- Email: [email protected]
Is Still's disease associated with parvovirus B19 infection?
*Normal=18-15; tnormal=++/+++. SD=Still’s disease; RA=rheumatoid arthritis; F=female; M=male.
Table: Features and bone marrow iron status in Still’s disease and rheumatoid arthritis patients.
5-8) showing normal erythroblastic iron values, as well as in RA with iron-deficiency anaemia (patients 9-11) showing reduced erythroblastic and non-erythroblastic iron stores. In fact, the picture in adult Still’s disease suggests iron-deficient erythropoiesis despite normal or increased nonerythroblastic iron stores. This deficiency could be ascribed to different cytokine profiles in this disease and RA leading to different types of chronic anaemia.2 Oral ferrous sulphate (1-05 g per day for 6 weeks) did not increase haemoglobin values. Intravenous iron saccharate (50 mg on alternate days for 6 weeks) increased haemoglobin by more than 1 g/dL in Still’s disease as well as in RA patients with iron deficiency; however, it was ineffective in RA patients with normal iron stores. This treatment was not accompanied by much variation of disease
activity. Our data suggest that low-dose intravenous iron could be effective in Still’s disease even in anaemic patients with normal or increased iron stores. Intravenous iron could by-pass macrophage trapping, thus being directly available for erythropoiesis. Finally, no important sideeffects or disease flares were seen during intravenous iron saccharate treatment, as Martini and colleagues also
reported. *Carlomaurizio Montecucco, Roberto Caporali,
Rosangela Invernizzi Terapia Medica
1
2
e
Clinica Medica II, University of Pavia, 27100 Pavia,
Italy
Invernizzi R, Cazzola M, DeFazio P, Rosti V, Ruggeri G, Arosio P. Immunochemical detection of ferritin in human bone marrow and peripheral blood cells using monoclonal antibodies specific for the H and L subunit. Br J Haematol 1990; 76: 427-32. Means RT Jr, Krantz SB. Progress in understanding the pathogenesis of the anemia of chronic diseases. Blood 1992; 80: 1639-47.
Is Still’s disease associated with B19 infection?
parvovirus
SiR-Adult Still’s disease is a febrile disorder of unknown origin characterised by spiking fever with rash and arthralgia or arthritis.’ Several isolated reports have suggested the role of an infectious trigger in its pathogenesis. Similarities between Still’s disease and parvovirus B19 infection are striking and include fever, myalgia, arthritis, rash, lymphadenopathy, and sore throat. Pouchot et aP reported a case of adult Still’s disease associated with acute parvovirus B19 infection. They concluded that parvovirus B19 should be added to the list of aetiological agents of Still’s disease. To test this hypothesis, we attempted to find serological and
*Duration of Still’s disease at time of
serological testing for parvovirus B19. optical density in ELISA; threshold of
Numbers within parentheses are values of positivity is 0.18. SD=Still’s disease.
Table: Patients’ characteristics and results of B19 and PCR
serology
biomolecular evidence of parvovirus B19 infection in adults with Still’s disease. We studied 13 patients with adult-onset Still’s disease and 1 adult diagnosed with Still’s disease when 10 years old. Serum antibodies against parvovirus B19 antigens were determined in every patient by enzymoimmunoassay with B19 capsid proteins (VP1-VP2) for IgM,3 and a commercial ELISA Biotrin test with B19 capsid protein VP1for IgG. Sera were tested for DNA sequences specific for parvovirus B19 by PCR amplification.4 In a first group of 7 patients (patients 1-7), serological tests and PCR tests for B19specific DNA sequences were done within 8 weeks of onset of Still’s disease. The remaining patients (patients 8-14) were tested more than 12 months (12-192 months) after the onset of Still’s disease. The results are summarised in the table. All three tests were negative (no IgM and IgG B 19 antibodies and no B 19specific DNA sequences detected) for 5 patients (patients 1, 2, 3, 8, 9) indicating no contact with parvovirus B19. In the 9 other patients (4 patients of the first group and 5 patients of the second group), only IgG antibodies were detected indicating past infection. All 9 scored negative for IgM antibodies and B19-specific DNA sequences. We have ruled out any association between Still’s disease and parvovirus B19 infection in 5 of our 14 patients (patients 1, 2, 3, 8,9), indicating that the virus cannot be the sole aetiological agent of Still’s disease. In the 9 other patients, we found only serological markers of past B19 infection. Our results thus do not support an association between Still’s disease and parvovirus B19 replication. *Bertrand Godeau, Elisabeth Palazzo, Fredéric Morinet, Martine Deplanche, Lionel Deforge, Annette Schaeffer, Marcel-Francis Kahn Service de Médecine Interne I, Hôpital Henri Mondor, 94010 Créteil, France; Service de Rhumatologie, Hôpital Bichat/Claude Bernard, Paris; Service de Microbiologie, Hôpital Saint Louis, Paris; and Service de Microbiologie, Hôpital Henri Mondor
1
2
Pouchot J,
Sampalis J, Beaudet F, et al. Adult Still’s disease: manifestations, disease course, and outcome in 62 patients. Medicine 1991; 70: 118-36. Pouchot J, Ouakil H, Debin ML, Vinceneux P. Adult Still’s disease associated with acute human parvovirus B19 infection. Lancet 1993; 341: 1280-81.
59
Morinet F, Courouce AM, Galibert F, Peyrol Y. The use of labeled fusion protein for detection of B 19 parvovirus IgM antibodies by immunocapture test. J Virol Methods 1991; 31: 21-30. Belloy M, Morinet F, Blondin G, Courouce AM, Peyrol Y, Vilmer E. Erythroid hypoplasia due to chronic infection with parvovirus B19. N Engl J Med 1990; 322: 633-34.
3
4
Screening for codon 249 p53 mutation in lung associated with domestic radon exposure cancer
SIR-It has been suggested that radon may be an important environmental cause of lung cancer,’ Taylor and colleagues have identified an AGG to ATG transversion at codon 249 of the p53 gene in a high proportion of lung cancers from uranium miners with high radon exposure and have suggested that this mutation may be a marker for radiationinduced lung cancer.2 In this study, we have attempted to identify this mutation in lung cancer tissues from a number of individuals with known domestic radon exposure. As part of an ongoing case-control study of radon and lung cancer in southwest England, cases of lung cancer referred to the five main treatment centres in Devon and Cornwall were identified during a 4-year period and, for each case, concentrations of radon gas were measured in current and previous homes over a 6-month period using track-etched detectors supplied by the National Radiological Protection Board. Based on data accrued up to February, 1994, 30 cases were identified who had experienced an average domestic radon concentration of at least 200 Bq/m3 (ie, the recommended action level for the UK) over the previous 15 years; 118 cases were identified who had lived in a single house with a radon concentration of less than 20 Bq/m3 for at least 15 years; and 14 additional cases were identified with intermediate exposure and who were lifelong non-smokers. For this pilot study, lung cancer specimens were obtained from 21 cases: 9 in the high-exposure group including one lifelong non-smoker, 10 in the low-exposure group, and 2 lifelong non-smokers with intermediate exposure
Paraffin wax embedded lung cancer tissues were prepared for amplification with PCR as previously describedby use of nested amplification primers located in the intron sequences flanking exon 7 where codon 249 resides. Amplification products were obtained from 17 of the 21 cases, consistent with the previously reported success rate for PCR from paraffin embedded tissues. Two techniques were used to detect the codon 249 mutation: restriction analysis of the PCR products using BsaBI which recognises only the mutant sequence, as done by Taylor et al,2 and detection of the mutation using the amplification refractory mutation system (ARMS). The latter system was chosen because it allows the preferential amplification of the mutant sequence and the resulting system is able to detect 1 copy of the mutant sequence amongst 104 normal cells. None of the 17 cases of lung cancer showed evidence of the presence of the codon 249 mutation by either method of analysis. Our results, therefore, are more analogous to the results of Vakakangas and colleagues4 who did not find the codon 249 mutation in any of their lung cancer specimens from uranium miners. However, the radiation levels in Vakakangas and colleagues’ study and in our series are much lower than that of Taylor et al and may reflect a doseresponse relation for the codon 249 mutations. Another possibility might be that the codon 249 mutation is related to other environmental factors, such as mycotoxins,5 which could be in the uranium mines in Colorado. We thank the pathologists, laboratory and research staff, interviewers, colleagues at the National Radiological Protection Board, and physicians who have taken part in this study. We also thank Dr Takashi Takahashi for help during the project. This study is supported by the University of Oxford, ICRF, the European Commission, the Department of Health, the Department of the Environment, and the National Radiological Protection Board. YMDL is a Wellcome Career Development Fellow.
*Y M D Lo, S Darby, L K A Fleming, J I Bell
Noakes, E Whitley, P B S Silcocks,
*Nuffield Department of Clinical Medicine, Room 7501 John Radcliffe Hospital, Oxford OX3 9DU; ICRF Cancer Epidemiology Unit, Radcliffe Infirmary, Oxford; Department of Public Health Medicine, University of Sheffield; and Nuffield Department of Patholoogy, John Radcliffe Hospital, Oxford
(table). 1 2
Peto J, Darby S. Radon risk reassessed. Nature 1994; 368: 97-98. Taylor JA, Watson MA, Devereux TR, Michels RY, Saccomanno G, Anderson M. p53 mutation hotspot in radon-associated lung cancer. Lancet
3
4
5
1994; 343: 86-87. Lo ESF, Lo YMD, Tse CH, Fleming KA. Detection of hepatitis B pre-core mutant by allele specific polymerase chain reaction. J Clin Pathol 1992; 45: 689-92. Vähäkangas KH, Samet JM, Metcalf RA, et al. Mutations of p53 and ras genes in radon-associated lung cancer from uranium miners. Lancet 1992; 339: 576-80. Venitt S, Biggs PJ. Radon, mycotoxins, p53, and uranium mining. Lancet 1994; 343: 795.
Reversal of brain metabolic alterations with zidovudine detected by proton localised
magnetic
SQ=squamous cell cancer, AD=adenocarcmoma, UN=undifferentiated. WI_M=workmglevel months, CU (n)=current smoker who smokes n cigarettes per day, NS=never smoked regularly. EX (n)=ex-smoker who gave up n years ago. Radon exposure is expressed as time-weighted average domestic radon gas concentration m homes occupied by subject over previous 15 years (Bq/m3). or as cumulative exposure during past 15 years assuming equilibrium factor of 0-8 (WLM). No amplification products were obtained from patients 1, 6. 7. and 8. Mutation-specific PCR was earned out with ARMS primer 249M (5’GATGATGGTGAGGATGGGCA3’, antisense)) and an unpstram non-ARMS primer (5’AGGCGCACTGGCCTCATCTT3’, sense) at an annealing temperature of 55’C.’
Table:
60
Lung
cancer cases
with known domestic radon exposure
resonance
spectroscopy
SiR-Proton localised magnetic resonance spectroscopy (MRS) of the brain provides non-invasive exploration of intracerebral metabolism in vivo’ and has been used to analyse the metabolic modifications occurring in brains of patients with AIDS dementia complex (ADC).2-4 However whether or not ADC always encompasses neuronal death is unclear. We studied brain metabolism in 3 patients with ADC by use of proton MRS with a Siemens Magnetom SP63 (1-5 T) as previously described.4 Proton MR spectra of the brain were recorded at 63 MHz by use of spin-echo sequence (echo time 135 ms), after standard magnetic resonance imaging (MRI). The
Table: Features and bone marrow iron status in Still’s disease and rheumatoid arthritis patients.
5-8) showing normal erythroblastic iron values, as well as in RA with iron-deficiency anaemia (patients 9-11) showing reduced erythroblastic and non-erythroblastic iron stores. In fact, the picture in adult Still’s disease suggests iron-deficient erythropoiesis despite normal or increased nonerythroblastic iron stores. This deficiency could be ascribed to different cytokine profiles in this disease and RA leading to different types of chronic anaemia.2 Oral ferrous sulphate (1-05 g per day for 6 weeks) did not increase haemoglobin values. Intravenous iron saccharate (50 mg on alternate days for 6 weeks) increased haemoglobin by more than 1 g/dL in Still’s disease as well as in RA patients with iron deficiency; however, it was ineffective in RA patients with normal iron stores. This treatment was not accompanied by much variation of disease
activity. Our data suggest that low-dose intravenous iron could be effective in Still’s disease even in anaemic patients with normal or increased iron stores. Intravenous iron could by-pass macrophage trapping, thus being directly available for erythropoiesis. Finally, no important sideeffects or disease flares were seen during intravenous iron saccharate treatment, as Martini and colleagues also
reported. *Carlomaurizio Montecucco, Roberto Caporali,
Rosangela Invernizzi Terapia Medica
1
2
e
Clinica Medica II, University of Pavia, 27100 Pavia,
Italy
Invernizzi R, Cazzola M, DeFazio P, Rosti V, Ruggeri G, Arosio P. Immunochemical detection of ferritin in human bone marrow and peripheral blood cells using monoclonal antibodies specific for the H and L subunit. Br J Haematol 1990; 76: 427-32. Means RT Jr, Krantz SB. Progress in understanding the pathogenesis of the anemia of chronic diseases. Blood 1992; 80: 1639-47.
Is Still’s disease associated with B19 infection?
parvovirus
SiR-Adult Still’s disease is a febrile disorder of unknown origin characterised by spiking fever with rash and arthralgia or arthritis.’ Several isolated reports have suggested the role of an infectious trigger in its pathogenesis. Similarities between Still’s disease and parvovirus B19 infection are striking and include fever, myalgia, arthritis, rash, lymphadenopathy, and sore throat. Pouchot et aP reported a case of adult Still’s disease associated with acute parvovirus B19 infection. They concluded that parvovirus B19 should be added to the list of aetiological agents of Still’s disease. To test this hypothesis, we attempted to find serological and
*Duration of Still’s disease at time of
serological testing for parvovirus B19. optical density in ELISA; threshold of
Numbers within parentheses are values of positivity is 0.18. SD=Still’s disease.
Table: Patients’ characteristics and results of B19 and PCR
serology
biomolecular evidence of parvovirus B19 infection in adults with Still’s disease. We studied 13 patients with adult-onset Still’s disease and 1 adult diagnosed with Still’s disease when 10 years old. Serum antibodies against parvovirus B19 antigens were determined in every patient by enzymoimmunoassay with B19 capsid proteins (VP1-VP2) for IgM,3 and a commercial ELISA Biotrin test with B19 capsid protein VP1for IgG. Sera were tested for DNA sequences specific for parvovirus B19 by PCR amplification.4 In a first group of 7 patients (patients 1-7), serological tests and PCR tests for B19specific DNA sequences were done within 8 weeks of onset of Still’s disease. The remaining patients (patients 8-14) were tested more than 12 months (12-192 months) after the onset of Still’s disease. The results are summarised in the table. All three tests were negative (no IgM and IgG B 19 antibodies and no B 19specific DNA sequences detected) for 5 patients (patients 1, 2, 3, 8, 9) indicating no contact with parvovirus B19. In the 9 other patients (4 patients of the first group and 5 patients of the second group), only IgG antibodies were detected indicating past infection. All 9 scored negative for IgM antibodies and B19-specific DNA sequences. We have ruled out any association between Still’s disease and parvovirus B19 infection in 5 of our 14 patients (patients 1, 2, 3, 8,9), indicating that the virus cannot be the sole aetiological agent of Still’s disease. In the 9 other patients, we found only serological markers of past B19 infection. Our results thus do not support an association between Still’s disease and parvovirus B19 replication. *Bertrand Godeau, Elisabeth Palazzo, Fredéric Morinet, Martine Deplanche, Lionel Deforge, Annette Schaeffer, Marcel-Francis Kahn Service de Médecine Interne I, Hôpital Henri Mondor, 94010 Créteil, France; Service de Rhumatologie, Hôpital Bichat/Claude Bernard, Paris; Service de Microbiologie, Hôpital Saint Louis, Paris; and Service de Microbiologie, Hôpital Henri Mondor
1
2
Pouchot J,
Sampalis J, Beaudet F, et al. Adult Still’s disease: manifestations, disease course, and outcome in 62 patients. Medicine 1991; 70: 118-36. Pouchot J, Ouakil H, Debin ML, Vinceneux P. Adult Still’s disease associated with acute human parvovirus B19 infection. Lancet 1993; 341: 1280-81.
59
Morinet F, Courouce AM, Galibert F, Peyrol Y. The use of labeled fusion protein for detection of B 19 parvovirus IgM antibodies by immunocapture test. J Virol Methods 1991; 31: 21-30. Belloy M, Morinet F, Blondin G, Courouce AM, Peyrol Y, Vilmer E. Erythroid hypoplasia due to chronic infection with parvovirus B19. N Engl J Med 1990; 322: 633-34.
3
4
Screening for codon 249 p53 mutation in lung associated with domestic radon exposure cancer
SIR-It has been suggested that radon may be an important environmental cause of lung cancer,’ Taylor and colleagues have identified an AGG to ATG transversion at codon 249 of the p53 gene in a high proportion of lung cancers from uranium miners with high radon exposure and have suggested that this mutation may be a marker for radiationinduced lung cancer.2 In this study, we have attempted to identify this mutation in lung cancer tissues from a number of individuals with known domestic radon exposure. As part of an ongoing case-control study of radon and lung cancer in southwest England, cases of lung cancer referred to the five main treatment centres in Devon and Cornwall were identified during a 4-year period and, for each case, concentrations of radon gas were measured in current and previous homes over a 6-month period using track-etched detectors supplied by the National Radiological Protection Board. Based on data accrued up to February, 1994, 30 cases were identified who had experienced an average domestic radon concentration of at least 200 Bq/m3 (ie, the recommended action level for the UK) over the previous 15 years; 118 cases were identified who had lived in a single house with a radon concentration of less than 20 Bq/m3 for at least 15 years; and 14 additional cases were identified with intermediate exposure and who were lifelong non-smokers. For this pilot study, lung cancer specimens were obtained from 21 cases: 9 in the high-exposure group including one lifelong non-smoker, 10 in the low-exposure group, and 2 lifelong non-smokers with intermediate exposure
Paraffin wax embedded lung cancer tissues were prepared for amplification with PCR as previously describedby use of nested amplification primers located in the intron sequences flanking exon 7 where codon 249 resides. Amplification products were obtained from 17 of the 21 cases, consistent with the previously reported success rate for PCR from paraffin embedded tissues. Two techniques were used to detect the codon 249 mutation: restriction analysis of the PCR products using BsaBI which recognises only the mutant sequence, as done by Taylor et al,2 and detection of the mutation using the amplification refractory mutation system (ARMS). The latter system was chosen because it allows the preferential amplification of the mutant sequence and the resulting system is able to detect 1 copy of the mutant sequence amongst 104 normal cells. None of the 17 cases of lung cancer showed evidence of the presence of the codon 249 mutation by either method of analysis. Our results, therefore, are more analogous to the results of Vakakangas and colleagues4 who did not find the codon 249 mutation in any of their lung cancer specimens from uranium miners. However, the radiation levels in Vakakangas and colleagues’ study and in our series are much lower than that of Taylor et al and may reflect a doseresponse relation for the codon 249 mutations. Another possibility might be that the codon 249 mutation is related to other environmental factors, such as mycotoxins,5 which could be in the uranium mines in Colorado. We thank the pathologists, laboratory and research staff, interviewers, colleagues at the National Radiological Protection Board, and physicians who have taken part in this study. We also thank Dr Takashi Takahashi for help during the project. This study is supported by the University of Oxford, ICRF, the European Commission, the Department of Health, the Department of the Environment, and the National Radiological Protection Board. YMDL is a Wellcome Career Development Fellow.
*Y M D Lo, S Darby, L K A Fleming, J I Bell
Noakes, E Whitley, P B S Silcocks,
*Nuffield Department of Clinical Medicine, Room 7501 John Radcliffe Hospital, Oxford OX3 9DU; ICRF Cancer Epidemiology Unit, Radcliffe Infirmary, Oxford; Department of Public Health Medicine, University of Sheffield; and Nuffield Department of Patholoogy, John Radcliffe Hospital, Oxford
(table). 1 2
Peto J, Darby S. Radon risk reassessed. Nature 1994; 368: 97-98. Taylor JA, Watson MA, Devereux TR, Michels RY, Saccomanno G, Anderson M. p53 mutation hotspot in radon-associated lung cancer. Lancet
3
4
5
1994; 343: 86-87. Lo ESF, Lo YMD, Tse CH, Fleming KA. Detection of hepatitis B pre-core mutant by allele specific polymerase chain reaction. J Clin Pathol 1992; 45: 689-92. Vähäkangas KH, Samet JM, Metcalf RA, et al. Mutations of p53 and ras genes in radon-associated lung cancer from uranium miners. Lancet 1992; 339: 576-80. Venitt S, Biggs PJ. Radon, mycotoxins, p53, and uranium mining. Lancet 1994; 343: 795.
Reversal of brain metabolic alterations with zidovudine detected by proton localised
magnetic
SQ=squamous cell cancer, AD=adenocarcmoma, UN=undifferentiated. WI_M=workmglevel months, CU (n)=current smoker who smokes n cigarettes per day, NS=never smoked regularly. EX (n)=ex-smoker who gave up n years ago. Radon exposure is expressed as time-weighted average domestic radon gas concentration m homes occupied by subject over previous 15 years (Bq/m3). or as cumulative exposure during past 15 years assuming equilibrium factor of 0-8 (WLM). No amplification products were obtained from patients 1, 6. 7. and 8. Mutation-specific PCR was earned out with ARMS primer 249M (5’GATGATGGTGAGGATGGGCA3’, antisense)) and an unpstram non-ARMS primer (5’AGGCGCACTGGCCTCATCTT3’, sense) at an annealing temperature of 55’C.’
Table:
60
Lung
cancer cases
with known domestic radon exposure
resonance
spectroscopy
SiR-Proton localised magnetic resonance spectroscopy (MRS) of the brain provides non-invasive exploration of intracerebral metabolism in vivo’ and has been used to analyse the metabolic modifications occurring in brains of patients with AIDS dementia complex (ADC).2-4 However whether or not ADC always encompasses neuronal death is unclear. We studied brain metabolism in 3 patients with ADC by use of proton MRS with a Siemens Magnetom SP63 (1-5 T) as previously described.4 Proton MR spectra of the brain were recorded at 63 MHz by use of spin-echo sequence (echo time 135 ms), after standard magnetic resonance imaging (MRI). The