- Email: [email protected]
Is nitric oxide involved in the tolerance of Calomys callosus as a reservoir host towards Trypanosoma cruzi infection?
Journal of Infection (2006) 52, 49–55
www.elsevierhealth.com/journals/jinf
Is nitric oxide involved in the tolerance of Calomys callosus as a reservoir host towards Trypanosoma cruzi infection? C.K. Dosta,b,*, J. Saraivac, U. Zentgrafa, N. Monesic, W. Engelsb, S. Albuquerquec a
¨bingen Lehrstuhl Allgemeine Genetik, ZMBP, University of Tu ¨bingen Lehrstuhl Entwicklungsphysiologie, Zoologisches Institut, University of Tu c ´lises Clinı´cas, Toxicolo ´gicas e Bromatolo ´gicas da Faculdade de Cie ˆncias Departamento de Ana ˆuticas, Ribeira ˜o Preto-USP, Ribeira ˜o Preto, Brazil Farmace b
Accepted 1 February 2005 Available online 5 April 2005
KEYWORDS Trypanosoma cruzi; Nitric oxide; Calomys callosus; Chagas disease; Resistance
Summary Trypanosoma cruzi, the agent of Chagas disease, is known to cause enhanced nitric oxide (NO) production, which might be involved in host resistance. The inducible nitric-oxide-synthase (iNOS) is assumed to be responsible for the NO increase after several infections. We studied the potential role of NO in Calomys callosus, a natural reservoir of this protozoan parasite. The concentration of NO was determined in spleen and liver of animals infected with two different T. cruzi strains, BOL and BOL-SB. Furthermore, the iNOS mRNA expression was quantified in the same cell types. NO production was detectable in both tissues exhibiting only slight differences compared to non-infected controls. All measured NO values were significantly lower than those reported for a number of different mouse strains, which displayed extremely enhanced NO levels after T. cruzi infection. Surprisingly, iNOS mRNA expression was induced in infected C. callosus but without subsequent increase of NO levels, indicating a post-transcriptional regulation mechanism. In summary, our results, indicate that the tolerance of C. callosus to T. cruzi is only accompanied by non-toxic NO intracellular concentrations. Q 2005 The British Infection Society. Published by Elsevier Ltd. All rights reserved.
Introduction
* Corresponding author. Tel.: C55 7071 2978851; fax: C55 7071 295042. E-mail address: [email protected] (C.K. Dost).
Infections with the protozoan parasite Trypanosoma cruzi, the causative agent of Chagas disease, affect numerous inhabitants of South and Central America. At present, about 13 million people are infected, of which 3.0–3.3 million consist of
0163-4453/$30.00 Q 2005 The British Infection Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.jinf.2005.02.003
50 symptomatic cases. The annual incidence is 200 000 new cases in 15 countries (WHO, 2003). The parasite has a complex life-cycle including different developmental stages, which permits its adaption to very diverse host environments. In vertebrates, T. cruzi invades different cell types, including macrophages and is capable to replicate inside them. Up to now no vaccine or efficient therapy is available. The two drugs employed in clinical treatment, benznidazole and nifurtimox, are badly tolerated and their use results of severe side effects.10 T. cruzi infection is followed by the activation of immune factors, like T-cells as important sources of cytokines (INF-g), B-cells releasing antibodies, and macrophages which not only phagocyte the trypomastigotes, but also produce of nitric oxide (NO). Several other cell types, like fibroblasts, Kupffer’s cells, hepatocytes, epithelial cells and smooth muscle cells have been described as capable of producing NO.28,29 This highly reactive molecule has microbicidial and cytostatic effects, and plays a role in the cell mediated immune response to parasite infections, as already shown for T. cruzi,16 Leishmania spec.21,22 and Toxoplamsa gondii.20,32 Resistance against such protozoan depends on both the INF-g induction and NO production.25,33 The latter is catalyzed by NO-synthases (NOS) of which the endothelial (eNOS) and the neuronal (nNOS) forms are constitutively expressed and calcium dependent. However, the inducible isoform (iNOS) is calcium independent and is not detectable in uninfected white mice.15 This has been clearly demonstrated by in vitro stimulation with LPS, which leads to an enhanced production of NO.19,24 Besides the normal physiological role of NO and its contribution in the defence of various infections, high NO concentrations are damaging the cells and also seem to be involved in the pathophysiology of human diseases.7,8 In this sense, NO can be considered a double-edged sword. Calomys callosus, a wild neotropical rodent, is a natural reservoir host tolerant to T. cruzi infection.1,5,30,31 In contrast, experimental infection of Mus musculus with the Chagas agent results in high mortality of these animals within some weeks,11 accompanied by several histological alterations.6 We used the naturally tolerant model C. callosus to investigate the NO production in spleen and liver cells. In this study we employed T. cruzi strains BOL and BOL-SB4 which belong to groups I and II, respectively, characterized by distinct biological properties.11 The data were compared with already characterized reactions of non-tolerant mice.3,17 In addition, we determined iNOS mRNA expression levels during the infection in both C. callosus and M. musculus in order to better understand the mechanisms of tolerance towards Chagas disease.
C.K. Dost et al.
Material and methods Animals Male C. callosus were infected i.p. with blood samples containing 4!103 trypomastigotes. The time course of parasitemia after infection was assessed by microscopic examination of thin blood films of tail bleeds.
Parasites The T. cruzi strains BOL, belonging to group I, and BOL-SB of group II, which are characterized by distinct biological properties11 were used. The strains were maintained in the laboratory by serial blood passages in mice. Analyzes were performed at the following days after infection: BOL-SB days 5, 7, 12, 14 and 45, BOL days 7, 9, 12, 14 and 45.
Primary cell cultures Spleen and liver from infected and control animals were dissected and washed in sterile PBS, at different days of infection. Spleen For separation of splenocytes, the whole organ was covered with RPMIincompl.medium (GIBCO) and mechanically disaggregated by using a polypropylene sieve as previously described. Viable cells were counted by exclusion of trypan blue (SIGMA) in a Neubauer Hemacytometer and seeded at a density of 2, 5!104 cells/well in a 24-well-microtitre plate with RPMIcompl.medium, containing 5% FCS (GIBCO), 2 mM L-glutamine (SIGMA) and 25 mg/ml penicillin/streptomycin (GIBCO). Liver Liver cells were enzymatically disaggregated using collagenase II. First, the whole organ was covered in Petri dishes with DMEMincompl.medium (GIBCO) and chopped into pieces measuring about 3 mm, then transferred to a sterile Erlenmeyer from which residual fluid was removed. Fresh DMEMcompl. medium (4.5 ml), containing 5% FCS, 2 mM Lglutamine, 25 mg/ml penicillin and streptomycin (GIBCO) and 0.5 ml of collagenase II (2000 U/ml; GIBCO) were added. Tissue pieces were incubated at 37 8C for 30 min on a shaker. After the larger pieces settled down, the supernatant was removed and stored on ice. Fresh DMEMcompl.medium and collagenase were added again to the tissue pieces and incubated. This step was repeated 3–4 times until most of the tissue had disaggregated. Cell
Nitric oxide production in Calomys callosus suspensions were centrifuged and resuspended in fresh DMEMcompl.medium. Viable cells were counted using trypan blue (SIGMA) exclusion and seeded at a density of 2.5!104 cells/well in a 24-well-culture plate.
51 presented as meanGSEM as determined by three RT-PCRs. The significance (P!0.05) of the observed differences was calculated by the Prism GraphPad ver. 3.0 program, using ANOVA one-way analysis of variance and Tukeys multiple comparison test.
Measurement of nitric oxide Cells were cultured in 24-well-flat-bottomed plates at 2.5!104 cells/well (500 ml/well) with or without LPS (1 mg/ml). Cultures were incubated at 37 8C in 5% CO2 for 48 h. Nitric oxide was measured in the supernatants by using the Griess reaction.18 The Griess reagent was prepared by mixing equal volumes of 1% sulfanilamide in 5% H2PO4 and 0.1% naphthylethylene diamine dihydrochloride. Equal amounts of culture supernatant and Griess reagent were combined, and incubated for 10 min at room temperature. Absorbance measured at 540 nm was compared to a sodium nitrite standard curve and data were expressed in mM.
RNA isolation Total RNA was isolated from spleen and liver using TriZol reagent (Invitrogen) following the manufacturer’s instruction. Remnant DNA was digested with DNase I (Fermentas) followed by phenol-chloroform extraction.
iNOS-synthase detection by RT-PCR Equal amounts of total RNA were primed with OligodT primer and reverse transcribed with superscript II (Invitrogen) according to the manufacturer’s instructions. Two sets of primers were used for subsequent PCR of cDNA, actin (F: 5 0 gctacagcttcaccaccaca3 0 ; R: 5 0 aaggaaggctggaaaagagc3 0 ) as an internal loading control and the specific mouse iNOS primer (F: 5 0 ccacaactcgctccaagatt3 0 ; R: 5 0 actactctcctggttaaact3 0 ). After an initial denaturation step at 94 8C for 3 min, the mixture was subjected to 29 cycles as follows: 1 min at 94 8C, 55.2 8C for 1 min for annealing, 72 8C for 2 min for extension. The final extension step was performed for 5 min, 72 8C. PCR products were separated in ethidium bromide agarose gels, and band intensities were quantified by SCION Image for windows. For normalization, actin expression was used as an internal standard.
Statistical analysis Two sets of independent experiments were conducted under identical conditions. Results are
Results Parasitemia in C. callosus and in nontolerant M. musculus C. callosus were infected with either the BOL strain or the BOL-SB T. cruzi strains. As shown in Fig. 1, a later peak of parasitemia (14 days after infection) and a higher parasite burden (27.6!105 trypomastigotes/ml blood) were observed in the animals infected with the BOL strain. A different result was obtained after the infection with the BOL-SB strain, which displayed the highest parasitemia levels already 7 days after infection and a five times lower parasite burden (5.5!105 trypomastigotes/ ml blood). Similar results were observed after the infection of non-tolerant M. musculus with either the BOL or the BOL-SB T. cruzi strains. In this animal, the parasitemia peaks were reached also 14 days after infection with the BOL strain but with a higher parasite burden of about 39.4!106 trypomastigotes/ml blood. Infection with the BOL-SB strain highest parasite burden of 14.5!106 trypomastigotes/ml blood was reached after 7 days of infection (data not shown). After at least 20 days of infection all M. musculus died as a result of the disease.
Figure 1 Parasitemia of C. callosus infected with T. cruzi strain BOL and BOL-SB. Results were polled from three independent experiments with a total of 15–20 animals.
52
NO release in C. callosus liver and spleen cells after infection with T. cruzi strains BOL or BOL-SB The NO production in C. callosus was measured in both liver and spleen cells at different days after infection with the T. cruzi strains BOL and BOL-SB (Figs. 2(A) and (B) and 3(A) and (B)). In liver cells, the highest values of NO production were measured at day 14 after infection with the BOL strain (Fig. 2(B)). Different results in liver cells were obtained after the infection with the BOL-SB strain. In this case, a decrease in NO production was initially observed at days 5 and 7 after infection, followed by and increase at day 12, in which the NO production reached levels similar to non-infected animals (Fig. 2(A)).
C.K. Dost et al. NO production was also measured in spleen cells at different days after infection. This cell type presents much lower endogenous levels of NO production (0.46 mM), when compared to noninfected liver cells (7.3 mM). Furthermore, only the infection with the T. cruzi BOL strain resulted in a significant increase in NO production in C. callosus, 9 and 12 days after infection, whereas a non-significant increase in NO production levels was observed only 12 days after infection with the BOL-SB strain (Fig. 3(A) and (B)). As a positive control, the same set of experiments was performed in which NO production of T. cruzi infected cells was measured after in vitro LPS treatment. The obtained results reveal that both C. callosus liver and spleen cells can produce higher
Figure 2 Nitric oxide production and iNOS mRNA expression levels measured in T. cruzi infected liver cells of C. callosus. Expression of iNOS mRNA was evaluated in M. musculus infected with BOL and BOL-SB at the peak of parasitemia (Mm7; Mm14). Data, meanGSEM, presented densiometric scanning analysis of the electrophoresis gels of two independent experiments, performed in triplicates. (*) exhibit P%0.05 compared to the control animals. d.p.i., days post-infection.
Nitric oxide production in Calomys callosus
53
Figure 3 Nitric oxide production and iNOS expression levels measured in T. cruzi infected spleen cells of C. callosus. Expression of iNOS mRNA was evaluated in M. musculus infected with BOL and BOL-SB at the peak of parasitemia (Mm7; Mm14). Data, meanGSEM, presented densiometric scanning analysis of the electrophoresis gels of two independent experiments, performed in triplicates. (*) exhibit P%0.05 compared to the control animals. d.p.i., days post-infection.
levels of NO when further stimulated (Figs. 2(A) and (B) and 3(A) and (B)).
iNOS mRNA expression in C. callosus liver and spleen cells after infection with T. cruzi strains BOL and BOL-SB Semi-quantitative RT-PCR experiments were performed in order to verify if NO production in C. callosus was accompanied by iNOS mRNA expression, after infection with either the BOL or BOL-SB strains. In C. callosus liver cells, infection with either T. cruzi strain induced a significant increase in the iNOS mRNA expression levels 7 days after infection, when compared to control noninfected animals (Fig. 2(C) and (D)). In C. callosus spleen cells high levels of iNOS mRNA expression
were observed 7 days after infection with the BOLSB strain, whereas the highest levels of iNOS mRNA expression in spleen cells were observed 12 days after infection with the BOL strain (Fig. 3(C) and (D)). The levels of iNOS mRNA expression were also measured at the parasitemia peak in liver and spleen cells of M. musculus, 7 and 14 days after infection with the BOL-SB or the BOL strain, respectively. At day 7, the levels of iNOS mRNA expression in M. musculus liver and spleen cells, infected with the BOL-SB strain, were significantly lower than those observed in C. callosus liver and spleen cells, 7 days after infection with BOL-SB (Figs. 2(C) and 3(C)). The levels of iNOS mRNA expression detected in M. musculus liver and spleen cells 14 days after infection with the BOL strain were not significantly different that those observed
54 14 days after infection in C. callosus liver and spleen cells (Figs. 2(D) and 3(D)).
Discussion Chagas tolerance in C. callosus Presumably, nitric oxide is involved during T. cruzi infections in the proved Chagas tolerance of the sylvatic host C. callosus. There are reports on the protection provided by NO against various infections, but also on detrimental effects due to cytotoxic damage. High NO concentration may result in necrotic lesions followed by organ failure.2,14,34 Induction of increased NO production after infection with T. cruzi has been shown to kill the parasite or at least to inhibit its propagation.13,26 However, these effects have been recently questioned in the case of the acute phase of T. cruzi infestation.3,9 We propose that in C. callosus the well balanced host-parasite relationship could be the result of specific mechanisms by which an overproduction of NO after infection is prevented. Oliveira et al.30 were able to detect NO in the serum of C. callosus infected with T. cruzi, however, it was not possible to measure enhanced production in peritoneal macrophages. In contrast, the same treatment resulted in an increase of NO levels in Swiss mice peritoneal macrophages. In this paper, we have investigated the NO levels in liver and spleen cells, cell types that participate in key reactions to all types of infections by metabolic detoxification and immune response, respectively. We detected NO in both types of cells after infection with T. cruzi strain BOL-SB, but the concentrations did not differ very much from those in cells of uninfected control animals. A slight increase in NO production was only observed in spleen cells, at days 9 and 12 after infection with BOL. These data strongly support the suggestion that, in C. callosus, the parasite T. cruzi does not induce toxic levels of NO and, consequently, only slight histopathological effects result from the infection.6 Strong histopathological effects in infected organs have been consistently correlated with high NO levels in a number of different mouse strains after experimental infection.2,3,14,17,34 Therefore, it is possible that the tolerance of C. callosus towards T. cruzi infestation is due to the production of non-toxic concentrations of NO in liver and spleen cells, which could be participating in more specific responses to parasitic attacks.
C.K. Dost et al.
Is tolerance or sensitivity to T. cruzi infection dependent on iNOS mRNA expression? The comparatively low concentration of NO in T. cruzi infested C. callosus cells raises the question if the induced expression of iNOS might be lacking in this tolerant host. In order to examine this response, which has been described in vertebrates which are sensitive to the infection, we compared the levels of iNOS mRNA expression in liver and spleen cells before and after T. cruzi infection, using RT-PCR. To our surprise, T. cruzi infections caused induction of iNOS mRNA expression not only in the sensitive white mice M. musculus, but also, in the tolerant C. callosus. Because the subsequent NO concentrations in liver and spleen cells differed remarkably, major differences in the control of intracellular NO concentration must exist, which could result in high NO values only in the susceptible host M. musculus. Since in the tolerant C. callosus host high production of NO was not verified, posttranscriptional regulation is assumed to prevent the intracellular increase of NO to toxic concentrations. Perhaps, the already described differences in the iNOS gene may result in iNOS protein instability12,27 or reduced efficacy of iNOS translation.23 Whatever mechanisms results in this protection remains an open question that will require future research. In this sense, C. callosus should continue to be an appropriate model for investigation of Chagas control since it constitutes a natural reservoir host that does not present any disease symptoms.
Acknowledgements This work was supported by Gottlieb Daimler- und Karl Benz-Stiftung, Wilhelm-Schuler-Stiftung and FAPESP.
References 1. Andrada SG, Kloetzel JK, Borges MM, Ferrans VJ. Morphological aspects of myocarditis and myositis in Calomys callosus experimentally infected with Trypanosoma cruzi: fibrogenesis and spontaneous regression of fibrosis. Mem Oswaldo Cruz 1994;89:379–1393. 2. Arantes RME, Marche HHF, Baha MT, Cunha FQ, Rossi MA, Silva JS. Interferon-g-induced nitric oxide causes intrinsic intestinal denervation in Trypanosoma cruzi-infected mices. Am J Pathol 2004;164:1361–8. 3. Basso B, Cervetta L, Moretti E, Carlier Y, Truyens C. Acute Trypanosoma cruzi infection: IL-12, IL-18; TNF; sTNFR and NO in T. rangeli- vaccinated mice. Vaccine 2004;22:1868–72.
Nitric oxide production in Calomys callosus 4. Belda-Neto FM, Ribeiro RD, Albuquerque S, Rosa JA. Considerac ¸o ¸a ˜es o compartamento da infecc ˜o de camundongos por subamostras de Trypanosoma cruzi, atrave ´s de ino ´culos diferenciados por via subcuta ˆnea e intraperitoneal. Rev ˆnc Farm Sa ˜o Paulo 1990;12:141–9. Cie 5. Borges MM, Andrade SG, Pillati CG, Prado Jr JC, Kloetzel JK. Macrophage activation and histopathological findings in Calomys callosus and Swiss mice infected with several strains of Trypanosoma cruzi. Mem Inst Oswaldo Cruz 1992;87:493–502. 6. Borges MM, Vassao R, Andrade SG, Pereira CA, Kloetzel JK. Interferon-gamma levels during the course of Trypanosoma cruzi infection of Calomys callosus (Rodentia-Cricetidae) and Swiss mice. Parasitol Res 1995;81:498–504. 7. Chang CS, Chen WN, Lin HH, Wu CC, Wang CJ. Increased oxidative DNA damage, inducible nitric oxide synthase, nuclear factor kappaB expression and enhanced antiapoptosis-related proteins in Helicobacter pylori-infected noncardiac gastric adenocarcinoma. World J Gastroenterol 2004;10:2232–40. 8. Colasanti M, Suzuki H. The dual personality of NO. Trends Pharmacol Sci 2000;21:249–52. 9. Cummings KL, Tarleton RL. Inducible nitric oxide synthase is not essential for control of Trypanosoma cruzi infection in mice. Infect Immun 2004;4089–98. 10. Docampo R. Recent developments in the chemotherapy of Chagas’ disease. Curr Pharm Des 2001;72:1157–64. 11. Dost CK, Albuquerque S, Hemleben V, Engels W, Prado Jr JC. Molecular genetic characterization of different Trypanosoma cruzi strains and comparison of their development in Mus musculus and Calomys callosus. Parasitol Res 2002;88: 609–16. 12. Felley-Bosco E, Bender FC, Courjault-Gautier F, Bron C, Quest AF. Caveolin-1 down regulates inducible nitric oxide synthase via the proteasome pathway in human colon carcinoma cells. Proc Natl Acad Sci USA 2000;97:14334–9. 13. Fichera LE, Albareda MC, Laucella SA, Postan M. Intracellular growth of Trypanosoma cruzi in cardiac myocytes is inhibited by cytokine-induced nitric oxide release. Infect Immun 2004;72:359–63. 14. Garcia SB, Paula JS, Giovannetti GS, Zenha F, Ramalho EM, Zucoloto S, et al. Nitric oxide is involved in the lesions of the peripheral autonomic neurons observed in the acute phase of experimental Trypanosoma cruzi infection. Exp Parasitol 1999;93:191–7. 15. Gath I, Ebert J, Godtel-Armbrust U, Ross R, Reske-Kunz AB, Forstermann U. NO synthase II in mouse skeletal muscle is associated with caveolin 3. Biochem J 1999;340:723–8. 16. Gazzinelli RT, Oswald JP, hienys S, James SL, Sher A. The microbicidal activity of INF-g treated macrophaes against T. cruzi involves an L-arginine-dependent nitrogen oxidemediated mechanism inhabitable by IL-10 and TGF-b. Eur J Immunol 1992;22:2501–6. 17. Gon ˜i O, Alcaide P, Fresno M. Immunosuppression during acute Trypanosoma cruzi infection: involvement of Ly6G (Gr1C)CD11bC immature myeloid suppressor cells. Int Immunol 2002;14:1125–34. 18. Griess P. Bemerkungen zu der Abhandlung der H.H.Weselsky ¨ ber einige Azoverbindungen’. Chem Ber und Benedikt ‘U 1879;12:426.
55 19. Hibbs Jr JB, Taintor RR, Vavrin Z. Macrophage cytotoxicity: role for L-arginine deiminase and imino nitrogen oxidation to nitrite. Science 1987;235:473–6. 20. Khan IA, Schwartzman JD, Matsuura T, Kasper LH. A dichotomous role for nitric oxide during acute Toxoplasma gondii infection in mice. Proc Natl Acad Sci USA 1997;94: 13955–60. 21. Liew FY, Millot S, Parkinson C, Plamer RMJ, Moncada S. Macrophage killing of Leishmania parasite in vivo is mediated by nitric oxide from L-arginine. J Immunol 1990; 144:4794–7. 22. Liew FY, Moss D, Parkinson C, Rogers MV, Moncada S. Resistance to L. major infections correlates with induction of nitric oxide synthase in murine macrophages. Eur J Imunnol 1991;21:3009–14. 23. Lu ¨ss H, Li RK, Shapiro RA, Tzeng E, McGowan FX, Yoneyama T, et al. Dedifferentiated human ventricular cardiac myocytes express inducible nitric oxide synthase mRNA but not protein in response to IL-1; IFN-g and LPS. J Mol Cell Cardiol 1997;29:1153–65. 24. Martin E, Nathan C, Xie FQ. Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J Exp. Med 1994;180:977–84. 25. Martins GA, Vieira LQ, Cunha FQ, Silva JS. Gamma interferon modulates (CD95/fas) and CD95 ligand (Fas-L) expression and nitric oxide-induced apoptosis during the acute phase of Trypanosoma cruzi infection: a possible role in immune response control. Infect Immun 1999;67:3864–71. 26. Munoz-Fernandez MA, Fernandez MA, Fresno M. Synergism between tumor necrosis factor-alpha and the interferongamma on macrophage activation for the killing of intracellular Trypanosoma cruzi through a nitric oxide dependent mechanism. Eur J Immunol 1992;22:301–7. 27. Musial A, Eissa NT. Inducible nitric-oxide synthase is regulated by the proteasome degradation pathway. J Biol Chem 2001;276:24268–73. 28. Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992;6:3051–64. 29. Nussler AK, Beger HG, Liu ZZ, Billiar TR. Nitric oxide, hepatocytes and inflammation. Res Immunol 1995;146: 671–7. 30. Oliveira LC, Borges MM, Lela RC, Assreuy J, Kloetzel JK. Nitric oxide involvement in the experimental Trypanosoma cruzi infection in Calomys callosus and Swiss mice. Parasitol Res 1997;83:762–70. 31. Prado Jr JC, Levy AMA, Leal MP, Bernard E, Kloetzel JK. Influence of male gonadal hormones on the parasitemia and humoral response of male Calomys callosus infected with the Y strain of Trypanosoma cruzi. Parasitol Res 1999;85: 826–9. 32. Sharton-Kersten TM, Yap J, Magram J, Sher A. Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J Exp Med 1997;185:1261–73. 33. Silva JS, Machado FS, Martins GA. The role of nitric oxide in the pathogenesis of Chagas disease. Font Biosci 2003;8: 314–25. 34. Tan RSP, Kara AU, Feng C, Asano Y, Sinniah R. Differential interleukin-10 expression in interferon regulatory factor-1 deficient mice during Plasmodium berghei blood-stage infection. Parasite Immunol 2000;22:425–35.
www.elsevierhealth.com/journals/jinf
Is nitric oxide involved in the tolerance of Calomys callosus as a reservoir host towards Trypanosoma cruzi infection? C.K. Dosta,b,*, J. Saraivac, U. Zentgrafa, N. Monesic, W. Engelsb, S. Albuquerquec a
¨bingen Lehrstuhl Allgemeine Genetik, ZMBP, University of Tu ¨bingen Lehrstuhl Entwicklungsphysiologie, Zoologisches Institut, University of Tu c ´lises Clinı´cas, Toxicolo ´gicas e Bromatolo ´gicas da Faculdade de Cie ˆncias Departamento de Ana ˆuticas, Ribeira ˜o Preto-USP, Ribeira ˜o Preto, Brazil Farmace b
Accepted 1 February 2005 Available online 5 April 2005
KEYWORDS Trypanosoma cruzi; Nitric oxide; Calomys callosus; Chagas disease; Resistance
Summary Trypanosoma cruzi, the agent of Chagas disease, is known to cause enhanced nitric oxide (NO) production, which might be involved in host resistance. The inducible nitric-oxide-synthase (iNOS) is assumed to be responsible for the NO increase after several infections. We studied the potential role of NO in Calomys callosus, a natural reservoir of this protozoan parasite. The concentration of NO was determined in spleen and liver of animals infected with two different T. cruzi strains, BOL and BOL-SB. Furthermore, the iNOS mRNA expression was quantified in the same cell types. NO production was detectable in both tissues exhibiting only slight differences compared to non-infected controls. All measured NO values were significantly lower than those reported for a number of different mouse strains, which displayed extremely enhanced NO levels after T. cruzi infection. Surprisingly, iNOS mRNA expression was induced in infected C. callosus but without subsequent increase of NO levels, indicating a post-transcriptional regulation mechanism. In summary, our results, indicate that the tolerance of C. callosus to T. cruzi is only accompanied by non-toxic NO intracellular concentrations. Q 2005 The British Infection Society. Published by Elsevier Ltd. All rights reserved.
Introduction
* Corresponding author. Tel.: C55 7071 2978851; fax: C55 7071 295042. E-mail address: [email protected] (C.K. Dost).
Infections with the protozoan parasite Trypanosoma cruzi, the causative agent of Chagas disease, affect numerous inhabitants of South and Central America. At present, about 13 million people are infected, of which 3.0–3.3 million consist of
0163-4453/$30.00 Q 2005 The British Infection Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.jinf.2005.02.003
50 symptomatic cases. The annual incidence is 200 000 new cases in 15 countries (WHO, 2003). The parasite has a complex life-cycle including different developmental stages, which permits its adaption to very diverse host environments. In vertebrates, T. cruzi invades different cell types, including macrophages and is capable to replicate inside them. Up to now no vaccine or efficient therapy is available. The two drugs employed in clinical treatment, benznidazole and nifurtimox, are badly tolerated and their use results of severe side effects.10 T. cruzi infection is followed by the activation of immune factors, like T-cells as important sources of cytokines (INF-g), B-cells releasing antibodies, and macrophages which not only phagocyte the trypomastigotes, but also produce of nitric oxide (NO). Several other cell types, like fibroblasts, Kupffer’s cells, hepatocytes, epithelial cells and smooth muscle cells have been described as capable of producing NO.28,29 This highly reactive molecule has microbicidial and cytostatic effects, and plays a role in the cell mediated immune response to parasite infections, as already shown for T. cruzi,16 Leishmania spec.21,22 and Toxoplamsa gondii.20,32 Resistance against such protozoan depends on both the INF-g induction and NO production.25,33 The latter is catalyzed by NO-synthases (NOS) of which the endothelial (eNOS) and the neuronal (nNOS) forms are constitutively expressed and calcium dependent. However, the inducible isoform (iNOS) is calcium independent and is not detectable in uninfected white mice.15 This has been clearly demonstrated by in vitro stimulation with LPS, which leads to an enhanced production of NO.19,24 Besides the normal physiological role of NO and its contribution in the defence of various infections, high NO concentrations are damaging the cells and also seem to be involved in the pathophysiology of human diseases.7,8 In this sense, NO can be considered a double-edged sword. Calomys callosus, a wild neotropical rodent, is a natural reservoir host tolerant to T. cruzi infection.1,5,30,31 In contrast, experimental infection of Mus musculus with the Chagas agent results in high mortality of these animals within some weeks,11 accompanied by several histological alterations.6 We used the naturally tolerant model C. callosus to investigate the NO production in spleen and liver cells. In this study we employed T. cruzi strains BOL and BOL-SB4 which belong to groups I and II, respectively, characterized by distinct biological properties.11 The data were compared with already characterized reactions of non-tolerant mice.3,17 In addition, we determined iNOS mRNA expression levels during the infection in both C. callosus and M. musculus in order to better understand the mechanisms of tolerance towards Chagas disease.
C.K. Dost et al.
Material and methods Animals Male C. callosus were infected i.p. with blood samples containing 4!103 trypomastigotes. The time course of parasitemia after infection was assessed by microscopic examination of thin blood films of tail bleeds.
Parasites The T. cruzi strains BOL, belonging to group I, and BOL-SB of group II, which are characterized by distinct biological properties11 were used. The strains were maintained in the laboratory by serial blood passages in mice. Analyzes were performed at the following days after infection: BOL-SB days 5, 7, 12, 14 and 45, BOL days 7, 9, 12, 14 and 45.
Primary cell cultures Spleen and liver from infected and control animals were dissected and washed in sterile PBS, at different days of infection. Spleen For separation of splenocytes, the whole organ was covered with RPMIincompl.medium (GIBCO) and mechanically disaggregated by using a polypropylene sieve as previously described. Viable cells were counted by exclusion of trypan blue (SIGMA) in a Neubauer Hemacytometer and seeded at a density of 2, 5!104 cells/well in a 24-well-microtitre plate with RPMIcompl.medium, containing 5% FCS (GIBCO), 2 mM L-glutamine (SIGMA) and 25 mg/ml penicillin/streptomycin (GIBCO). Liver Liver cells were enzymatically disaggregated using collagenase II. First, the whole organ was covered in Petri dishes with DMEMincompl.medium (GIBCO) and chopped into pieces measuring about 3 mm, then transferred to a sterile Erlenmeyer from which residual fluid was removed. Fresh DMEMcompl. medium (4.5 ml), containing 5% FCS, 2 mM Lglutamine, 25 mg/ml penicillin and streptomycin (GIBCO) and 0.5 ml of collagenase II (2000 U/ml; GIBCO) were added. Tissue pieces were incubated at 37 8C for 30 min on a shaker. After the larger pieces settled down, the supernatant was removed and stored on ice. Fresh DMEMcompl.medium and collagenase were added again to the tissue pieces and incubated. This step was repeated 3–4 times until most of the tissue had disaggregated. Cell
Nitric oxide production in Calomys callosus suspensions were centrifuged and resuspended in fresh DMEMcompl.medium. Viable cells were counted using trypan blue (SIGMA) exclusion and seeded at a density of 2.5!104 cells/well in a 24-well-culture plate.
51 presented as meanGSEM as determined by three RT-PCRs. The significance (P!0.05) of the observed differences was calculated by the Prism GraphPad ver. 3.0 program, using ANOVA one-way analysis of variance and Tukeys multiple comparison test.
Measurement of nitric oxide Cells were cultured in 24-well-flat-bottomed plates at 2.5!104 cells/well (500 ml/well) with or without LPS (1 mg/ml). Cultures were incubated at 37 8C in 5% CO2 for 48 h. Nitric oxide was measured in the supernatants by using the Griess reaction.18 The Griess reagent was prepared by mixing equal volumes of 1% sulfanilamide in 5% H2PO4 and 0.1% naphthylethylene diamine dihydrochloride. Equal amounts of culture supernatant and Griess reagent were combined, and incubated for 10 min at room temperature. Absorbance measured at 540 nm was compared to a sodium nitrite standard curve and data were expressed in mM.
RNA isolation Total RNA was isolated from spleen and liver using TriZol reagent (Invitrogen) following the manufacturer’s instruction. Remnant DNA was digested with DNase I (Fermentas) followed by phenol-chloroform extraction.
iNOS-synthase detection by RT-PCR Equal amounts of total RNA were primed with OligodT primer and reverse transcribed with superscript II (Invitrogen) according to the manufacturer’s instructions. Two sets of primers were used for subsequent PCR of cDNA, actin (F: 5 0 gctacagcttcaccaccaca3 0 ; R: 5 0 aaggaaggctggaaaagagc3 0 ) as an internal loading control and the specific mouse iNOS primer (F: 5 0 ccacaactcgctccaagatt3 0 ; R: 5 0 actactctcctggttaaact3 0 ). After an initial denaturation step at 94 8C for 3 min, the mixture was subjected to 29 cycles as follows: 1 min at 94 8C, 55.2 8C for 1 min for annealing, 72 8C for 2 min for extension. The final extension step was performed for 5 min, 72 8C. PCR products were separated in ethidium bromide agarose gels, and band intensities were quantified by SCION Image for windows. For normalization, actin expression was used as an internal standard.
Statistical analysis Two sets of independent experiments were conducted under identical conditions. Results are
Results Parasitemia in C. callosus and in nontolerant M. musculus C. callosus were infected with either the BOL strain or the BOL-SB T. cruzi strains. As shown in Fig. 1, a later peak of parasitemia (14 days after infection) and a higher parasite burden (27.6!105 trypomastigotes/ml blood) were observed in the animals infected with the BOL strain. A different result was obtained after the infection with the BOL-SB strain, which displayed the highest parasitemia levels already 7 days after infection and a five times lower parasite burden (5.5!105 trypomastigotes/ ml blood). Similar results were observed after the infection of non-tolerant M. musculus with either the BOL or the BOL-SB T. cruzi strains. In this animal, the parasitemia peaks were reached also 14 days after infection with the BOL strain but with a higher parasite burden of about 39.4!106 trypomastigotes/ml blood. Infection with the BOL-SB strain highest parasite burden of 14.5!106 trypomastigotes/ml blood was reached after 7 days of infection (data not shown). After at least 20 days of infection all M. musculus died as a result of the disease.
Figure 1 Parasitemia of C. callosus infected with T. cruzi strain BOL and BOL-SB. Results were polled from three independent experiments with a total of 15–20 animals.
52
NO release in C. callosus liver and spleen cells after infection with T. cruzi strains BOL or BOL-SB The NO production in C. callosus was measured in both liver and spleen cells at different days after infection with the T. cruzi strains BOL and BOL-SB (Figs. 2(A) and (B) and 3(A) and (B)). In liver cells, the highest values of NO production were measured at day 14 after infection with the BOL strain (Fig. 2(B)). Different results in liver cells were obtained after the infection with the BOL-SB strain. In this case, a decrease in NO production was initially observed at days 5 and 7 after infection, followed by and increase at day 12, in which the NO production reached levels similar to non-infected animals (Fig. 2(A)).
C.K. Dost et al. NO production was also measured in spleen cells at different days after infection. This cell type presents much lower endogenous levels of NO production (0.46 mM), when compared to noninfected liver cells (7.3 mM). Furthermore, only the infection with the T. cruzi BOL strain resulted in a significant increase in NO production in C. callosus, 9 and 12 days after infection, whereas a non-significant increase in NO production levels was observed only 12 days after infection with the BOL-SB strain (Fig. 3(A) and (B)). As a positive control, the same set of experiments was performed in which NO production of T. cruzi infected cells was measured after in vitro LPS treatment. The obtained results reveal that both C. callosus liver and spleen cells can produce higher
Figure 2 Nitric oxide production and iNOS mRNA expression levels measured in T. cruzi infected liver cells of C. callosus. Expression of iNOS mRNA was evaluated in M. musculus infected with BOL and BOL-SB at the peak of parasitemia (Mm7; Mm14). Data, meanGSEM, presented densiometric scanning analysis of the electrophoresis gels of two independent experiments, performed in triplicates. (*) exhibit P%0.05 compared to the control animals. d.p.i., days post-infection.
Nitric oxide production in Calomys callosus
53
Figure 3 Nitric oxide production and iNOS expression levels measured in T. cruzi infected spleen cells of C. callosus. Expression of iNOS mRNA was evaluated in M. musculus infected with BOL and BOL-SB at the peak of parasitemia (Mm7; Mm14). Data, meanGSEM, presented densiometric scanning analysis of the electrophoresis gels of two independent experiments, performed in triplicates. (*) exhibit P%0.05 compared to the control animals. d.p.i., days post-infection.
levels of NO when further stimulated (Figs. 2(A) and (B) and 3(A) and (B)).
iNOS mRNA expression in C. callosus liver and spleen cells after infection with T. cruzi strains BOL and BOL-SB Semi-quantitative RT-PCR experiments were performed in order to verify if NO production in C. callosus was accompanied by iNOS mRNA expression, after infection with either the BOL or BOL-SB strains. In C. callosus liver cells, infection with either T. cruzi strain induced a significant increase in the iNOS mRNA expression levels 7 days after infection, when compared to control noninfected animals (Fig. 2(C) and (D)). In C. callosus spleen cells high levels of iNOS mRNA expression
were observed 7 days after infection with the BOLSB strain, whereas the highest levels of iNOS mRNA expression in spleen cells were observed 12 days after infection with the BOL strain (Fig. 3(C) and (D)). The levels of iNOS mRNA expression were also measured at the parasitemia peak in liver and spleen cells of M. musculus, 7 and 14 days after infection with the BOL-SB or the BOL strain, respectively. At day 7, the levels of iNOS mRNA expression in M. musculus liver and spleen cells, infected with the BOL-SB strain, were significantly lower than those observed in C. callosus liver and spleen cells, 7 days after infection with BOL-SB (Figs. 2(C) and 3(C)). The levels of iNOS mRNA expression detected in M. musculus liver and spleen cells 14 days after infection with the BOL strain were not significantly different that those observed
54 14 days after infection in C. callosus liver and spleen cells (Figs. 2(D) and 3(D)).
Discussion Chagas tolerance in C. callosus Presumably, nitric oxide is involved during T. cruzi infections in the proved Chagas tolerance of the sylvatic host C. callosus. There are reports on the protection provided by NO against various infections, but also on detrimental effects due to cytotoxic damage. High NO concentration may result in necrotic lesions followed by organ failure.2,14,34 Induction of increased NO production after infection with T. cruzi has been shown to kill the parasite or at least to inhibit its propagation.13,26 However, these effects have been recently questioned in the case of the acute phase of T. cruzi infestation.3,9 We propose that in C. callosus the well balanced host-parasite relationship could be the result of specific mechanisms by which an overproduction of NO after infection is prevented. Oliveira et al.30 were able to detect NO in the serum of C. callosus infected with T. cruzi, however, it was not possible to measure enhanced production in peritoneal macrophages. In contrast, the same treatment resulted in an increase of NO levels in Swiss mice peritoneal macrophages. In this paper, we have investigated the NO levels in liver and spleen cells, cell types that participate in key reactions to all types of infections by metabolic detoxification and immune response, respectively. We detected NO in both types of cells after infection with T. cruzi strain BOL-SB, but the concentrations did not differ very much from those in cells of uninfected control animals. A slight increase in NO production was only observed in spleen cells, at days 9 and 12 after infection with BOL. These data strongly support the suggestion that, in C. callosus, the parasite T. cruzi does not induce toxic levels of NO and, consequently, only slight histopathological effects result from the infection.6 Strong histopathological effects in infected organs have been consistently correlated with high NO levels in a number of different mouse strains after experimental infection.2,3,14,17,34 Therefore, it is possible that the tolerance of C. callosus towards T. cruzi infestation is due to the production of non-toxic concentrations of NO in liver and spleen cells, which could be participating in more specific responses to parasitic attacks.
C.K. Dost et al.
Is tolerance or sensitivity to T. cruzi infection dependent on iNOS mRNA expression? The comparatively low concentration of NO in T. cruzi infested C. callosus cells raises the question if the induced expression of iNOS might be lacking in this tolerant host. In order to examine this response, which has been described in vertebrates which are sensitive to the infection, we compared the levels of iNOS mRNA expression in liver and spleen cells before and after T. cruzi infection, using RT-PCR. To our surprise, T. cruzi infections caused induction of iNOS mRNA expression not only in the sensitive white mice M. musculus, but also, in the tolerant C. callosus. Because the subsequent NO concentrations in liver and spleen cells differed remarkably, major differences in the control of intracellular NO concentration must exist, which could result in high NO values only in the susceptible host M. musculus. Since in the tolerant C. callosus host high production of NO was not verified, posttranscriptional regulation is assumed to prevent the intracellular increase of NO to toxic concentrations. Perhaps, the already described differences in the iNOS gene may result in iNOS protein instability12,27 or reduced efficacy of iNOS translation.23 Whatever mechanisms results in this protection remains an open question that will require future research. In this sense, C. callosus should continue to be an appropriate model for investigation of Chagas control since it constitutes a natural reservoir host that does not present any disease symptoms.
Acknowledgements This work was supported by Gottlieb Daimler- und Karl Benz-Stiftung, Wilhelm-Schuler-Stiftung and FAPESP.
References 1. Andrada SG, Kloetzel JK, Borges MM, Ferrans VJ. Morphological aspects of myocarditis and myositis in Calomys callosus experimentally infected with Trypanosoma cruzi: fibrogenesis and spontaneous regression of fibrosis. Mem Oswaldo Cruz 1994;89:379–1393. 2. Arantes RME, Marche HHF, Baha MT, Cunha FQ, Rossi MA, Silva JS. Interferon-g-induced nitric oxide causes intrinsic intestinal denervation in Trypanosoma cruzi-infected mices. Am J Pathol 2004;164:1361–8. 3. Basso B, Cervetta L, Moretti E, Carlier Y, Truyens C. Acute Trypanosoma cruzi infection: IL-12, IL-18; TNF; sTNFR and NO in T. rangeli- vaccinated mice. Vaccine 2004;22:1868–72.
Nitric oxide production in Calomys callosus 4. Belda-Neto FM, Ribeiro RD, Albuquerque S, Rosa JA. Considerac ¸o ¸a ˜es o compartamento da infecc ˜o de camundongos por subamostras de Trypanosoma cruzi, atrave ´s de ino ´culos diferenciados por via subcuta ˆnea e intraperitoneal. Rev ˆnc Farm Sa ˜o Paulo 1990;12:141–9. Cie 5. Borges MM, Andrade SG, Pillati CG, Prado Jr JC, Kloetzel JK. Macrophage activation and histopathological findings in Calomys callosus and Swiss mice infected with several strains of Trypanosoma cruzi. Mem Inst Oswaldo Cruz 1992;87:493–502. 6. Borges MM, Vassao R, Andrade SG, Pereira CA, Kloetzel JK. Interferon-gamma levels during the course of Trypanosoma cruzi infection of Calomys callosus (Rodentia-Cricetidae) and Swiss mice. Parasitol Res 1995;81:498–504. 7. Chang CS, Chen WN, Lin HH, Wu CC, Wang CJ. Increased oxidative DNA damage, inducible nitric oxide synthase, nuclear factor kappaB expression and enhanced antiapoptosis-related proteins in Helicobacter pylori-infected noncardiac gastric adenocarcinoma. World J Gastroenterol 2004;10:2232–40. 8. Colasanti M, Suzuki H. The dual personality of NO. Trends Pharmacol Sci 2000;21:249–52. 9. Cummings KL, Tarleton RL. Inducible nitric oxide synthase is not essential for control of Trypanosoma cruzi infection in mice. Infect Immun 2004;4089–98. 10. Docampo R. Recent developments in the chemotherapy of Chagas’ disease. Curr Pharm Des 2001;72:1157–64. 11. Dost CK, Albuquerque S, Hemleben V, Engels W, Prado Jr JC. Molecular genetic characterization of different Trypanosoma cruzi strains and comparison of their development in Mus musculus and Calomys callosus. Parasitol Res 2002;88: 609–16. 12. Felley-Bosco E, Bender FC, Courjault-Gautier F, Bron C, Quest AF. Caveolin-1 down regulates inducible nitric oxide synthase via the proteasome pathway in human colon carcinoma cells. Proc Natl Acad Sci USA 2000;97:14334–9. 13. Fichera LE, Albareda MC, Laucella SA, Postan M. Intracellular growth of Trypanosoma cruzi in cardiac myocytes is inhibited by cytokine-induced nitric oxide release. Infect Immun 2004;72:359–63. 14. Garcia SB, Paula JS, Giovannetti GS, Zenha F, Ramalho EM, Zucoloto S, et al. Nitric oxide is involved in the lesions of the peripheral autonomic neurons observed in the acute phase of experimental Trypanosoma cruzi infection. Exp Parasitol 1999;93:191–7. 15. Gath I, Ebert J, Godtel-Armbrust U, Ross R, Reske-Kunz AB, Forstermann U. NO synthase II in mouse skeletal muscle is associated with caveolin 3. Biochem J 1999;340:723–8. 16. Gazzinelli RT, Oswald JP, hienys S, James SL, Sher A. The microbicidal activity of INF-g treated macrophaes against T. cruzi involves an L-arginine-dependent nitrogen oxidemediated mechanism inhabitable by IL-10 and TGF-b. Eur J Immunol 1992;22:2501–6. 17. Gon ˜i O, Alcaide P, Fresno M. Immunosuppression during acute Trypanosoma cruzi infection: involvement of Ly6G (Gr1C)CD11bC immature myeloid suppressor cells. Int Immunol 2002;14:1125–34. 18. Griess P. Bemerkungen zu der Abhandlung der H.H.Weselsky ¨ ber einige Azoverbindungen’. Chem Ber und Benedikt ‘U 1879;12:426.
55 19. Hibbs Jr JB, Taintor RR, Vavrin Z. Macrophage cytotoxicity: role for L-arginine deiminase and imino nitrogen oxidation to nitrite. Science 1987;235:473–6. 20. Khan IA, Schwartzman JD, Matsuura T, Kasper LH. A dichotomous role for nitric oxide during acute Toxoplasma gondii infection in mice. Proc Natl Acad Sci USA 1997;94: 13955–60. 21. Liew FY, Millot S, Parkinson C, Plamer RMJ, Moncada S. Macrophage killing of Leishmania parasite in vivo is mediated by nitric oxide from L-arginine. J Immunol 1990; 144:4794–7. 22. Liew FY, Moss D, Parkinson C, Rogers MV, Moncada S. Resistance to L. major infections correlates with induction of nitric oxide synthase in murine macrophages. Eur J Imunnol 1991;21:3009–14. 23. Lu ¨ss H, Li RK, Shapiro RA, Tzeng E, McGowan FX, Yoneyama T, et al. Dedifferentiated human ventricular cardiac myocytes express inducible nitric oxide synthase mRNA but not protein in response to IL-1; IFN-g and LPS. J Mol Cell Cardiol 1997;29:1153–65. 24. Martin E, Nathan C, Xie FQ. Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J Exp. Med 1994;180:977–84. 25. Martins GA, Vieira LQ, Cunha FQ, Silva JS. Gamma interferon modulates (CD95/fas) and CD95 ligand (Fas-L) expression and nitric oxide-induced apoptosis during the acute phase of Trypanosoma cruzi infection: a possible role in immune response control. Infect Immun 1999;67:3864–71. 26. Munoz-Fernandez MA, Fernandez MA, Fresno M. Synergism between tumor necrosis factor-alpha and the interferongamma on macrophage activation for the killing of intracellular Trypanosoma cruzi through a nitric oxide dependent mechanism. Eur J Immunol 1992;22:301–7. 27. Musial A, Eissa NT. Inducible nitric-oxide synthase is regulated by the proteasome degradation pathway. J Biol Chem 2001;276:24268–73. 28. Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992;6:3051–64. 29. Nussler AK, Beger HG, Liu ZZ, Billiar TR. Nitric oxide, hepatocytes and inflammation. Res Immunol 1995;146: 671–7. 30. Oliveira LC, Borges MM, Lela RC, Assreuy J, Kloetzel JK. Nitric oxide involvement in the experimental Trypanosoma cruzi infection in Calomys callosus and Swiss mice. Parasitol Res 1997;83:762–70. 31. Prado Jr JC, Levy AMA, Leal MP, Bernard E, Kloetzel JK. Influence of male gonadal hormones on the parasitemia and humoral response of male Calomys callosus infected with the Y strain of Trypanosoma cruzi. Parasitol Res 1999;85: 826–9. 32. Sharton-Kersten TM, Yap J, Magram J, Sher A. Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J Exp Med 1997;185:1261–73. 33. Silva JS, Machado FS, Martins GA. The role of nitric oxide in the pathogenesis of Chagas disease. Font Biosci 2003;8: 314–25. 34. Tan RSP, Kara AU, Feng C, Asano Y, Sinniah R. Differential interleukin-10 expression in interferon regulatory factor-1 deficient mice during Plasmodium berghei blood-stage infection. Parasite Immunol 2000;22:425–35.