compared with the control group, the SPS group showed more injured cells in the hippocampus, prefrontal cortex and
striatum,
which showed
heterogeneous and
hyperchromatic neurons (Fig. 5). The neurons in the hippocampus of the SPS group, observed under the transmission electron microscope, showed marked swelling of the mitochondria, crista degranulation, and cell apoptosis in the SPS group (Fig. 5).
DISCUSSION To our knowledge, this is the first report that abnormal iron metabolism involving in the brain injury in the SPS rat model. Our results demonstrated the following: (1) the SPS model led to behavioral changes as compared with the control animals; (2) the serum cortisol level and GR immunoreactivity in the hippocampus was increased after stress; (3) iron was accumulated in brain areas such as the hippocampus, prefrontal cortex, and striatum of SPS rats; (4) cells showed region-specific reaction to iron deposition, and mRNA expression of TfR1 and Fn in the hippocampus was decreased in SPS rats; (5) and by morphological observation, the neurons were injured in the areas of iron accumulation. Among various animal models of PTSD, the SPS model has been validated to mimic the pathophysiological abnormalities and behavioral characteristics of PTSD, such as enhanced anxiety-like behavior, elevated glucocorticoid negative feedback, and exaggerated acoustic startle response (Yamamoto et al., 2009; Wu et al., 2016a). Furthermore, studies have shown that the SPS model was well-established for investigation of abnormal metabolism of the 11
nervous system (Yamamoto et al., 2008; Lee et al., 2016). Our results showed that the rats had a higher degree of anxiety and fear in both behavioral tests, which was consistent with a previous study (Gao et al., 2014). Cortisol is the most representative hormone in response to stress. A study showed that injection of glucocorticoids into the hippocampus induced PTSD-like memory impairments in mice, which emphasized the importance of this hormone involved in the pathology of PTSD (Kaouane et al., 2012). In our study, the serum cortisol level and GR immunoreactivity in the hippocampus were markedly increased, which was in agreement with previous findings (Ganon-Elazar and Akirav, 2013; Liberzon et al., 1999). As hippocampal glucocorticoid receptors function in glucocorticoid negative feedback regulation, all these data suggest that changes in the expression of GR may represent the primary level of dysfunction in glucocorticoid signaling. Combined with behavioral evidence, our data may indicate the rats in the morbid state were affected by severe stress and can simulate the conditions of PTSD patients to some extent (van Zuiden et al., 2012). Iron is the essential coenzyme responsible for oxygen transportation in mitochondrial respiration metabolism (Beard, 2001). Iron is also very important for brain cell activities but has highly oxidizing activity producing reactive free radical species such as the hydroxyl radical (OH) reported by the Fenton and Haber–Weiss reaction (Kehrer, 2000; Liochev, 1999). Previous animal studies suggested that systemic iron status in mammals may be altered during different kinds of physiological stress such as swimming, aerobic exercise and surgical trauma (Konig et al., 1998; Lukaski et al., 1990; Nikolova-Todorova and Troic, 2003; Lyle et al., 1992). Recent studies have shown that both psychological and somatic stress can lead to increase brain iron content in some brain regions (Wang et al., 2008; An et al., 2013; Ma et al., 2008). By using the highly sensitive ICP-OES method, our data clearly showed iron accumulation in the hippocampus, prefrontal cortex, and striatum after the SPS stress and may do harm to the neurons in these areas. With respect to emotional behaviors, previous research has shown that iron overload could induce anxiety-like behaviors and mood disorder (Maaroufi et al., 2009), which were corroborated in our tests. These findings support the idea that imbalanced iron metabolism functions in modulating anxiety and emotional behaviors (Kim and Wessling-Resnick, 2014). Recent studies have indicated that iron accumulation, even in trace amounts, can result in the 12
Fenton reaction (Alexandrov et al., 2005) and leads to cell apoptosis through lipid peroxidation (Zhang et al., 2003). In fact, we observed significant heterogeneous and hyperchromatic neurons in the three brain regions when compared with the control group. On the other hand, by using the transmission electron microscope, we found that hippocampal neurons showed marked mitochondrial swelling and cell apoptosis in the SPS animals, suggesting that iron is an important factor leading to neuronal injury. Normal physiological function has a stringent regulatory mechanism to guarantee the net turnover of dietary iron, which primarily depends on TfR1 and Fn (Hare et al., 2013). In our study, TfR1 was decreased in the hippocampus, which is in agreement with some previous reports showing iron deposition in neurodegenerative diseases such as AD and PD (Morris et al., 1994a; Crespo et al., 2014; Morris et al., 1994b). Fn is a main intracellular protein that stores excess iron, and is considered a pro-oxidant as well as an antioxidant (Arosio et al., 2009). Our study demonstrated that Fn was decreased in the hippocampus. Similar results were reported in a recent study of Fn transcript investigated in PD brains (Faucheux et al., 2002). The down-regulation of TfR1 suggests increased levels of free iron in this region (Hare et al., 2013). Furthermore, we hypothesized that decreased ferritin may result in subsequent cellular free iron accumulation which aggravates neuronal damage, eventually leading to apoptosis. There is a significant increase in ferritin in the striatum, which could potentially lead to a net reduction in the level of free iron. A deficit in bioavailable iron would activate microglia to damage the neurons through inflammation (Block et al., 2007). Our finding suggested that TfR1 may be increased in the prefrontal cortex inducing excess iron endocytosis, which could lead to cytotoxicity. The heterogeneity between these areas may be a reflection of differences in the regional susceptibility of iron accumulation and the hippocampus may be the most vulnerable area (Erikson et al., 1997; Ke and Gibson, 2004). When intracellular iron is accumulated, the iron regulatory proteins (IRP) regulate protein is expressed through the iron responsive element (IRE) binding, leading to the elevated TfR1 and consequently, decreasing ferritin expression (Kuhn, 2015). Our data showed that TfR1 and FnmRNA in the hippocampus were significantly decreased, and demonstrated the stress affects iron metabolism at the genome level. Because the expression of both ferritin and TfR1 is controlled by this same mechanism, and both ferritin and TfR1 were decreased, this 13
suggests that these two key homeostatic proteins are influenced by more than just iron bioavailability (Cairo et al., 1998). An alternative explanation for the apparently paradoxical alterations in ferritin and TfR1 in the hippocampus involves the stress hormone glucocorticoids (GCs) and nitricoxide synthase (NOS), which has been demonstrated in other cell experiments (data not shown, not published). Since we just conducted a preliminary experiment to test whether iron may be a high risk factor in the SPS model, it is unclear whether iron accumulation is a causative factor or a result of the disease process itself. Additional studies, such as in vivo injection of deferoxamine to observe animal behavior, will be very helpful to demonstrate the exact role of iron accumulation in this model. I would be necessary to examine the roles of other iron proteins such as iron regulated protein (IRP), divalent metal transporter-1 (DMT1) and ferroportin (FpN) in our future study.
CONCLUSIONS In summary, this study indicated that iron was involved in the brain injury in the PTSD model, suggesting that iron may be a potential candidate for therapeutic interventions targeting PTSD.
ACKNOWLEDGEMENTS The authors want to thank the editors of Medjaden Bioscience, who edited and proofread this manuscript. Jiqiang Zhang and Haitao Li designed the study. Ming Zhao and Zhibo Yu conducted all searches, Jingming Hou appraised all potential studies and Ming Zhao wrote the draft manuscript and subsequent manuscripts. Yang Zhang, Xueling Huang, Jingming Hou and Luo Wei assisted with searches. Wei Luo carried out the cytology experiment. Lin Chen and Lan Ou assisted with the presentation of findings. Jiqiang Zhang and Haitao Li assisted with revising the manuscript. All authors read and approved the final manuscript.
Funding This work was supported predominantly by the National Nature Science Foundation of China 14
No. 81171283 and No. 81301679, and in part by Funds for Young Scientists of Southwest Hospital No 291289554.
Conflict of interest None
15
References Alexandrov PN, Zhao Y, Pogue AI, Tarr MA, Kruck TP, Percy ME, Cui JG, Lukiw WJ (2005) Synergistic effects of iron and aluminum on stress-related gene expression in primary human neural cells. J Alzheimers Dis 8:117-127; discussion 209-115. An LN, Yue Y, Guo WZ, Miao YL, Mi WD, Zhang H, Lei ZL, Han SJ, Dong L (2013) Surgical trauma induces iron accumulation and oxidative stress in a rodent model of postoperative cognitive dysfunction. Biol Trace Elem Res 151:277-283. Arosio P, Ingrassia R, Cavadini P (2009) Ferritins: a family of molecules for iron storage, antioxidation and more. Biochim Biophys Acta 1790:589-599. Beard JL (2001) Iron biology in immune function, muscle metabolism and neuronal functioning. J Nutr 131:568S-579S; discussion 580S. Block ML, Zecca L, Hong JS (2007) Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 8:57-69. Cairo G, Tacchini L, Pietrangelo A (1998) Lack of coordinate control of ferritin and transferrin receptor expression during rat liver regeneration. Hepatology 28:173-178. Chen J, Shen H, Chen C, Wang W, Yu S, Zhao M, Li M (2009) The effect of psychological stress on iron absorption in rats. BMC Gastroenterol 9:83. Connor JR, Snyder BS, Arosio P, Loeffler DA, LeWitt P (1995) A quantitative analysis of isoferritins in select regions of aged, parkinsonian, and Alzheimer's diseased brains. J Neurochem 65:717-724. Crespo AC, Silva B, Marques L, Marcelino E, Maruta C, Costa S, Timoteo A, Vilares A, Couto FS, Faustino P, Correia AP, Verdelho A, Porto G, Guerreiro M, Herrero A, Costa C, de Mendonca A, Costa L, Martins M (2014) Genetic and biochemical markers in patients with Alzheimer's disease support a concerted systemic iron homeostasis dysregulation. Neurobiol Aging 35:777-785. Crichton RR, Dexter DT, Ward RJ (2011) Brain iron metabolism and its perturbation in neurological diseases. J Neural Transm (Vienna) 118:301-314. Curtis AR, Fey C, Morris CM, Bindoff LA, Ince PG, Chinnery PF, Coulthard A, Jackson MJ, Jackson AP, McHale DP, Hay D, Barker WA, Markham AF, Bates D, Curtis A, Burn J (2001) Mutation in the gene encoding ferritin light polypeptide causes dominant 16
adult-onset basal ganglia disease. Nat Genet 28:350-354. Dickinson TK, Connor JR (1998) Immunohistochemical analysis of transferrin receptor: regional and cellular distribution in the hypotransferrinemic (hpx) mouse brain. Brain Res 801:171-181. Erikson KM, Pinero DJ, Connor JR, Beard JL (1997) Regional brain iron, ferritin and transferrin concentrations during iron deficiency and iron repletion in developing rats. J Nutr 127:2030-2038. Faucheux BA, Martin ME, Beaumont C, Hunot S, Hauw JJ, Agid Y, Hirsch EC (2002) Lack of up-regulation of ferritin is associated with sustained iron regulatory protein-1 binding activity in the substantia nigra of patients with Parkinson's disease. J Neurochem 83:320-330. Ganon-Elazar E, Akirav I (2013) Cannabinoids and traumatic stress modulation of contextual fear extinction and GR expression in the amygdala-hippocampal-prefrontal circuit. Psychoneuroendocrinology 38:1675-1687. Gao G, Chang YZ (2014) Mitochondrial ferritin in the regulation of brain iron homeostasis and neurodegenerative diseases. Front Pharmacol 5:19. Gao J, Wang H, Liu Y, Li YY, Chen C, Liu LM, Wu YM, Li S, Yang C (2014) Glutamate and GABA imbalance promotes neuronal apoptosis in hippocampus after stress. Med Sci Monit 20:499-512. Grunblatt E, Bartl J, Riederer P (2011) The link between iron, metabolic syndrome, and Alzheimer's disease. J Neural Transm (Vienna) 118:371-379. Han F, Yan S, Shi Y (2013) Single-prolonged stress induces endoplasmic reticulum-dependent apoptosis in the hippocampus in a rat model of post-traumatic stress disorder. PLoS One 8:e69340. Hare D, Ayton S, Bush A, Lei P (2013) A delicate balance: Iron metabolism and diseases of the brain. Front Aging Neurosci 5:34. Kalivendi SV, Kotamraju S, Cunningham S, Shang T, Hillard CJ, Kalyanaraman B (2003) 1-Methyl-4-phenylpyridinium (MPP+)-induced apoptosis and mitochondrial oxidant generation: role of transferrin-receptor-dependent iron and hydrogen peroxide. Biochem J 371:151-164. 17
Kaouane N, Porte Y, Vallee M, Brayda-Bruno L, Mons N, Calandreau L, Marighetto A, Piazza PV, Desmedt A (2012) Glucocorticoids can induce PTSD-like memory impairments in mice. Science 335:1510-1513. Ke ZJ, Gibson GE (2004) Selective response of various brain cell types during neurodegeneration induced by mild impairment of oxidative metabolism. Neurochem Int 45:361-369. Kehrer JP (2000) The Haber-Weiss reaction and mechanisms of toxicity. Toxicology 149:43-50. Kim EJ, Pellman B, Kim JJ (2015) Stress effects on the hippocampus: a critical review. Learn Mem 22:411-416. Kim J, Wessling-Resnick M (2014) Iron and mechanisms of emotional behavior. J Nutr Biochem 25:1101-1107. Konig D, Weinstock C, Keul J, Northoff H, Berg A (1998) Zinc, iron, and magnesium status in athletes--influence on the regulation of exercise-induced stress and immune function. Exerc Immunol Rev 4:2-21. Kuhn LC (2015) Iron regulatory proteins and their role in controlling iron metabolism. Metallomics 7:232-243. Lee B, Sur B, Cho SG, Yeom M, Shim I, Lee H, Hahm DH (2016) Ginsenoside Rb1 rescues anxiety-like responses in a rat model of post-traumatic stress disorder. J Nat Med 70:133-144. Leskovjan AC, Kretlow A, Lanzirotti A, Barrea R, Vogt S, Miller LM (2011) Increased brain iron coincides with early plaque formation in a mouse model of Alzheimer's disease. Neuroimage 55:32-38. Liberzon I, Krstov M, Young EA (1997) Stress-restress: effects on ACTH and fast feedback. Psychoneuroendocrinology 22:443-453. Liberzon I, Lopez JF, Flagel SB, Vazquez DM, Young EA (1999) Differential regulation of hippocampal glucocorticoid receptors mRNA and fast feedback: relevance to post-traumatic stress disorder. J Neuroendocrinol 11:11-17. Liochev SI (1999) The mechanism of "Fenton-like" reactions and their importance for biological systems. A biologist's view. Met Ions Biol Syst 36:1-39. 18
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. Lukaski HC, Hoverson BS, Gallagher SK, Bolonchuk WW (1990) Physical training and copper, iron, and zinc status of swimmers. Am J Clin Nutr 51:1093-1099. Lyle RM, Weaver CM, Sedlock DA, Rajaram S, Martin B, Melby CL (1992) Iron status in exercising women: the effect of oral iron therapy vs increased consumption of muscle foods. Am J Clin Nutr 56:1049-1055. Ma L, Wang W, Zhao M, Li M (2008) Foot-shock stress-induced regional iron accumulation and altered iron homeostatic mechanisms in rat brain. Biol Trace Elem Res 126:204-213. Maaroufi K, Ammari M, Jeljeli M, Roy V, Sakly M, Abdelmelek H (2009) Impairment of emotional behavior and spatial learning in adult Wistar rats by ferrous sulfate. Physiol Behav 96:343-349. Morris CM, Candy JM, Kerwin JM, Edwardson JA (1994a) Transferrin receptors in the normal human hippocampus and in Alzheimer's disease. Neuropathol Appl Neurobiol 20:473-477. Morris CM, Candy JM, Omar S, Bloxham CA, Edwardson JA (1994b) Transferrin receptors in the parkinsonian midbrain. Neuropathol Appl Neurobiol 20:468-472. Nikolova-Todorova Z, Troic T (2003) [Effect of surgical trauma on patient nutritional status]. Med Arh 57:29-31. Pitman RK, Rasmusson AM, Koenen KC, Shin LM, Orr SP, Gilbertson MW, Milad MR, Liberzon I (2012) Biological studies of post-traumatic stress disorder. Nat Rev Neurosci 13:769-787. Prut L, Belzung C (2003) The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharmacol 463:3-33. Spoont MR, Williams JW, Jr., Kehle-Forbes S, Nieuwsma JA, Mann-Wrobel MC, Gross R (2015) Does This Patient Have Posttraumatic Stress Disorder?: Rational Clinical Examination Systematic Review. JAMA 314:501-510. Sumbria RK, Hui EK, Lu JZ, Boado RJ, Pardridge WM (2013) Disaggregation of amyloid plaque in brain of Alzheimer's disease transgenic mice with daily subcutaneous 19
administration of a tetravalent bispecific antibody that targets the transferrin receptor and the Abeta amyloid peptide. Mol Pharm 10:3507-3513. van Zuiden M, Geuze E, Willemen HL, Vermetten E, Maas M, Amarouchi K, Kavelaars A, Heijnen CJ (2012) Glucocorticoid receptor pathway components predict posttraumatic stress disorder symptom development: a prospective study. Biol Psychiatry 71:309-316. Wang L, Wang W, Zhao M, Ma L, Li M (2008) Psychological stress induces dysregulation of iron metabolism in rat brain. Neuroscience 155:24-30. Wieler M, Gee M, Martin WR (2015) Longitudinal midbrain changes in early Parkinson's disease: iron content estimated from R2*/MRI. Parkinsonism Relat Disord 21:179-183. Wu Z, Tian Q, Li F, Gao J, Liu Y, Mao M, Liu J, Wang S, Li G, Ge D, Mao Y, Zhang W, Liu Z, Song Y (2016a) Behavioral changes over time in post-traumatic stress disorder: Insights from a rat model of single prolonged stress. Behav Processes 124:123-129. Wu ZM, Zheng CH, Zhu ZH, Wu FT, Ni GL, Liang Y (2016b) SiRNA-mediated serotonin transporter knockdown in the dorsal raphe nucleus rescues single prolonged stress-induced hippocampal autophagy in rats. J Neurol Sci 360:133-140. Yamamoto S, Morinobu S, Fuchikami M, Kurata A, Kozuru T, Yamawaki S (2008) Effects of single prolonged stress and D-cycloserine on contextual fear extinction and hippocampal NMDA receptor expression in a rat model of PTSD. Neuropsychopharmacology 33:2108-2116. Yamamoto S, Morinobu S, Takei S, Fuchikami M, Matsuki A, Yamawaki S, Liberzon I (2009) Single prolonged stress: toward an animal model of posttraumatic stress disorder. Depress Anxiety 26:1110-1117. Yu S, Feng Y, Shen Z, Li M (2011) Diet supplementation with iron augments brain oxidative stress status in a rat model of psychological stress. Nutrition 27:1048-1052. Zhang Z, Wei T, Hou J, Li G, Yu S, Xin W (2003) Iron-induced oxidative damage and apoptosis in cerebellar granule cells: attenuation by tetramethylpyrazine and ferulic acid. Eur J Pharmacol 467:41-47. Zhu WZ, Zhong WD, Wang W, Zhan CJ, Wang CY, Qi JP, Wang JZ, Lei T (2009) 20
Quantitative MR phase-corrected imaging to investigate increased brain iron deposition of patients with Alzheimer disease. Radiology 253:497-504.
21
Figure legends Figure 1. Behavioral changes in the SPS model and altered brain iron content. A diagrammatic representation of the SPS paradigm. The SPS model involves serial stressors including restraint, forced swim, and anesthetization by ether, followed by a week no touching period. B-D: The data of the elevated plus maze test (EPM) are shown. The open arm time (B), open arm distance (C), and open arm entries (D) of the SPS group showed significant decreases using the independent samples T test. Data are expressed as the mean ± S.E.M (*: p<0.05). E and F: The data of the open field tests are shown. The central area time (E) and central distance (F) of the SPS group decreased significantly compared with the control group (*: p<0.05). G: The iron content in different brain areas by using the ICP-OES. PFC: prefrontal cortex; Str: striatum; Hip: hippocampus. The results showed that iron accumulated in these three areas in the SPS group compared with the control group (*:p<0.05). Figure 2. Transferrin receptor1 (TfR1) as shown by Western blot analysis (WB) in brain regions. PFC: prefrontal cortex. Str: striatum. Hip: hippocampus. Cer: cerebellum. The results showed TfR1 immunoreactivity in the hippocampus was decreased, and the expression of TfR1 was increased in the prefrontal cortex significantly in the SPS group (Results are expressed as the mean ± S.E.M. *:p < 0.05; independent samples T test). Results of Western blot analysis showed no significant difference in the striatum or cerebellum compared with the controls (p > 0.05; independent samples T test). Figure 3. Ferritin (Fn) as shown by Western blot analysis (WB) in brain regions. PFC: prefrontal cortex. Str: striatum. Hip: hippocampus. Cer: cerebellum. Fn expression showed a decreasing trend, and immunoreactivity of ferritin in the striatum was increased in the SPS group compared with control (p<0.05, independent samples T test). There was no obvious difference in expression between the prefrontal cortex and cerebellum (p > 0.05, independent samples T test). Figure 4. Immunohistochemistry (IHC) detected the expression of glucocorticoid receptor (GR), transferrin receptor (TfR1), and Ferritin (Fn) in the hippocampus. Glucocorticoid receptor (GR) immunoreactivity in the SPS-exposed group was increased significantly, and both the TfR1 and Fn immunoreactivity in the SPS-exposed group was decreased compared 22
with the control according to non-parametric tests. Figure 5. Morphology of cells observed by the H&E staining and transmission electron microscope. A and B: staining of the prefrontal cortex. C and D: staining of the hippocampus. E and F: staining of the striatum. B, D and F show that there are more heterogeneous and hyperchromatic neurons in these three areas in the SPS group compared with the control group. H and J show normal neurons as detected by the transmission electron microscope. I shows the marked swelling of mitochondria and crista degranulation in the neurons of the SPS group. K shows cell apoptosis in the SPS group.
23
Table 1 Immunohistochemistry (IHC) Results (n=4) CON
PTSD
GR in hippocampus
0.309(0.291;0.337)
0.376(0.374;0.410)*
TfR1 in hippocampus
0.474 (0.459;0.481)
0.350(0.303;0.367)*
Fn in hippocampus
0.28(0.277;0.292)
0.222(0.216;0.246)*
Data are described as the median (P25, P75), *: p<0.05, when compared to the control; Nonparametric test.
24
25
26
27
28
29
Highlights •
SPS is a model which induced anxiety-like symptoms and increased GR in
hippocampus. •
Iron was increased in the hippocampus, prefrontal cortex and striatum after stress.
•
Cells showed region-specific reaction to iron deposition.
•
The neurons were injured in the areas of iron accumulation.
30