- Email: [email protected]
Ischemic preconditioning improves liver tolerance to congestion–reperfusion injury in mice
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
Ischemic preconditioning improves liver tolerance to congestionereperfusion injury in mice Qiyi Zhang, MD,a,b,c Sheng Yan, MD,a,b,c Yang Tian, MD,a,b,c Yuan Ding, MD,a,b,c Jia Yao, MD,a,b,c Hui Chen, MD,a,b,c Zhiying Feng, MD,a,b,c Kwabena Owusu-Ansah, MD,a,b,c and Shusen Zheng, MD, PhDa,b,c,* a
Key Laboratory of Combined Multi-Organ Transplantation, Ministry of Public Health, Hangzhou, Zhejiang Province, China b Key Laboratory of Organ Transplantation, Hangzhou, Zhejiang Province, China c Division of Hepatobiliary and Pancreatic Surgery, Department of Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province, China
article info
abstract
Article history:
Background: Congestionereperfusion injury (CRI) is a common complication after living
Received 8 November 2013
donor liver transplantation, which has not been fully understood. It causes more severe
Received in revised form
inflammatory response as compared with ischemiaereperfusion injury (IRI). Ischemic pre-
13 January 2014
conditioning (IPC) has been endowed with powerful protective properties toward IRI. This
Accepted 31 January 2014
study aimed to investigate whether IPC also has a protective effect against CRI and potential
Available online 5 February 2014
underlying mechanisms. Materials and methods: Mice were randomly divided into sham operation, CRI, IPC-CRI, and
Keywords:
congestion precondition (CPC-CRI) group. The hepatic vein of the left anterior hepatic lobe
Congestion
was occluded for 75 min followed by reperfusion in the CRI group. The blood inflow was
Ischemic precondition
previously clamped for 10 min followed by 10 min of reperfusion just before occluding the
Ischemia reperfusion injury
hepatic vein in the IPC-CRI group. To imitating IPC in the CPC-CRI group, 10 min of
Living donor liver transplantation
congestion followed by 10 min of reperfusion just before CRI was performed. The animals were sacrificed at 2, 6, 24, 48 h, and 7 d after reperfusion. The blood and liver samples were collected for hepatic function assay, histology, terminal deoxynucleotidyl transferase dUTP nick end labeling, myeloperoxidase, and real-time polymerase chain reaction analysis. Results: Mice in the CRI, IPC-CRI, and CPC-CRI group demonstrated elevated liver enzymes, histologic damage, cellular apoptosis, and inflammatory response compared with those in the sham operation group. Compared with the CRI group, mice in the IPC-CRI group expressed lower alanine transaminase activities (2 h: 839.2 132.5 versus 384.2 94.8, P < 0.01; and 6 h: 680 142.4 versus 342.3 99.7, P < 0.01) and lower myeloperoxidase levels (2 h: 7.1 4.0 U/g versus 3.8 1.6 U/g, P < 0.05; and 6 h: 8.1 1.3 U/g versus 5.2 3.0 U/g, P < 0.05). However, the alanine transaminase level in the CPC-CRI group was notably higher at 2 h (839.2 132.5 versus 1087.5 192.5, P < 0.05). Livers from mice in the IPC-CRI group showed better tissue integrity, diminished hepatocellular injury, and apoptosis at 2 and 6 h. The messenger RNA transcriptions of interleukin 1 and interleukin 6 were significantly lower after 2e24 h of
* Corresponding author. Key Laboratory of Combined Multi-Organ Transplantation, Ministry of Public Health, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, Zhejiang Province, P.R. China. Tel.: þ86 571 8723 6567; fax: þ86 571 8723 6567. E-mail address: [email protected] (S. Zheng). 0022-4804/$ e see front matter ª 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2014.01.061
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
153
reperfusion, whereas tumor necrosis factor a and monocyte chemoattractant protein 1 were significantly lower after 24 h of reperfusion in the IPC-CRI group. Conclusions: IPC can significantly improve liver tolerance to CRI by attenuating neutrophil infiltration, proinflammatory cytokine formation, and hepatocytes apoptosis. This pretreatment strategy holds greater prospect of being translated into clinical use in living donor liver transplantation. ª 2014 Elsevier Inc. All rights reserved.
1.
Introduction
It is common to use modified right lobe living donor liver transplantation (LDLT) in many institutions for the sake of donor’s safety. This procedure usually leads to a partial congestion in the anterior hepatic segment, which occurs in the process of graft harvesting and implantation, because of deprivation of the regional venous outflow from the middle hepatic vein. Autogenous or heterogeneous vascular stent is used for reconstruction of the venous outflow, which leads to congestionereperfusion injury (CRI) [1e6]. Severe CRI results in progressive graft dysfunction and inadequate regeneration of the affected liver segment [1,7]. Detailed mechanisms and therapies of hepatic ischemiaereperfusion injury (IRI) have been reported in rodent models and clinical practice [8,9], but few have focused on CRI and its protective measures. We previously [10] developed a murine hepatic CRI model to examine the difference in severity of injury, inflammatory mediators, and the impacts on microcirculation between CRI and IRI. CRI resulted in more severe hepatic injury due to additional effects of blood stasis, thrombosis, regurgitation in hepatic sinusoids, and venous vasculature. However, there has not been adequate treatment options for CRI up to now. In 1986, Murry et al. [11] disclosed how ischemic preconditioning (IPC) led to an unexpected resistance in the myocardium to a subsequent prolonged ischemia. Clavien et al. [12] described the first clinical beneficial evidence of IPC during major hepatic surgery in patients. This study aimed to prove whether IPC does protect liver tissue from CRI and to study its potential underlying mechanisms. Previous murine CRI model was used to verify the hypothesis.
2.
Materials and methods
2.1.
Animals
Adult male C57BL/6 mice were purchased from the Shanghai Animal Center (Chinese Academy of Science, Shanghai, China). Animals were housed at the experimental animal facility of the Zhejiang University under standard care conditions and fed with mouse chow ad libitum. All animal experiments were approved by the Animal Care Committee of Zhejiang University in accordance with the Principles of Laboratory Animal Care (NIH publication 85-23, revised 1985).
2.2.
Experimental model
Adult male C57BL/6 mice were assigned to sham operation, CRI, IPC-CRI, and congestion precondition (CPC-CRI) group.
Mice in the sham group were subjected to laparotomy. In the CRI group, the hepatic vein of the left anterior hepatic lobe was temporarily ligated with 10-0 suture for 75 min then followed by reperfusion. In the IPC-CRI group, before congestion period (as in CRI group), the portal vein and hepatic artery of the left anterior hepatic lobe were previously interrupted by a nontraumatic microvascular clamp for 10 min followed by 10 min of reperfusion (Fig. 1). To imitate IPC in the CPC-CRI group, 10 min of congestion followed by 10 min of reperfusion just before CRI was performed. Heparin (50 U/per mouse) was systemically administered by intravenous injection before operation in all groups. The animals were sacrificed after reperfusion at 2, 6, 24, 48 h, and 7 d sampling time intervals (CRI and IPC-CRI group: n ¼ 6 at each time point; CPCCRI group: n ¼ 6 at 2 and 6; and the sham group: n ¼ 6 at 2 h). The blood and liver samples were collected for hepatic function assay, histology, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), myeloperoxidase (MPO), and real-time polymerase chain reaction (PCR) analysis.
2.3.
Hepatic function assay
Blood samples were obtained from retrobulbar venous plexus to measure alanine transaminase (ALT) by an Automated Chemical Analyzer (7600; Hitachi, Tokyo, Japan).
2.4.
Histology and TUNEL
Tissue samples were fixed in 10% formaldehyde overnight, dehydrated, and embedded in paraffin. Sections of thickness 5 mm were stained with hematoxylin and eosin (H and E). Morphologic changes such as congestion, vacuolization, and necrosis were evaluated in serial hematoxylin and eosine stained sections under light microscopy according to Suzuki score [13]. Other sections were prepared and stained for apoptotic cells by the TUNEL method using a commercially available kit (Apop Tag Peroxidase In Situ Apoptosis Detection Kit S7100; Chemicon International Inc, Billerica, MA). The TUNEL assay was performed according to the manufacturer’s protocol. The results were presented as the mean number of TUNEL-positive cells per high power field (400).
2.5.
MPO assay
MPO activity of the liver was analyzed using commercial kits (NJJC Bio Inc, Nanjing, China) according to the manufacturer’s instructions.
2.6.
RNA preparation and reverse transcription
Total hepatic RNA was isolated from small pieces of liver tissue (50e100 mg) using the TRIzol reagent (Invitrogen
154
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
Fig. 1 e (A) Sham laparotomy. (B) Temporary ligation of the left hepatic vein causing congestion of the left anterior hepatic lobe. (C) Cross-clamping the portal vein and hepatic artery inducing ischemia of the left anterior hepatic lobe.
Corporation, Carlsbad, CA) according to the manufacturer’s instructions. Absorbance was measured at 260 and 280 nm to verify the integrity and purity of the isolated RNA. The extracted RNA was stored at 80 C until used for PCR. Reverse transcription was performed on 3 mg of RNA with an oligo (dT) primer and moloney leukemia virus reverse transcriptase (Promega Corporation, Madison, WI).
2.8.
2.7.
3.
Results
3.1.
Comparison of serum ALT level
Real-time PCR
SYBR Green (TaKaRa company, China) was used for the quantification of PCR reactions. The prepared complementary DNA was subjected to different PCR in the presence of 50 and 30 murine interleukin (IL)-1, IL-6, tumor necrosis factor (TNF)-a, monocyte chemoattractant protein(MCP)-1, and interferon (IFN)-g primer pairs (IDT company, Coralville, IA). The sequences of the primers were described in Table. Mouse b-actin was used as an endogenous control to standardize the amount of complementary DNA added to the reaction. The PCR amplification was placed in an ABI PRISM 7500 Real-Time PCR System (ABI/PE, Foster City, CA). The PCR reaction involved the following steps: (1) initial denaturation at 94 C for 3 min; (2) 40 cycles of denaturation at 94 C for 20 s and annealing extension at 60 C for 45 s. The data were analyzed using 2DDCT method [14]. The DCt value was defined as the absolute value of the difference between the Ct value of the target gene and b-actin for each sample. DDCt was defined as the relative value of the difference between treated group and untreated control (sham operation group). The fold change in the target gene was calculated using the equation: quantity of target gene ¼ 2DDCT.
Table e Sequences of the primers for IL-1, IL-6, TNF-a, MCP-1, IFN-g, and b-actin used in the present study. Gene IL-1
Primer
Forward Reverse TNF-a Forward Reverse MCP-1 Forward Reverse IL-6 Forward Reverse IFN-g Forward Reverse b-actin Forward Reverse
Sequence (50 -30 )
Size (bp)
CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA TCTCATCAGTTCTATGGCCC GGGAGTAGACAAGGTACAAC CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA ACTGGCAAAAGGATGGTGACA TGGACCTGTGGGTTGTTGAC TGACAGGATGCAGAAGGAGA GCTGGAAGGTGGACAGTGAG
152 212 127 141 214 131
Statistics
All data are presented as mean values standard error of the mean. Analysis of variance and t-test of independent means was used for statistical analysis. Data were considered significant at a level of P < 0.05.
Marked elevation of serum ALT levels in CRI, IPC-CRI, and CPC-CRI group were seen at 2 and 6 h after reperfusion, and subsided afterward. In comparison with the CRI group, the hepatic enzyme activity of the IPC-CRI group was significantly lower at 2 h (839.2 132.5 versus 384.2 94.8, P < 0.01) and 6 h (680 142.4 versus 342.3 99.7, P < 0.01) of reperfusion, but showed no statistical significance at 24 and 48 h and 7 d (Fig. 2). Nevertheless, compared with the CRI group, the ALT level in CPC-CRI group was notably higher at 2 h (839.2 132.5 versus 1087.5 192.5, P < 0.05) and comparable at 6 h (680 142.4 versus 626.7 140.9, P > 0.05), which implied that CPC does not work for hepatic congestion by IPC at early stage.
3.2.
Histologic assessment and TUNEL staining
Hepatic pathologic changes were insubstantial in the sham operation group, in the absence of evident vacuolization, and necrosis of hepatocytes. Significant necrosis with focal sinusoidal congestion and moderate vacuolization of hepatocytes was seen in the CRI group. Mild vacuolization, necrosis, and neutrophil accumulation was observed in IPC-CRI group compared with the CRI group; its Suzuki score was significantly lower (2 h: 3.2 0.4 versus 1.8 0.4 and 6 h: 3.2 0.3 versus 1.7 0.5, P < 0.05), but showed no statistical significance at 24 and 48 h and 7 d (Fig. 3). On the other hand, compared with the CRI group, CPC-CRI group demonstrated no beneficial effects but severe necrosis and clotting, whereas its Suzuki score was similar (2 h: 3.2 0.4 versus 3 1.1 and 6 h: 3.2 0.3 versus 3.5 0.5, P > 0.05). In contrast to the multiple apoptotic cells in the CRI group using TUNEL staining, the apoptotic hepatocytes declined dramatically in the IPC-CRI group (2 h: 22.0 13.8 versus 6.1 1.4, P < 0.05; 6 h: 10.7 6.0 versus 4.5 1.1, P < 0.05; 24 h: 12.1 8.5 versus 4.3 2.7, P < 0.05; positive cells/high power field; Fig. 4).
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
155
8.1 1.3 U/g versus 5.2 3.0 U/g, P < 0.05), suggesting less neutrophil infiltration after hepatic congestion by IPC at the early stage (Fig. 5). No statistically significant values were observed at 24 h.
3.4. Analysis of messenger RNA expression of inflammatory cytokine and chemokine
Fig. 2 e The serum level of ALT activity. In the CRI and IPCCRI group, ALT levels were significantly higher than those in the sham operation group. Compared with the CRI group, ALT levels in the IPC-CRI group were significantly lower at 2 and 6 h after reperfusion. (Data are shown as mean ± standard error of mean; **P < 0.01).
The messenger RNA expression of the inflammatory mediators, that is, IL-1, IL-6, TNF-a, MCP-1, and IFN-g were analyzed in the reperfused hepatic tissue. In comparison with the sham operation group, the expression of these inflammatory cytokines or chemokines was enhanced between 2 and 24 h after congestion. The expression of IL-1, IL-6, TNF-a, and MCP-1 in the IPC-CRI group showed apparent decline in comparison with those in the CRI group at 24 h. Notably, the messenger RNA level of IL-1 and IL-6 at 2 h and 6 h were also obviously lower in the IPC-CRI group than those in the CRI group (Fig. 6). However, there was not any statistical significance in IFN-g between those two groups.
4. 3.3.
MPO activity
Liver MPO, a neutrophil marker enzyme, was measured to determine the degree of neutrophil sequestration. CRI caused increment in MPO activity at 2, 6, and 24 h after reperfusion. Compared with the CRI group, the MPO levels were markedly decreased in the IPC-CRI group at 2 and 6 h (2 h: 7.1 4.0 U/g versus 3.8 1.6 U/g, P < 0.05; and 6 h:
Discussion
With the technical evolutions in hepatic surgery, CRI has become a major problem in LDLT. Inspite of extensive investigations into IRI of liver, few studies have focused on the reperfusion injury caused by acute hepatic venous outflow occlusion. Kimura et al. [15] found the detrimental impact intestinal venous congestion rather than arterial ischemia had on early inflammatory damage. More recently, Park et al. [16] reported an increased injury to the
Fig. 3 e (A) Hematoxylin and eosin staining in the CRI group reveal significant necrosis with focal sinusoidal congestion and moderate vacuolization. (B) Hematoxylin and eosin staining in the IPC-CRI group reveal improved necrosis and vacuolization. (C) Lower Suzuki score in the IPC-CRI group compared with CRI group at 2 and 6 h after reperfusion. (Data are shown as mean ± standard error of mean; *P < 0.05).
156
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
Fig. 4 e TUNEL staining reveal vast stretches of apoptotic cells in the CRI group at 2 h (A) and several apoptotic cells at 6 h (C) and 24 h (E). (B), (D), and (F) show significantly diminished apoptotic cells at 2, 6, and 24 h in the IPC-CRI group. (G) The positive cells decrease significantly in the IPC-CRI group compared with the CRI group after reperfusion. (Data are shown as mean ± standard error mean; *P < 0.05, **P < 0.01).
kidney by congestion rather than ischemia alone. Similar to the kidney and skin flaps [17], the liver is more susceptible to congestion [10,18]. Compared with IRI, CRI leads to intrasinusoidal hypertension, dilation of the hepatic sinus, and even regurgitation of the blood flow [10]. Because CRI
Fig. 5 e The MPO activity of the sham operation, CRI, and IPC-CRI group. MPO activity of the IPC-CRI group was significantly lower than that of the CRI group at 2 and 6 h after reperfusion. (Data are given as mean ± standard error of mean; *P < 0.05).
could not be avoided in LDLT, it is important to find an effective maneuver to alleviate this particular liver injury to the greatest extent. In a pilot study, CPC exhibited no healing effect for CRI, but rather severe necrosis and liver dysfunction. Alternatively, IPC, which prevents microcirculatory disturbances and loss of high-energy metabolites might be effective [19e21]. The results revealed for the first time that IPC improved liver tolerance to sustained congestion by diminishing hepatic enzymes, neutrophilic activity, formation of proinflammatory mediators, necrosis, and hepatocytes apoptosis. The histology and serum liver function tests were particularly more evident in the early stage of reperfusion than in the later stage. The chief inflammatory cytokines (IL-1, IL-6, and TNF-a) and the monocyte chemokines (MCP-1) were reduced distinctively in the later stage. Acute inflammation is characterized by an initial infiltration of neutrophils, which is then replaced by monocytes after 24 h to prevent increased tissue damage from the accumulation of neutrophil-secreted proteases and reactive oxygen species at the site of inflammation. Neutrophils have a short life span and die rapidly via apoptosis in vivo and in vitro [22]. That is the reason MPO levels were markedly decreased in the early period but no statistical significance observed at 24 h. As reported, Kupffer cells and neutrophils are activated, and they release a series of inflammatory cytokines such as IL-1, IL-6, and TNF-a, which in turn activate leukocytes and increase the release of peroxides [23e25]. This implied that the protection effect of IPC maybe
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
157
Fig. 6 e The messenger RNA expression of IL-1 (A), IL-6 (B), TNF-a (C), and MCP-1 (D). The threshold cycle (Ct) indicating the fractional cycle number at which the amount of amplified target reaches a fixed threshold. DCt [ Ct (target gene) L Ct (bactin), where b-actin is the endogenous reference. DDCt [ DCt (treated) L DCt (sham). The fold change in the target gene was calculated using the equation: quantity of target gene [ 2LDDCT. The higher histogram reflects higher messenger RNA expression. Data are given as mean ± standard error of mean of the fold increase relative to sham operation group. (*P < 0.05, **P < 0.01).
closely related to decrease the activation of Kupffer cell and neutrophil infiltration in the liver. IL-6 is a mediator of the acute phase response and differentiation or activation of macrophages, B-, and T-cells, and has both pro- and anti-inflammatory properties [22]. Likewise, IL-6 also activates the signal transducer and activator of transcription-3 (STAT3) and Src homology 2 domain-containing protein tyrosine phosphatase-2/Grb2-associated binder/mitogen-activated protein kinase signaling pathways via the glycoprotein 130 signal transducer [26,27]. It is known that TNF-a and IL-6 are required for liver regeneration by nuclear factor kappa B and STAT3. TNF-a and IL-6, which in turn facilitate the remnant hepatocytes to reenter the proliferation state [28e30]. In this study, the level of TNF-a and IL-6 was higher in the IPC group than in the sham operation group, but lower in the CRI group. Therefore, it can be inferred that a low dose of TNF-a and IL-6 may play a protective role in this model, whereas a higher dose augments hepatotoxicity rather than reducing hepatic CRI injury. Also it can be concluded that IPC can initiate hepatocyte proliferation and then compensate subsequent hepatocyte apoptosis induced by prolonged CRI. The protective signaling mechanism of IPC may be associated with TNF-a and IL-6 signals. This detrimental effect of hepatic CRI was manifested by decreased sinusoids perfusion and provoked activation of leukocytes as indicated by their enhanced interactions with the hepatic endothelial microvasculature [10]. It could be
hypothesized that preconditioning reduces neutrophil accumulation by preserving the endothelial cell integrity and reducing leukocyte adherence in sinusoids and postsinusoidal venules. Preconditioned liver may improve hepatic tissue blood flow, decrease hepatic vascular resistance, and ameliorate impairment of hepatic microcirculation after CRI. The precise protective mechanisms of IPC against hepatic CRI remain to be further elucidated. The adverse effect of CRI is considered to be drastic reduction in the hepatic effective microvascular bed leading to excessive portal perfusion injury in a small-for-size liver graft [31,32]. As mentioned, IPC is potentially able to attenuate the microvascular disorders and the inflammatory responses, and thus, it improves the effective sinusoid irrigation. A number of clinical trials have confirmed that inflow occlusion can be applied to living donor hepatectomy without graft injury [12]. Thus, the facilitation of IPC on hepatic CRI can be an option for the development of new strategies in LDLT. On the other hand, different pharmacologic therapeutic agents simulating the benefits of IPC on hepatic CRI could be of great interest.
5.
Conclusions
These results provide strong experimental evidence for the use of IPC against hepatic CRI. This simple and powerful pretreatment strategy holds great prospect of being translated
158
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
into clinical use in LDLT. Further research is needed to achieve a better understanding of the underlying protective mechanisms.
Acknowledgment This work was supported by Natural Science Foundation of Zhejiang province (Y2110064 and LY12H03012) and National Natural Science Foundation of China (No. 81372626). Author contributions: Z.Q.Y. designed the study and wrote the article. Y.S. participated in data analysis and interpretation. T.Y., D.Y., and C.H. performed the experiment. Y.J. and F.Z.Y. carried out data collection and statistical analysis. O.A.K. edited and revised the article. Z.S.S. conceived the study conception and obtaining funding. All authors read and approved the final manuscript.
Disclosure The authors reported no proprietary or commercial interest in any product mentioned or concept discussed in this article.
references
[1] Lee S, Park K, Hwang S, et al. Congestion of right liver graft in living donor liver transplantation. Transplantation 2001;71: 812. [2] Fukuhara T, Umeda K, Toshima T, et al. Congestion of the donor remnant right liver after extended left lobe donation. Transpl Int 2009;22:837. [3] Fan ST, De Villa VH, Kiuchi T, et al. Right anterior sector drainage in right-lobe live-donor liver transplantation. Transplantation 2003;75:S25. [4] Gyu Lee S, Min Park K, Hwang S, et al. Modified right liver graft from a living donor to prevent congestion. Transplantation 2002;74:54. [5] Scatton O, Plasse M, Dondero F, et al. Impact of localized congestion related to venous deprivation after hepatectomy. Surgery 2008;143:483. [6] Wu J, Wang W, Zhang M, et al. Reconstruction of middle hepatic vein in living donor liver transplantation with modified right lobe graft: a single center experience. Transpl Int 2008;21:843. [7] Maetani Y, Itoh K, Egawa H, et al. Factors influencing liver regeneration following living-donor liver transplantation of the right hepatic lobe. Transplantation 2003;75:97. [8] Vardanian AJ, Busuttil RW, Kupiec-Weglinski JW. Molecular mediators of liver ischemia and reperfusion injury: a brief review. Mol Med 2008;14:337. [9] Malhi H, Gores GJ. Cellular and molecular mechanisms of liver injury. Gastroenterology 2008;134:1641. [10] Yan S, Zhou B, Zhang Q, et al. Hepatic venous occlusion causes more impairment after reperfusion compared with portal clamping in a murine model. J Surg Res 2011;169:117. [11] Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 1986;74:1124. [12] Clavien PA, Petrowsky H, DeOliveira ML, et al. Strategies for safer liver surgery and partial liver transplantation. N Engl J Med 2007;356:1545.
[13] Suzuki S, Toledo-Pereyra LH, Rodriguez FJ, et al. Neutrophil infiltration as an important factor in liver ischemia and reperfusion injury. Modulating effects of FK506 and cyclosporine. Transplantation 1993;55:1265. [14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402. [15] Kimura M, Kataoka M, Kuwabara Y, et al. Real-time energy metabolism of intestine during arterial versus venous occlusion in the rat. J Gastroenterol 2003;38:849. [16] Park Y, Hirose R, Dang K, et al. Increased severity of renal ischemia-reperfusion injury with venous clamping compared to arterial clamping in a rat model. Surgery 2008; 143:243. [17] Hauge EM, Balling E, Hartmund T, et al. Secondary ischemia caused by venous or arterial occlusion shows differential effects on myocutaneous island flap survival and muscle ATP levels. Plast Reconstr Surg 1997;99:825. [18] Dirsch O, Madrahimov N, Chaudri N, et al. Recovery of liver perfusion after focal outflow obstruction and liver resection. Transplantation 2008;85:748. [19] Serafin A, Fernandez-Zabalegui L, Prats N, et al. Ischemic preconditioning: tolerance to hepatic ischemia-reperfusion injury. Histol Histopathol 2004;19:281. [20] Yan S, Jin LM, Liu YX, et al. Outcomes and mechanisms of ischemic preconditioning in liver transplantation. Hepatobiliary Pancreat Dis Int 2010;9:346. [21] Peralta C, Bartrons R, Serafin A, et al. Adenosine monophosphate-activated protein kinase mediates the protective effects of ischemic preconditioning on hepatic ischemia-reperfusion injury in the rat. Hepatology 2001;34: 1164. [22] Scheller J, Chalaris A, Schmidt-Arras D, et al. The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 2011;1813:878. [23] Bilzer M, Roggel F, Gerbes AL. Role of Kupffer cells in host defense and liver disease. Liver Int 2006;26:1175. [24] Arii S, Teramoto K, Kawamura T. Current progress in the understanding of and therapeutic strategies for ischemia and reperfusion injury of the liver. J Hepatobiliary Pancreat Surg 2003;10:189. [25] Peralta C, Prats N, Xaus C, et al. Protective effect of liver ischemic preconditioning on liver and lung injury induced by hepatic ischemia-reperfusion in the rat. Hepatology 1999;30: 1481. [26] Xing Z, Gauldie J, Cox G, et al. IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses. J Clin Invest 1998;101:311. [27] Mihara M, Hashizume M, Yoshida H, et al. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond) 2012;122:143. [28] Teoh N, Leclercq I, Pena AD, et al. Low-dose TNF-alpha protects against hepatic ischemia-reperfusion injury in mice: implications for preconditioning. Hepatology 2003;37:118. [29] Teoh N, Field J, Farrell G. Interleukin-6 is a key mediator of the hepatoprotective and pro-proliferative effects of ischaemic preconditioning in mice. J Hepatol 2006;45:20. [30] Sudo K, Yamada Y, Saito K, et al. TNF-alpha and IL-6 signals from the bone marrow derived cells are necessary for normal murine liver regeneration. Biochim Biophys Acta 2008;1782: 671. [31] Tanaka K, Ogura Y. “Small-for-size graft” and “small-for-size syndrome” in living donor liver transplantation. Yonsei Med J 2004;45:1089. [32] Yagi S, Uemoto S. Small-for-size syndrome in living donor liver transplantation. Hepatobiliary Pancreat Dis Int 2012;11: 570.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
Ischemic preconditioning improves liver tolerance to congestionereperfusion injury in mice Qiyi Zhang, MD,a,b,c Sheng Yan, MD,a,b,c Yang Tian, MD,a,b,c Yuan Ding, MD,a,b,c Jia Yao, MD,a,b,c Hui Chen, MD,a,b,c Zhiying Feng, MD,a,b,c Kwabena Owusu-Ansah, MD,a,b,c and Shusen Zheng, MD, PhDa,b,c,* a
Key Laboratory of Combined Multi-Organ Transplantation, Ministry of Public Health, Hangzhou, Zhejiang Province, China b Key Laboratory of Organ Transplantation, Hangzhou, Zhejiang Province, China c Division of Hepatobiliary and Pancreatic Surgery, Department of Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province, China
article info
abstract
Article history:
Background: Congestionereperfusion injury (CRI) is a common complication after living
Received 8 November 2013
donor liver transplantation, which has not been fully understood. It causes more severe
Received in revised form
inflammatory response as compared with ischemiaereperfusion injury (IRI). Ischemic pre-
13 January 2014
conditioning (IPC) has been endowed with powerful protective properties toward IRI. This
Accepted 31 January 2014
study aimed to investigate whether IPC also has a protective effect against CRI and potential
Available online 5 February 2014
underlying mechanisms. Materials and methods: Mice were randomly divided into sham operation, CRI, IPC-CRI, and
Keywords:
congestion precondition (CPC-CRI) group. The hepatic vein of the left anterior hepatic lobe
Congestion
was occluded for 75 min followed by reperfusion in the CRI group. The blood inflow was
Ischemic precondition
previously clamped for 10 min followed by 10 min of reperfusion just before occluding the
Ischemia reperfusion injury
hepatic vein in the IPC-CRI group. To imitating IPC in the CPC-CRI group, 10 min of
Living donor liver transplantation
congestion followed by 10 min of reperfusion just before CRI was performed. The animals were sacrificed at 2, 6, 24, 48 h, and 7 d after reperfusion. The blood and liver samples were collected for hepatic function assay, histology, terminal deoxynucleotidyl transferase dUTP nick end labeling, myeloperoxidase, and real-time polymerase chain reaction analysis. Results: Mice in the CRI, IPC-CRI, and CPC-CRI group demonstrated elevated liver enzymes, histologic damage, cellular apoptosis, and inflammatory response compared with those in the sham operation group. Compared with the CRI group, mice in the IPC-CRI group expressed lower alanine transaminase activities (2 h: 839.2 132.5 versus 384.2 94.8, P < 0.01; and 6 h: 680 142.4 versus 342.3 99.7, P < 0.01) and lower myeloperoxidase levels (2 h: 7.1 4.0 U/g versus 3.8 1.6 U/g, P < 0.05; and 6 h: 8.1 1.3 U/g versus 5.2 3.0 U/g, P < 0.05). However, the alanine transaminase level in the CPC-CRI group was notably higher at 2 h (839.2 132.5 versus 1087.5 192.5, P < 0.05). Livers from mice in the IPC-CRI group showed better tissue integrity, diminished hepatocellular injury, and apoptosis at 2 and 6 h. The messenger RNA transcriptions of interleukin 1 and interleukin 6 were significantly lower after 2e24 h of
* Corresponding author. Key Laboratory of Combined Multi-Organ Transplantation, Ministry of Public Health, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, Zhejiang Province, P.R. China. Tel.: þ86 571 8723 6567; fax: þ86 571 8723 6567. E-mail address: [email protected] (S. Zheng). 0022-4804/$ e see front matter ª 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2014.01.061
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
153
reperfusion, whereas tumor necrosis factor a and monocyte chemoattractant protein 1 were significantly lower after 24 h of reperfusion in the IPC-CRI group. Conclusions: IPC can significantly improve liver tolerance to CRI by attenuating neutrophil infiltration, proinflammatory cytokine formation, and hepatocytes apoptosis. This pretreatment strategy holds greater prospect of being translated into clinical use in living donor liver transplantation. ª 2014 Elsevier Inc. All rights reserved.
1.
Introduction
It is common to use modified right lobe living donor liver transplantation (LDLT) in many institutions for the sake of donor’s safety. This procedure usually leads to a partial congestion in the anterior hepatic segment, which occurs in the process of graft harvesting and implantation, because of deprivation of the regional venous outflow from the middle hepatic vein. Autogenous or heterogeneous vascular stent is used for reconstruction of the venous outflow, which leads to congestionereperfusion injury (CRI) [1e6]. Severe CRI results in progressive graft dysfunction and inadequate regeneration of the affected liver segment [1,7]. Detailed mechanisms and therapies of hepatic ischemiaereperfusion injury (IRI) have been reported in rodent models and clinical practice [8,9], but few have focused on CRI and its protective measures. We previously [10] developed a murine hepatic CRI model to examine the difference in severity of injury, inflammatory mediators, and the impacts on microcirculation between CRI and IRI. CRI resulted in more severe hepatic injury due to additional effects of blood stasis, thrombosis, regurgitation in hepatic sinusoids, and venous vasculature. However, there has not been adequate treatment options for CRI up to now. In 1986, Murry et al. [11] disclosed how ischemic preconditioning (IPC) led to an unexpected resistance in the myocardium to a subsequent prolonged ischemia. Clavien et al. [12] described the first clinical beneficial evidence of IPC during major hepatic surgery in patients. This study aimed to prove whether IPC does protect liver tissue from CRI and to study its potential underlying mechanisms. Previous murine CRI model was used to verify the hypothesis.
2.
Materials and methods
2.1.
Animals
Adult male C57BL/6 mice were purchased from the Shanghai Animal Center (Chinese Academy of Science, Shanghai, China). Animals were housed at the experimental animal facility of the Zhejiang University under standard care conditions and fed with mouse chow ad libitum. All animal experiments were approved by the Animal Care Committee of Zhejiang University in accordance with the Principles of Laboratory Animal Care (NIH publication 85-23, revised 1985).
2.2.
Experimental model
Adult male C57BL/6 mice were assigned to sham operation, CRI, IPC-CRI, and congestion precondition (CPC-CRI) group.
Mice in the sham group were subjected to laparotomy. In the CRI group, the hepatic vein of the left anterior hepatic lobe was temporarily ligated with 10-0 suture for 75 min then followed by reperfusion. In the IPC-CRI group, before congestion period (as in CRI group), the portal vein and hepatic artery of the left anterior hepatic lobe were previously interrupted by a nontraumatic microvascular clamp for 10 min followed by 10 min of reperfusion (Fig. 1). To imitate IPC in the CPC-CRI group, 10 min of congestion followed by 10 min of reperfusion just before CRI was performed. Heparin (50 U/per mouse) was systemically administered by intravenous injection before operation in all groups. The animals were sacrificed after reperfusion at 2, 6, 24, 48 h, and 7 d sampling time intervals (CRI and IPC-CRI group: n ¼ 6 at each time point; CPCCRI group: n ¼ 6 at 2 and 6; and the sham group: n ¼ 6 at 2 h). The blood and liver samples were collected for hepatic function assay, histology, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), myeloperoxidase (MPO), and real-time polymerase chain reaction (PCR) analysis.
2.3.
Hepatic function assay
Blood samples were obtained from retrobulbar venous plexus to measure alanine transaminase (ALT) by an Automated Chemical Analyzer (7600; Hitachi, Tokyo, Japan).
2.4.
Histology and TUNEL
Tissue samples were fixed in 10% formaldehyde overnight, dehydrated, and embedded in paraffin. Sections of thickness 5 mm were stained with hematoxylin and eosin (H and E). Morphologic changes such as congestion, vacuolization, and necrosis were evaluated in serial hematoxylin and eosine stained sections under light microscopy according to Suzuki score [13]. Other sections were prepared and stained for apoptotic cells by the TUNEL method using a commercially available kit (Apop Tag Peroxidase In Situ Apoptosis Detection Kit S7100; Chemicon International Inc, Billerica, MA). The TUNEL assay was performed according to the manufacturer’s protocol. The results were presented as the mean number of TUNEL-positive cells per high power field (400).
2.5.
MPO assay
MPO activity of the liver was analyzed using commercial kits (NJJC Bio Inc, Nanjing, China) according to the manufacturer’s instructions.
2.6.
RNA preparation and reverse transcription
Total hepatic RNA was isolated from small pieces of liver tissue (50e100 mg) using the TRIzol reagent (Invitrogen
154
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
Fig. 1 e (A) Sham laparotomy. (B) Temporary ligation of the left hepatic vein causing congestion of the left anterior hepatic lobe. (C) Cross-clamping the portal vein and hepatic artery inducing ischemia of the left anterior hepatic lobe.
Corporation, Carlsbad, CA) according to the manufacturer’s instructions. Absorbance was measured at 260 and 280 nm to verify the integrity and purity of the isolated RNA. The extracted RNA was stored at 80 C until used for PCR. Reverse transcription was performed on 3 mg of RNA with an oligo (dT) primer and moloney leukemia virus reverse transcriptase (Promega Corporation, Madison, WI).
2.8.
2.7.
3.
Results
3.1.
Comparison of serum ALT level
Real-time PCR
SYBR Green (TaKaRa company, China) was used for the quantification of PCR reactions. The prepared complementary DNA was subjected to different PCR in the presence of 50 and 30 murine interleukin (IL)-1, IL-6, tumor necrosis factor (TNF)-a, monocyte chemoattractant protein(MCP)-1, and interferon (IFN)-g primer pairs (IDT company, Coralville, IA). The sequences of the primers were described in Table. Mouse b-actin was used as an endogenous control to standardize the amount of complementary DNA added to the reaction. The PCR amplification was placed in an ABI PRISM 7500 Real-Time PCR System (ABI/PE, Foster City, CA). The PCR reaction involved the following steps: (1) initial denaturation at 94 C for 3 min; (2) 40 cycles of denaturation at 94 C for 20 s and annealing extension at 60 C for 45 s. The data were analyzed using 2DDCT method [14]. The DCt value was defined as the absolute value of the difference between the Ct value of the target gene and b-actin for each sample. DDCt was defined as the relative value of the difference between treated group and untreated control (sham operation group). The fold change in the target gene was calculated using the equation: quantity of target gene ¼ 2DDCT.
Table e Sequences of the primers for IL-1, IL-6, TNF-a, MCP-1, IFN-g, and b-actin used in the present study. Gene IL-1
Primer
Forward Reverse TNF-a Forward Reverse MCP-1 Forward Reverse IL-6 Forward Reverse IFN-g Forward Reverse b-actin Forward Reverse
Sequence (50 -30 )
Size (bp)
CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA TCTCATCAGTTCTATGGCCC GGGAGTAGACAAGGTACAAC CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA ACTGGCAAAAGGATGGTGACA TGGACCTGTGGGTTGTTGAC TGACAGGATGCAGAAGGAGA GCTGGAAGGTGGACAGTGAG
152 212 127 141 214 131
Statistics
All data are presented as mean values standard error of the mean. Analysis of variance and t-test of independent means was used for statistical analysis. Data were considered significant at a level of P < 0.05.
Marked elevation of serum ALT levels in CRI, IPC-CRI, and CPC-CRI group were seen at 2 and 6 h after reperfusion, and subsided afterward. In comparison with the CRI group, the hepatic enzyme activity of the IPC-CRI group was significantly lower at 2 h (839.2 132.5 versus 384.2 94.8, P < 0.01) and 6 h (680 142.4 versus 342.3 99.7, P < 0.01) of reperfusion, but showed no statistical significance at 24 and 48 h and 7 d (Fig. 2). Nevertheless, compared with the CRI group, the ALT level in CPC-CRI group was notably higher at 2 h (839.2 132.5 versus 1087.5 192.5, P < 0.05) and comparable at 6 h (680 142.4 versus 626.7 140.9, P > 0.05), which implied that CPC does not work for hepatic congestion by IPC at early stage.
3.2.
Histologic assessment and TUNEL staining
Hepatic pathologic changes were insubstantial in the sham operation group, in the absence of evident vacuolization, and necrosis of hepatocytes. Significant necrosis with focal sinusoidal congestion and moderate vacuolization of hepatocytes was seen in the CRI group. Mild vacuolization, necrosis, and neutrophil accumulation was observed in IPC-CRI group compared with the CRI group; its Suzuki score was significantly lower (2 h: 3.2 0.4 versus 1.8 0.4 and 6 h: 3.2 0.3 versus 1.7 0.5, P < 0.05), but showed no statistical significance at 24 and 48 h and 7 d (Fig. 3). On the other hand, compared with the CRI group, CPC-CRI group demonstrated no beneficial effects but severe necrosis and clotting, whereas its Suzuki score was similar (2 h: 3.2 0.4 versus 3 1.1 and 6 h: 3.2 0.3 versus 3.5 0.5, P > 0.05). In contrast to the multiple apoptotic cells in the CRI group using TUNEL staining, the apoptotic hepatocytes declined dramatically in the IPC-CRI group (2 h: 22.0 13.8 versus 6.1 1.4, P < 0.05; 6 h: 10.7 6.0 versus 4.5 1.1, P < 0.05; 24 h: 12.1 8.5 versus 4.3 2.7, P < 0.05; positive cells/high power field; Fig. 4).
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
155
8.1 1.3 U/g versus 5.2 3.0 U/g, P < 0.05), suggesting less neutrophil infiltration after hepatic congestion by IPC at the early stage (Fig. 5). No statistically significant values were observed at 24 h.
3.4. Analysis of messenger RNA expression of inflammatory cytokine and chemokine
Fig. 2 e The serum level of ALT activity. In the CRI and IPCCRI group, ALT levels were significantly higher than those in the sham operation group. Compared with the CRI group, ALT levels in the IPC-CRI group were significantly lower at 2 and 6 h after reperfusion. (Data are shown as mean ± standard error of mean; **P < 0.01).
The messenger RNA expression of the inflammatory mediators, that is, IL-1, IL-6, TNF-a, MCP-1, and IFN-g were analyzed in the reperfused hepatic tissue. In comparison with the sham operation group, the expression of these inflammatory cytokines or chemokines was enhanced between 2 and 24 h after congestion. The expression of IL-1, IL-6, TNF-a, and MCP-1 in the IPC-CRI group showed apparent decline in comparison with those in the CRI group at 24 h. Notably, the messenger RNA level of IL-1 and IL-6 at 2 h and 6 h were also obviously lower in the IPC-CRI group than those in the CRI group (Fig. 6). However, there was not any statistical significance in IFN-g between those two groups.
4. 3.3.
MPO activity
Liver MPO, a neutrophil marker enzyme, was measured to determine the degree of neutrophil sequestration. CRI caused increment in MPO activity at 2, 6, and 24 h after reperfusion. Compared with the CRI group, the MPO levels were markedly decreased in the IPC-CRI group at 2 and 6 h (2 h: 7.1 4.0 U/g versus 3.8 1.6 U/g, P < 0.05; and 6 h:
Discussion
With the technical evolutions in hepatic surgery, CRI has become a major problem in LDLT. Inspite of extensive investigations into IRI of liver, few studies have focused on the reperfusion injury caused by acute hepatic venous outflow occlusion. Kimura et al. [15] found the detrimental impact intestinal venous congestion rather than arterial ischemia had on early inflammatory damage. More recently, Park et al. [16] reported an increased injury to the
Fig. 3 e (A) Hematoxylin and eosin staining in the CRI group reveal significant necrosis with focal sinusoidal congestion and moderate vacuolization. (B) Hematoxylin and eosin staining in the IPC-CRI group reveal improved necrosis and vacuolization. (C) Lower Suzuki score in the IPC-CRI group compared with CRI group at 2 and 6 h after reperfusion. (Data are shown as mean ± standard error of mean; *P < 0.05).
156
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
Fig. 4 e TUNEL staining reveal vast stretches of apoptotic cells in the CRI group at 2 h (A) and several apoptotic cells at 6 h (C) and 24 h (E). (B), (D), and (F) show significantly diminished apoptotic cells at 2, 6, and 24 h in the IPC-CRI group. (G) The positive cells decrease significantly in the IPC-CRI group compared with the CRI group after reperfusion. (Data are shown as mean ± standard error mean; *P < 0.05, **P < 0.01).
kidney by congestion rather than ischemia alone. Similar to the kidney and skin flaps [17], the liver is more susceptible to congestion [10,18]. Compared with IRI, CRI leads to intrasinusoidal hypertension, dilation of the hepatic sinus, and even regurgitation of the blood flow [10]. Because CRI
Fig. 5 e The MPO activity of the sham operation, CRI, and IPC-CRI group. MPO activity of the IPC-CRI group was significantly lower than that of the CRI group at 2 and 6 h after reperfusion. (Data are given as mean ± standard error of mean; *P < 0.05).
could not be avoided in LDLT, it is important to find an effective maneuver to alleviate this particular liver injury to the greatest extent. In a pilot study, CPC exhibited no healing effect for CRI, but rather severe necrosis and liver dysfunction. Alternatively, IPC, which prevents microcirculatory disturbances and loss of high-energy metabolites might be effective [19e21]. The results revealed for the first time that IPC improved liver tolerance to sustained congestion by diminishing hepatic enzymes, neutrophilic activity, formation of proinflammatory mediators, necrosis, and hepatocytes apoptosis. The histology and serum liver function tests were particularly more evident in the early stage of reperfusion than in the later stage. The chief inflammatory cytokines (IL-1, IL-6, and TNF-a) and the monocyte chemokines (MCP-1) were reduced distinctively in the later stage. Acute inflammation is characterized by an initial infiltration of neutrophils, which is then replaced by monocytes after 24 h to prevent increased tissue damage from the accumulation of neutrophil-secreted proteases and reactive oxygen species at the site of inflammation. Neutrophils have a short life span and die rapidly via apoptosis in vivo and in vitro [22]. That is the reason MPO levels were markedly decreased in the early period but no statistical significance observed at 24 h. As reported, Kupffer cells and neutrophils are activated, and they release a series of inflammatory cytokines such as IL-1, IL-6, and TNF-a, which in turn activate leukocytes and increase the release of peroxides [23e25]. This implied that the protection effect of IPC maybe
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
157
Fig. 6 e The messenger RNA expression of IL-1 (A), IL-6 (B), TNF-a (C), and MCP-1 (D). The threshold cycle (Ct) indicating the fractional cycle number at which the amount of amplified target reaches a fixed threshold. DCt [ Ct (target gene) L Ct (bactin), where b-actin is the endogenous reference. DDCt [ DCt (treated) L DCt (sham). The fold change in the target gene was calculated using the equation: quantity of target gene [ 2LDDCT. The higher histogram reflects higher messenger RNA expression. Data are given as mean ± standard error of mean of the fold increase relative to sham operation group. (*P < 0.05, **P < 0.01).
closely related to decrease the activation of Kupffer cell and neutrophil infiltration in the liver. IL-6 is a mediator of the acute phase response and differentiation or activation of macrophages, B-, and T-cells, and has both pro- and anti-inflammatory properties [22]. Likewise, IL-6 also activates the signal transducer and activator of transcription-3 (STAT3) and Src homology 2 domain-containing protein tyrosine phosphatase-2/Grb2-associated binder/mitogen-activated protein kinase signaling pathways via the glycoprotein 130 signal transducer [26,27]. It is known that TNF-a and IL-6 are required for liver regeneration by nuclear factor kappa B and STAT3. TNF-a and IL-6, which in turn facilitate the remnant hepatocytes to reenter the proliferation state [28e30]. In this study, the level of TNF-a and IL-6 was higher in the IPC group than in the sham operation group, but lower in the CRI group. Therefore, it can be inferred that a low dose of TNF-a and IL-6 may play a protective role in this model, whereas a higher dose augments hepatotoxicity rather than reducing hepatic CRI injury. Also it can be concluded that IPC can initiate hepatocyte proliferation and then compensate subsequent hepatocyte apoptosis induced by prolonged CRI. The protective signaling mechanism of IPC may be associated with TNF-a and IL-6 signals. This detrimental effect of hepatic CRI was manifested by decreased sinusoids perfusion and provoked activation of leukocytes as indicated by their enhanced interactions with the hepatic endothelial microvasculature [10]. It could be
hypothesized that preconditioning reduces neutrophil accumulation by preserving the endothelial cell integrity and reducing leukocyte adherence in sinusoids and postsinusoidal venules. Preconditioned liver may improve hepatic tissue blood flow, decrease hepatic vascular resistance, and ameliorate impairment of hepatic microcirculation after CRI. The precise protective mechanisms of IPC against hepatic CRI remain to be further elucidated. The adverse effect of CRI is considered to be drastic reduction in the hepatic effective microvascular bed leading to excessive portal perfusion injury in a small-for-size liver graft [31,32]. As mentioned, IPC is potentially able to attenuate the microvascular disorders and the inflammatory responses, and thus, it improves the effective sinusoid irrigation. A number of clinical trials have confirmed that inflow occlusion can be applied to living donor hepatectomy without graft injury [12]. Thus, the facilitation of IPC on hepatic CRI can be an option for the development of new strategies in LDLT. On the other hand, different pharmacologic therapeutic agents simulating the benefits of IPC on hepatic CRI could be of great interest.
5.
Conclusions
These results provide strong experimental evidence for the use of IPC against hepatic CRI. This simple and powerful pretreatment strategy holds great prospect of being translated
158
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 9 ( 2 0 1 4 ) 1 5 2 e1 5 8
into clinical use in LDLT. Further research is needed to achieve a better understanding of the underlying protective mechanisms.
Acknowledgment This work was supported by Natural Science Foundation of Zhejiang province (Y2110064 and LY12H03012) and National Natural Science Foundation of China (No. 81372626). Author contributions: Z.Q.Y. designed the study and wrote the article. Y.S. participated in data analysis and interpretation. T.Y., D.Y., and C.H. performed the experiment. Y.J. and F.Z.Y. carried out data collection and statistical analysis. O.A.K. edited and revised the article. Z.S.S. conceived the study conception and obtaining funding. All authors read and approved the final manuscript.
Disclosure The authors reported no proprietary or commercial interest in any product mentioned or concept discussed in this article.
references
[1] Lee S, Park K, Hwang S, et al. Congestion of right liver graft in living donor liver transplantation. Transplantation 2001;71: 812. [2] Fukuhara T, Umeda K, Toshima T, et al. Congestion of the donor remnant right liver after extended left lobe donation. Transpl Int 2009;22:837. [3] Fan ST, De Villa VH, Kiuchi T, et al. Right anterior sector drainage in right-lobe live-donor liver transplantation. Transplantation 2003;75:S25. [4] Gyu Lee S, Min Park K, Hwang S, et al. Modified right liver graft from a living donor to prevent congestion. Transplantation 2002;74:54. [5] Scatton O, Plasse M, Dondero F, et al. Impact of localized congestion related to venous deprivation after hepatectomy. Surgery 2008;143:483. [6] Wu J, Wang W, Zhang M, et al. Reconstruction of middle hepatic vein in living donor liver transplantation with modified right lobe graft: a single center experience. Transpl Int 2008;21:843. [7] Maetani Y, Itoh K, Egawa H, et al. Factors influencing liver regeneration following living-donor liver transplantation of the right hepatic lobe. Transplantation 2003;75:97. [8] Vardanian AJ, Busuttil RW, Kupiec-Weglinski JW. Molecular mediators of liver ischemia and reperfusion injury: a brief review. Mol Med 2008;14:337. [9] Malhi H, Gores GJ. Cellular and molecular mechanisms of liver injury. Gastroenterology 2008;134:1641. [10] Yan S, Zhou B, Zhang Q, et al. Hepatic venous occlusion causes more impairment after reperfusion compared with portal clamping in a murine model. J Surg Res 2011;169:117. [11] Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 1986;74:1124. [12] Clavien PA, Petrowsky H, DeOliveira ML, et al. Strategies for safer liver surgery and partial liver transplantation. N Engl J Med 2007;356:1545.
[13] Suzuki S, Toledo-Pereyra LH, Rodriguez FJ, et al. Neutrophil infiltration as an important factor in liver ischemia and reperfusion injury. Modulating effects of FK506 and cyclosporine. Transplantation 1993;55:1265. [14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402. [15] Kimura M, Kataoka M, Kuwabara Y, et al. Real-time energy metabolism of intestine during arterial versus venous occlusion in the rat. J Gastroenterol 2003;38:849. [16] Park Y, Hirose R, Dang K, et al. Increased severity of renal ischemia-reperfusion injury with venous clamping compared to arterial clamping in a rat model. Surgery 2008; 143:243. [17] Hauge EM, Balling E, Hartmund T, et al. Secondary ischemia caused by venous or arterial occlusion shows differential effects on myocutaneous island flap survival and muscle ATP levels. Plast Reconstr Surg 1997;99:825. [18] Dirsch O, Madrahimov N, Chaudri N, et al. Recovery of liver perfusion after focal outflow obstruction and liver resection. Transplantation 2008;85:748. [19] Serafin A, Fernandez-Zabalegui L, Prats N, et al. Ischemic preconditioning: tolerance to hepatic ischemia-reperfusion injury. Histol Histopathol 2004;19:281. [20] Yan S, Jin LM, Liu YX, et al. Outcomes and mechanisms of ischemic preconditioning in liver transplantation. Hepatobiliary Pancreat Dis Int 2010;9:346. [21] Peralta C, Bartrons R, Serafin A, et al. Adenosine monophosphate-activated protein kinase mediates the protective effects of ischemic preconditioning on hepatic ischemia-reperfusion injury in the rat. Hepatology 2001;34: 1164. [22] Scheller J, Chalaris A, Schmidt-Arras D, et al. The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 2011;1813:878. [23] Bilzer M, Roggel F, Gerbes AL. Role of Kupffer cells in host defense and liver disease. Liver Int 2006;26:1175. [24] Arii S, Teramoto K, Kawamura T. Current progress in the understanding of and therapeutic strategies for ischemia and reperfusion injury of the liver. J Hepatobiliary Pancreat Surg 2003;10:189. [25] Peralta C, Prats N, Xaus C, et al. Protective effect of liver ischemic preconditioning on liver and lung injury induced by hepatic ischemia-reperfusion in the rat. Hepatology 1999;30: 1481. [26] Xing Z, Gauldie J, Cox G, et al. IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses. J Clin Invest 1998;101:311. [27] Mihara M, Hashizume M, Yoshida H, et al. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond) 2012;122:143. [28] Teoh N, Leclercq I, Pena AD, et al. Low-dose TNF-alpha protects against hepatic ischemia-reperfusion injury in mice: implications for preconditioning. Hepatology 2003;37:118. [29] Teoh N, Field J, Farrell G. Interleukin-6 is a key mediator of the hepatoprotective and pro-proliferative effects of ischaemic preconditioning in mice. J Hepatol 2006;45:20. [30] Sudo K, Yamada Y, Saito K, et al. TNF-alpha and IL-6 signals from the bone marrow derived cells are necessary for normal murine liver regeneration. Biochim Biophys Acta 2008;1782: 671. [31] Tanaka K, Ogura Y. “Small-for-size graft” and “small-for-size syndrome” in living donor liver transplantation. Yonsei Med J 2004;45:1089. [32] Yagi S, Uemoto S. Small-for-size syndrome in living donor liver transplantation. Hepatobiliary Pancreat Dis Int 2012;11: 570.