- Email: [email protected]
Isolation and Characterization of a Novel Human paired-like Homeodomain-Containing Transcription Factor Gene, VSX1, Expressed in Ocular Tissues
All articles available online at http://www.idealibrary.com on
SHORT COMMUNICATION Isolation and Characterization of a Novel Human paired-like Homeodomain-Containing Transcription Factor Gene, VSX1, Expressed in Ocular Tissues E. V. Semina,* ,1 H. A. Mintz-Hittner,† and J. C. Murray* ,‡ *Department of Pediatrics and ‡Department of Biological Sciences, University of Iowa, Iowa City, Iowa 52242; and †Department of Ophthalmology and Visual Science, University of Texas–Houston Medical School, Houston, Texas 77030 Received September 3, 1999; accepted December 1, 1999
Homeodomain transcription factors control cell fates during the development of all animals. The paired-like subfamily of homeodomain proteins has been particularly implicated in ocular development in different species. In this paper we report the cDNA sequence, genomic structure, localization, and expression data of a novel paired-like homeobox-containing gene, VSX1, isolated from a human embryonic craniofacial cDNA library using the degenerate-PCR approach. The composed VSX1 cDNA sequence of 1433 bp was predicted to encode a protein of 365 amino acid residues. Maximal homology at the protein level was identified with the paired-like homeoproteins of the CVC-domain family: 92–97% identity was seen in the homeodomain region with 55% overall identity to zebrafish and goldfish Vsx1 and 35% overall identity to goldfish Vsx2 and murine Chx10. The gene was found to consist of five exons that are distributed over 6.2 kb of genomic sequence. VSX1 was localized to the 20p11– q11 region, which is homologous with the distal part of mouse chromosome 2. Expression of VSX1 was detected in embryonic craniofacial and adult ocular tissues. Several ocular phenotypes have been mapped to the VSX1 region in both human and mouse genomes, and its candidacy for these disorders is discussed. © 2000 Academic Press
Homeobox-containing genes encode transcription factors that control a variety of cell fate decisions during the development of all animals. This family is characterized by a 180-bp motif called the homeobox that encodes a homeodomain (HD). The homeodomain represents a helix-turn-helix motif that directs specific DNA binding to regulate the expression of target Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AF176797. 1 To whom correspondence should be addressed at 140F EMRB, Department of Pediatrics, The University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242-1083. Telephone: (319) 335-6566. Fax: (319) 335-6970. E-mail: [email protected].
genes. Homeobox genes were shown to underlie many human disorders and animal phenotypes; therefore a concentrated effort was made to identify novel homeobox genes and to study their functional roles. The paired-like family of homeobox genes appears to play a particular role in craniofacial and ocular development (1–3, 5, 8, 9, 12, 13, 17–20, 23). This family is characterized by a homeodomain related to Drosophila paired. There are six invariant amino acid residues in the paired-like homeodomain, while the residue at position 50 can be a serine (S50) as in the Pax-type, a glutamine (Q50) as in the aristaless-type, or a lysine (K50) as in the bicoid-type (4). We have employed the degenerate PCR approach to isolate paired-like homeobox sequences from the human embryonic craniofacial library (14). A Bluescript plasmid library of craniofacial homeobox sequences has been created by cloning the PCR products obtained by amplification with degenerate primers directed toward highly conserved motifs within the paired-like homeodomain. The 3⬘ primer, paired-3⬘R, designed from the NRRAKWR sequence located in helix 3 was employed with two alternative 5⬘ primers, paired-5⬘.1F and paired-5⬘.2F designed from the conserved RRQ/HRTT/IF and K/RTHYPD sequences (see Fig. 1B). The 3⬘-primer contained a HindIII site and the 5⬘-primers contained an EcoRI site in the 5⬘ end to facilitate specific cloning of the products into the plasmid vector. Unique clones were sequenced in both directions using automated sequencing. With this technique, a plasmid HxHc1-18 containing a novel paired-like homeobox sequence was identified. To amplify a full-length cDNA insert from the craniofacial cDNA library, PCR was performed using oligonucleotides designed from the ends of the HxHc1-18 sequence and T3 and T7 primers. The PCR products were sequenced in both directions, and sequences were used to construct a cDNA contig. The HxHc1-18 cDNA contig was found to be 1433 bp in length and to contain a 1095-nt open reading frame (ORF), which was predicted to encode a protein of 365
289
Genomics 63, 289 –293 (2000) doi:10.1006/geno.1999.6093 0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
290
SHORT COMMUNICATION
FIG. 1. (A) The cDNA sequence and predicted protein sequence of the VSX1 gene. The homeodomain region is shown in boldface type; the CVC-domain is underlined. The initiative methionine and stop codons are shown in boldface type as is the 5⬘ methionine codon, which is also italicized. Multiple stop codons in the 5⬘ region are underlined. Positions of introns are indicated with a backslash. (B) Homeodomain sequence comparison between different paired-like proteins. The conserved glutamine at position 50 of the homeodomain (position 9 of the third helix) is shown in boldface type.
amino acids (Fig. 1A). The putative initiation codon of this ORF was found at position 274 of the cDNA, representing the first in-frame ATG codon in the 5⬘ region that is not followed by a stop codon. The sequence 5⬘ of the proposed initiating methionine had stop codons in all three ORFs. The upstream in-frame initiation codon was found at nucleotide 7; the ORF associated with this ATG codon is predicted to encode a low-complexity
16-amino-acid peptide, with four stop codons terminating this ORF between the first and the second ATG codons. Thus, the upstream ATG codon was considered to be an unlikely site for translation initiation and would not interfere with efficient translation starting from the proposed initiating methionine. The 3⬘ region of the cDNA was found to be 65 bp in length and to lack a polyadenylation signal and a poly(A) tail. Compari-
SHORT COMMUNICATION
291
FIG. 2. Comparison of the protein sequences of different CVC domain proteins. The amino acid residues that are identical among all of the proteins are shown in dark gray, while amino acids characteristic for the VSX1/Vsx1 or Vsx2/Chx10 groups are shown in light gray. The homeodomain regions are shown in boldface type, the CVC domains are underlined, and the 14-aa motif region is boxed. Line 1, human VSX1; 2, goldfish Vsx1; 3, zebrafish Vsx1; 4, mouse Chx10; 5, goldfish Vsx2.
son of the HxHc1-18 nucleotide sequence with GenBank sequences revealed strong homology (92%) in the region spanning nt 681–901 of the cDNA with the EST clone H87757. The overall HxHc1-18 composite cDNA sequence represented a novel gene. The region spanning nt 751–943 revealed significant homology with the homeobox sequence, indicating that this gene encodes a homeodomain protein. The maximum homology in the homeodomain region was identified with paired-like proteins, particularly of the CVC-domain class, such as the Caenorhabditis elegans ceh-10 (22), zebrafish and goldfish Vsx1 and Vsx2 (10, 15, 16), and murine Chx10 (1) (Fig. 1B). Within this family, the HxHc1-18 protein sequence had the most homology with the zebrafish and goldfish Vsx1 proteins; therefore the new gene and encoded protein were named VSX1. The human VSX1 homeodomain sequence is different from the fish sequence by 3 residues. All homeodomains share a glutamine residue at position 50 of the homeodomain (position 9 of the third helix), which is characteristic of the aristaless-type paired-like homeoproteins. The amino acid at position 50 has been shown to determine the specificity of DNA binding to the two bases following the TAAT core (6). The CVC domain of the VSX1 protein is different from the known Vsx1 proteins by 15 residues and from the Chx10 and Vsx2 proteins by 13 residues (Fig. 2). The function of this domain is unknown, but because of its proximity to the homeodomain, it is likely to participate in DNA binding. The human VSX1
protein sequence showed 55% overall identity with the fish Vsx1 proteins and 36% overall identity with the murine Chx10 and the goldfish Vsx2 proteins; there was no homology with the C. elegans ceh-10 protein outside the homeodomain and CVC domain. Additional conserved sequence, the 14-amino acid motif that is often found in the paired-like proteins including the murine Chx10 and the goldfish Vsx2 proteins (17), is not conserved in the human VSX1 and fish Vsx1 proteins (see Fig. 2). The fish Vsx1 and Vsx2 and the murine Chx10 genes play important role in retinogenesis and are strongly expressed in the developing neuroretina. The Chx10 mutation was found to cause the ocular retardation phenotype in the mouse, characterized by microphthalmia, a thin hypocellular retina, and optic nerve aplasia (1, 11). The human CHX10 gene was mapped to the 14q24.3 region, which is homologous to the central part of mouse chromosome 12 where the mouse Chx10 gene is located. A genomic clone containing the VSX1 gene was identified by PCR screening of the human BAC library (Research Genetics) with specific oligonucleotides from the 3⬘UTR of the gene: forward, tcccactgtcaaaggctgaa, and reverse, ttatcttgacattgtcagaag. The genomic structure of the gene was identified by sequencing the BAC clone with VSX1-specific primers while the introns were sized by long-term PCR as previously described (19). The VSX1 gene was found to comprise about 6.2 kb of genomic sequence and to consist of five exons of 698, 89, 124, 181, and 352 nucleotides in length. The
292
SHORT COMMUNICATION
FIG. 3. Genomic structure of the VSX1 gene. The coding region is shown in gray, and the homeobox region is shown in black. The sizes of introns are indicated.
initiation codon is located in the first exon, the homeobox region is located in the second, third, and fourth exons, and the CVC – domain is found in the fourth and fifth exons. The genomic structure of the gene is illustrated in Fig. 3, and the exon–intron boundary sequences are presented in Table 1. VSX1 gene expression was analyzed by PCR amplification of VSX1-specific products from a cDNA panel consisting of human embryonic craniofacial, adult retina, cornea, and lens cDNAs and also cDNAs available from Clontech, using standard protocols (18). The following VSX1 primers were used: exon 3, forward, tgaggacagaccagtctgaa, and exon 4, reverse, agctggtgagcagtgaaaac. The HPRT-specific primers were used in control reactions as described elsewhere. The VSX1 transcripts were identified in the embryonic craniofacial and adult retina and cornea cDNAs but not in adult lens, embryonic or adult brain, heart, kidney, liver, lung, skeletal muscles, spleen, and thymus cDNAs (Fig. 4). The VSX1 expression pattern corresponds well with the expression of other known CVCdomain genes that were found to be restricted to the embryonic and adult eye (1, 15, 16). Identification of the murine homologue of the human VSX1 gene should facilitate studies of its expression in mammals. Mapping of the human VSX1 gene was performed using the GeneBridge 4 radiation hybrid panel. Ninety-three RH lines were typed by PCR with the VSX1 3⬘UTR-specific primers (see above) using standard PCR conditions. Twenty-seven RH lines were positive for the VSX1-specific sequence (retention frequency 30%). VSX1 was placed 9.21 cR telomeric from WI-1163 (LOD ⬎ 3.0), residing in the p11– q11 region of human chromosome 20. Screening of the OMIM database human gene map (http://www.ncbi.nlm.nih.gov/ Omim/searchmap.html) identified no known pairedlike genes in this region. The homologous region in the mouse genome is located on the distal part of chromosome 2 according to the Mouse Genome Database (MGD) comparative map (http://www.informatics.jax. org/searches/linkmap_form.shtml). Inspection of the human and mouse phenotypes incorporated into the
FIG. 4. An agarose gel representing results of the PCR amplification reaction with the VSX1-specific primers. (A) Lanes 1, H 2O; 2, craniofacial embryonic cDNA; 3–10, Clontech fetal cDNAs. (B) Lanes 1, -H 2O; 2,- adult retina; 3,-adult cornea; 4,-adult lens; 5–12, Clontech adult cDNAs: 5, brain; 6,- heart; 7,- kidney; 8,- liver; 9,- lung; 10,- skeletal muscle; 11,- spleen; 12,- thymus. a corresponds to the product obtained with the VSX1-specific primers, while b corresponds to the product obtained with the HPRT-specific primers.
OMIM and MGD maps revealed several ocular conditions in these regions. The 20p11– q11 region of the human genome has previously been shown to contain genes for congenital hereditary endothelial dystrophy (CHED) (24) and posterior polymorphous dystrophy (PPD) (7). Two mouse mutations were mapped to the homologous region on mouse chromosome 2: corneal disease 1 (21) and blind-sterile (25). CHED and PPD belong to a group of ocular disorders collectively known as the corneal endothelial dystrophies. The pathogenesis in both abnormalities is considered to be due to a primary dysfunction of the corneal epithelium and more specifically due to the abnormal terminal differentiation of secondary mesenchyme in the later stages of embryonic development (24). The mouse recessive corneal 1 mutation (corn1) is characterized by corneal epithelial hyperplasia as indicated by early irregular thickening of the corneal epithelium, development of stromal neovascularization by 20 days of age, and cataracts by 48 days of age 21). The blind-sterile (bs) mutation is also recessive, and homozygous mice display bilateral nuclear cataracts, eyes that are slightly smaller than normal, glossy coats, and sterility in males (25). In summary, the VSX1 gene encodes a novel pairedlike homeodomain-containing transcription factor that
TABLE 1 The Exon–Intron Junction Sequences of the VSX1 Gene Exon
5⬘ sequence
3⬘ sequence
1 2 3 4 5
— tcttctttctgtgccatcagATGAGGACAGCCA gtgttttggggtccttgcagGACAGTTTTCACT cttctcctgcctccaaccagGTCTGGTTTCAAA tttattttttttttttacaagGGATGCATAAAAAA
GTCTCCACGTCCGgtaatcaggcccgcgctttc GCGGCGGCACAGgtatagggccaggcagtccc AGACCGGATACAGgtgtctggggtcccttttctc CCTGGCTCCTGGgtaaggaagggcccccggga —
Note. Exon sequence is shown in uppercase letters, and intron sequence is shown in lowercase letters.
SHORT COMMUNICATION
represents a good candidate for both human and mouse ocular developmental phenotypes. Identification of the mouse orthologue of the VSX1 gene and studies of its embryonic expression in both species should help to define its developmental role.
11.
12.
ACKNOWLEDGMENTS We thank B. Schutte and M. Malik, P. Rodriges, and N. Kiliak for sharing the Clontech panels and the adult lens, cornea, and retina cDNAs, respectively, and we thank Bonnie Ludwig for help with sequencing. This work was supported by NIH-NEI Grant EY12384 to J.C.M., by grants from the Hermann Eye Fund and the J. M. West Texas Corp. (Houston, TX), by a grant from Research to Prevent Blindness, Inc. (New York, NY); and by Vision Core NIH Grant EY10608 to H.A.M.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Burmeister, M., Novak, J., Liang, M. Y, Basu, S., Ploder, L., Hawes, N. L., Vidgen, D., Hoover, F., Goldman, D., Kalnins, V. I., Roderick, T. H., Taylor, B. A., Hankin, M. H., and McInnes, R. R. (1996). Ocular retardation mouse caused by Chx10 homeobox null allele: Impaired retinal progenitor proliferation and bipolar cell differentiation. Nat. Genet. 12: 376 – 384. Dattani, M. T., Martinez-Barbera, J. P., Thomas, P. Q., Brickman, J. M., Gupta, R., Martensson, I. L., Toresson, H., Fox, M., Wales, J. K., Hindmarsh, P. C., Krauss, S., Beddington, R. S., and Robinson, I. C. (1998). Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat. Genet. 19: 125–133. Freund, C. L., Gregory-Evans, C. Y., Furukawa, T., Papaioannou, M., Looser, J., Ploder, L., Bellingham, J., Ng, D., Herbrick, J. A., Duncan, A., Scherer, S. W., Tsui, L. C., Loutradis-Anagnostou, A., Jacobson, S. G., Cepko, C. L., Bhattacharya, S. S., and McInnes, R. R. (1997). Cone–rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell 91: 543–553. Galliot, B., de Vargas, C., and Miller, D. (1999). Evolution of homeobox genes: Q50 Paired-like genes founded the Paired class. Dev. Genes Evol. 209: 186 –197. Glaser, T., Walton, D. S., and Maas, R. L. (1992). Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat. Genet. 2: 232–239. Hanes, S. D., and Brent, R. (1991). A genetic model for interaction of the homeodomain recognition helix with DNA. Science 251: 426 – 430. Heon, E., Mathers, W. D., Alward, W. L., Weisenthal, R. W., Sunden, S. L., Fishbaugh, J. A., Taylor, C. M., Krachmer, J. H., Sheffield, V. C., and Stone, E. M. (1995). Linkage of posterior polymorphous corneal dystrophy to 20q11. Hum. Mol. Genet. 4: 485– 488. Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522– 525. Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., Hastie, N., and van Heyningen, V. (1992). The human PAX6 gene is mutated in two patients with aniridia. Nat. Genet. 1: 328 –332. Levine, E. M., Hitchcock, P. F., Glasgow, E., and Schechter, N. (1994). Restricted expression of a new paired-class homeobox gene in normal and regenerating adult goldfish retina. J. Comp. Neurol. 348: 596 – 606.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
293
Liu, I. S., Chen, J. D., Ploder, L., Vidgen, D., van der Kooy, D., Kalnins, V. I., and McInnes, R. R. (1994). Developmental expression of a novel murine homeobox gene (Chx10): Evidence for roles in determination of the neuroretina and inner nuclear layer. Neuron 13: 377–393. Lu, M. F., Cheng, H. T., Kern, M. J., Potter, S. S., Tran, B., Diekwisch, T. G., and Martin, J. F. (1999). prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme. Development 126: 495–504. Mathers, P. H., Grinberg, A., Mahon, K. A., and Jamrich, M. (1997). The Rx homeobox gene is essential for vertebrate eye development. Nature 387: 603– 607. Padanilam, B. J., Stadler, H. S., Mills, K. A., McLeod, L. B., Solursh, M., Lee, B., Ramirez, F., Buetow, K. H., and Murray, J. C. (1992). Characterization of the human HOX 7 cDNA and identification of polymorphic markers. Hum. Mol. Genet. 1: 407– 410. Passini, M. A., Levine, E. M., Canger, A. K., Raymond, P. A., and Schechter, N. (1997). Vsx-1 and Vsx-2: Differential expression of two paired-like homeobox genes during zebrafish and goldfish retinogenesis. J. Comp. Neurol. 388: 495–505. Passini, M. A., Kurtzman, A. L., Canger, A. K., Asch, W. S., Wray, G. A., Raymond, P. A., and Schechter, N. (1998). Cloning of zebrafish vsx1: Expression of a paired-like homeobox gene during CNS development. Dev. Genet. 23: 128 –141. Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., Datson, N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel, B. U., Carey, J. C., and Murray, J. C. (1996). Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. 14: 392–399. Semina, E. V., Reiter, R. S., and Murray, J. C. (1997). Isolation of a new homeobox gene belonging to the Pitx/Rieg family: Expression during lens development and mapping to the aphakia region on mouse chromosome 19. Hum. Mol. Genet. 6: 2109 –2116. Semina, E. V., Ferrell, R. E., Mintz-Hittner, H. A., Bitoun, P., Alward, W. L., Reiter, R. S., Funkhauser, C., Daack-Hirsch, S., and Murray, J. C. (1998). A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat. Genet. 19: 167–170. Sanyanusin, P., Schimmenti, L. A., McNoe, L. A., Ward, T. A., Pierpont, M. E. M., Sullivan, M. J., Dobyns, W. B., and Eccles, M. R. (1995). Mutation of the PAX2 gene in a family with optic nerve colobomas, renal anomalies and vesicoureteral reflux. Nat. Genet. 9: 358 –364. Smith, R. S., Hawes, N. L., Kuhlmann, S. D., Heckenlively, J. R., Chang, B., Roderick, T. H., and Sundberg, J. (1996). Corn1: A mouse model for corneal surface disease and neovascularization. Invest. Ophthalmol. Vis. Sci. 37: 397– 404. Svendsen, P. C., and McGhee, J. D. (1995). The C. elegans neuronally expressed homeobox gene ceh-10 is closely related to genes expressed in the vertebrate eye. Development 121: 1253– 1262. Swaroop, A., Wang, Q. L., Wu, W., Cook, J., Coats, C., Xu, S., Chen, S., Zack, D. J., and Sieving, P. A. (1999). Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: Direct evidence for the involvement of CRX in the development of photoreceptor function. Hum. Mol. Genet. 8: 299 –305. Toma, N. M., Ebenezer, N. D., Inglehearn, C. F., Plant, C., Ficker, L. A., and Bhattacharya, S. S. (1995). Linkage of congenital hereditary endothelial dystrophy to chromosome 20. Hum. Mol. Genet. 4: 2395–2398. Varnum, D. S. (1983). Blind-sterile: A new mutation on chromosome 2 of the house mouse. J. Hered. 74: 206 –207.
SHORT COMMUNICATION Isolation and Characterization of a Novel Human paired-like Homeodomain-Containing Transcription Factor Gene, VSX1, Expressed in Ocular Tissues E. V. Semina,* ,1 H. A. Mintz-Hittner,† and J. C. Murray* ,‡ *Department of Pediatrics and ‡Department of Biological Sciences, University of Iowa, Iowa City, Iowa 52242; and †Department of Ophthalmology and Visual Science, University of Texas–Houston Medical School, Houston, Texas 77030 Received September 3, 1999; accepted December 1, 1999
Homeodomain transcription factors control cell fates during the development of all animals. The paired-like subfamily of homeodomain proteins has been particularly implicated in ocular development in different species. In this paper we report the cDNA sequence, genomic structure, localization, and expression data of a novel paired-like homeobox-containing gene, VSX1, isolated from a human embryonic craniofacial cDNA library using the degenerate-PCR approach. The composed VSX1 cDNA sequence of 1433 bp was predicted to encode a protein of 365 amino acid residues. Maximal homology at the protein level was identified with the paired-like homeoproteins of the CVC-domain family: 92–97% identity was seen in the homeodomain region with 55% overall identity to zebrafish and goldfish Vsx1 and 35% overall identity to goldfish Vsx2 and murine Chx10. The gene was found to consist of five exons that are distributed over 6.2 kb of genomic sequence. VSX1 was localized to the 20p11– q11 region, which is homologous with the distal part of mouse chromosome 2. Expression of VSX1 was detected in embryonic craniofacial and adult ocular tissues. Several ocular phenotypes have been mapped to the VSX1 region in both human and mouse genomes, and its candidacy for these disorders is discussed. © 2000 Academic Press
Homeobox-containing genes encode transcription factors that control a variety of cell fate decisions during the development of all animals. This family is characterized by a 180-bp motif called the homeobox that encodes a homeodomain (HD). The homeodomain represents a helix-turn-helix motif that directs specific DNA binding to regulate the expression of target Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AF176797. 1 To whom correspondence should be addressed at 140F EMRB, Department of Pediatrics, The University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242-1083. Telephone: (319) 335-6566. Fax: (319) 335-6970. E-mail: [email protected].
genes. Homeobox genes were shown to underlie many human disorders and animal phenotypes; therefore a concentrated effort was made to identify novel homeobox genes and to study their functional roles. The paired-like family of homeobox genes appears to play a particular role in craniofacial and ocular development (1–3, 5, 8, 9, 12, 13, 17–20, 23). This family is characterized by a homeodomain related to Drosophila paired. There are six invariant amino acid residues in the paired-like homeodomain, while the residue at position 50 can be a serine (S50) as in the Pax-type, a glutamine (Q50) as in the aristaless-type, or a lysine (K50) as in the bicoid-type (4). We have employed the degenerate PCR approach to isolate paired-like homeobox sequences from the human embryonic craniofacial library (14). A Bluescript plasmid library of craniofacial homeobox sequences has been created by cloning the PCR products obtained by amplification with degenerate primers directed toward highly conserved motifs within the paired-like homeodomain. The 3⬘ primer, paired-3⬘R, designed from the NRRAKWR sequence located in helix 3 was employed with two alternative 5⬘ primers, paired-5⬘.1F and paired-5⬘.2F designed from the conserved RRQ/HRTT/IF and K/RTHYPD sequences (see Fig. 1B). The 3⬘-primer contained a HindIII site and the 5⬘-primers contained an EcoRI site in the 5⬘ end to facilitate specific cloning of the products into the plasmid vector. Unique clones were sequenced in both directions using automated sequencing. With this technique, a plasmid HxHc1-18 containing a novel paired-like homeobox sequence was identified. To amplify a full-length cDNA insert from the craniofacial cDNA library, PCR was performed using oligonucleotides designed from the ends of the HxHc1-18 sequence and T3 and T7 primers. The PCR products were sequenced in both directions, and sequences were used to construct a cDNA contig. The HxHc1-18 cDNA contig was found to be 1433 bp in length and to contain a 1095-nt open reading frame (ORF), which was predicted to encode a protein of 365
289
Genomics 63, 289 –293 (2000) doi:10.1006/geno.1999.6093 0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
290
SHORT COMMUNICATION
FIG. 1. (A) The cDNA sequence and predicted protein sequence of the VSX1 gene. The homeodomain region is shown in boldface type; the CVC-domain is underlined. The initiative methionine and stop codons are shown in boldface type as is the 5⬘ methionine codon, which is also italicized. Multiple stop codons in the 5⬘ region are underlined. Positions of introns are indicated with a backslash. (B) Homeodomain sequence comparison between different paired-like proteins. The conserved glutamine at position 50 of the homeodomain (position 9 of the third helix) is shown in boldface type.
amino acids (Fig. 1A). The putative initiation codon of this ORF was found at position 274 of the cDNA, representing the first in-frame ATG codon in the 5⬘ region that is not followed by a stop codon. The sequence 5⬘ of the proposed initiating methionine had stop codons in all three ORFs. The upstream in-frame initiation codon was found at nucleotide 7; the ORF associated with this ATG codon is predicted to encode a low-complexity
16-amino-acid peptide, with four stop codons terminating this ORF between the first and the second ATG codons. Thus, the upstream ATG codon was considered to be an unlikely site for translation initiation and would not interfere with efficient translation starting from the proposed initiating methionine. The 3⬘ region of the cDNA was found to be 65 bp in length and to lack a polyadenylation signal and a poly(A) tail. Compari-
SHORT COMMUNICATION
291
FIG. 2. Comparison of the protein sequences of different CVC domain proteins. The amino acid residues that are identical among all of the proteins are shown in dark gray, while amino acids characteristic for the VSX1/Vsx1 or Vsx2/Chx10 groups are shown in light gray. The homeodomain regions are shown in boldface type, the CVC domains are underlined, and the 14-aa motif region is boxed. Line 1, human VSX1; 2, goldfish Vsx1; 3, zebrafish Vsx1; 4, mouse Chx10; 5, goldfish Vsx2.
son of the HxHc1-18 nucleotide sequence with GenBank sequences revealed strong homology (92%) in the region spanning nt 681–901 of the cDNA with the EST clone H87757. The overall HxHc1-18 composite cDNA sequence represented a novel gene. The region spanning nt 751–943 revealed significant homology with the homeobox sequence, indicating that this gene encodes a homeodomain protein. The maximum homology in the homeodomain region was identified with paired-like proteins, particularly of the CVC-domain class, such as the Caenorhabditis elegans ceh-10 (22), zebrafish and goldfish Vsx1 and Vsx2 (10, 15, 16), and murine Chx10 (1) (Fig. 1B). Within this family, the HxHc1-18 protein sequence had the most homology with the zebrafish and goldfish Vsx1 proteins; therefore the new gene and encoded protein were named VSX1. The human VSX1 homeodomain sequence is different from the fish sequence by 3 residues. All homeodomains share a glutamine residue at position 50 of the homeodomain (position 9 of the third helix), which is characteristic of the aristaless-type paired-like homeoproteins. The amino acid at position 50 has been shown to determine the specificity of DNA binding to the two bases following the TAAT core (6). The CVC domain of the VSX1 protein is different from the known Vsx1 proteins by 15 residues and from the Chx10 and Vsx2 proteins by 13 residues (Fig. 2). The function of this domain is unknown, but because of its proximity to the homeodomain, it is likely to participate in DNA binding. The human VSX1
protein sequence showed 55% overall identity with the fish Vsx1 proteins and 36% overall identity with the murine Chx10 and the goldfish Vsx2 proteins; there was no homology with the C. elegans ceh-10 protein outside the homeodomain and CVC domain. Additional conserved sequence, the 14-amino acid motif that is often found in the paired-like proteins including the murine Chx10 and the goldfish Vsx2 proteins (17), is not conserved in the human VSX1 and fish Vsx1 proteins (see Fig. 2). The fish Vsx1 and Vsx2 and the murine Chx10 genes play important role in retinogenesis and are strongly expressed in the developing neuroretina. The Chx10 mutation was found to cause the ocular retardation phenotype in the mouse, characterized by microphthalmia, a thin hypocellular retina, and optic nerve aplasia (1, 11). The human CHX10 gene was mapped to the 14q24.3 region, which is homologous to the central part of mouse chromosome 12 where the mouse Chx10 gene is located. A genomic clone containing the VSX1 gene was identified by PCR screening of the human BAC library (Research Genetics) with specific oligonucleotides from the 3⬘UTR of the gene: forward, tcccactgtcaaaggctgaa, and reverse, ttatcttgacattgtcagaag. The genomic structure of the gene was identified by sequencing the BAC clone with VSX1-specific primers while the introns were sized by long-term PCR as previously described (19). The VSX1 gene was found to comprise about 6.2 kb of genomic sequence and to consist of five exons of 698, 89, 124, 181, and 352 nucleotides in length. The
292
SHORT COMMUNICATION
FIG. 3. Genomic structure of the VSX1 gene. The coding region is shown in gray, and the homeobox region is shown in black. The sizes of introns are indicated.
initiation codon is located in the first exon, the homeobox region is located in the second, third, and fourth exons, and the CVC – domain is found in the fourth and fifth exons. The genomic structure of the gene is illustrated in Fig. 3, and the exon–intron boundary sequences are presented in Table 1. VSX1 gene expression was analyzed by PCR amplification of VSX1-specific products from a cDNA panel consisting of human embryonic craniofacial, adult retina, cornea, and lens cDNAs and also cDNAs available from Clontech, using standard protocols (18). The following VSX1 primers were used: exon 3, forward, tgaggacagaccagtctgaa, and exon 4, reverse, agctggtgagcagtgaaaac. The HPRT-specific primers were used in control reactions as described elsewhere. The VSX1 transcripts were identified in the embryonic craniofacial and adult retina and cornea cDNAs but not in adult lens, embryonic or adult brain, heart, kidney, liver, lung, skeletal muscles, spleen, and thymus cDNAs (Fig. 4). The VSX1 expression pattern corresponds well with the expression of other known CVCdomain genes that were found to be restricted to the embryonic and adult eye (1, 15, 16). Identification of the murine homologue of the human VSX1 gene should facilitate studies of its expression in mammals. Mapping of the human VSX1 gene was performed using the GeneBridge 4 radiation hybrid panel. Ninety-three RH lines were typed by PCR with the VSX1 3⬘UTR-specific primers (see above) using standard PCR conditions. Twenty-seven RH lines were positive for the VSX1-specific sequence (retention frequency 30%). VSX1 was placed 9.21 cR telomeric from WI-1163 (LOD ⬎ 3.0), residing in the p11– q11 region of human chromosome 20. Screening of the OMIM database human gene map (http://www.ncbi.nlm.nih.gov/ Omim/searchmap.html) identified no known pairedlike genes in this region. The homologous region in the mouse genome is located on the distal part of chromosome 2 according to the Mouse Genome Database (MGD) comparative map (http://www.informatics.jax. org/searches/linkmap_form.shtml). Inspection of the human and mouse phenotypes incorporated into the
FIG. 4. An agarose gel representing results of the PCR amplification reaction with the VSX1-specific primers. (A) Lanes 1, H 2O; 2, craniofacial embryonic cDNA; 3–10, Clontech fetal cDNAs. (B) Lanes 1, -H 2O; 2,- adult retina; 3,-adult cornea; 4,-adult lens; 5–12, Clontech adult cDNAs: 5, brain; 6,- heart; 7,- kidney; 8,- liver; 9,- lung; 10,- skeletal muscle; 11,- spleen; 12,- thymus. a corresponds to the product obtained with the VSX1-specific primers, while b corresponds to the product obtained with the HPRT-specific primers.
OMIM and MGD maps revealed several ocular conditions in these regions. The 20p11– q11 region of the human genome has previously been shown to contain genes for congenital hereditary endothelial dystrophy (CHED) (24) and posterior polymorphous dystrophy (PPD) (7). Two mouse mutations were mapped to the homologous region on mouse chromosome 2: corneal disease 1 (21) and blind-sterile (25). CHED and PPD belong to a group of ocular disorders collectively known as the corneal endothelial dystrophies. The pathogenesis in both abnormalities is considered to be due to a primary dysfunction of the corneal epithelium and more specifically due to the abnormal terminal differentiation of secondary mesenchyme in the later stages of embryonic development (24). The mouse recessive corneal 1 mutation (corn1) is characterized by corneal epithelial hyperplasia as indicated by early irregular thickening of the corneal epithelium, development of stromal neovascularization by 20 days of age, and cataracts by 48 days of age 21). The blind-sterile (bs) mutation is also recessive, and homozygous mice display bilateral nuclear cataracts, eyes that are slightly smaller than normal, glossy coats, and sterility in males (25). In summary, the VSX1 gene encodes a novel pairedlike homeodomain-containing transcription factor that
TABLE 1 The Exon–Intron Junction Sequences of the VSX1 Gene Exon
5⬘ sequence
3⬘ sequence
1 2 3 4 5
— tcttctttctgtgccatcagATGAGGACAGCCA gtgttttggggtccttgcagGACAGTTTTCACT cttctcctgcctccaaccagGTCTGGTTTCAAA tttattttttttttttacaagGGATGCATAAAAAA
GTCTCCACGTCCGgtaatcaggcccgcgctttc GCGGCGGCACAGgtatagggccaggcagtccc AGACCGGATACAGgtgtctggggtcccttttctc CCTGGCTCCTGGgtaaggaagggcccccggga —
Note. Exon sequence is shown in uppercase letters, and intron sequence is shown in lowercase letters.
SHORT COMMUNICATION
represents a good candidate for both human and mouse ocular developmental phenotypes. Identification of the mouse orthologue of the VSX1 gene and studies of its embryonic expression in both species should help to define its developmental role.
11.
12.
ACKNOWLEDGMENTS We thank B. Schutte and M. Malik, P. Rodriges, and N. Kiliak for sharing the Clontech panels and the adult lens, cornea, and retina cDNAs, respectively, and we thank Bonnie Ludwig for help with sequencing. This work was supported by NIH-NEI Grant EY12384 to J.C.M., by grants from the Hermann Eye Fund and the J. M. West Texas Corp. (Houston, TX), by a grant from Research to Prevent Blindness, Inc. (New York, NY); and by Vision Core NIH Grant EY10608 to H.A.M.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Burmeister, M., Novak, J., Liang, M. Y, Basu, S., Ploder, L., Hawes, N. L., Vidgen, D., Hoover, F., Goldman, D., Kalnins, V. I., Roderick, T. H., Taylor, B. A., Hankin, M. H., and McInnes, R. R. (1996). Ocular retardation mouse caused by Chx10 homeobox null allele: Impaired retinal progenitor proliferation and bipolar cell differentiation. Nat. Genet. 12: 376 – 384. Dattani, M. T., Martinez-Barbera, J. P., Thomas, P. Q., Brickman, J. M., Gupta, R., Martensson, I. L., Toresson, H., Fox, M., Wales, J. K., Hindmarsh, P. C., Krauss, S., Beddington, R. S., and Robinson, I. C. (1998). Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat. Genet. 19: 125–133. Freund, C. L., Gregory-Evans, C. Y., Furukawa, T., Papaioannou, M., Looser, J., Ploder, L., Bellingham, J., Ng, D., Herbrick, J. A., Duncan, A., Scherer, S. W., Tsui, L. C., Loutradis-Anagnostou, A., Jacobson, S. G., Cepko, C. L., Bhattacharya, S. S., and McInnes, R. R. (1997). Cone–rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell 91: 543–553. Galliot, B., de Vargas, C., and Miller, D. (1999). Evolution of homeobox genes: Q50 Paired-like genes founded the Paired class. Dev. Genes Evol. 209: 186 –197. Glaser, T., Walton, D. S., and Maas, R. L. (1992). Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat. Genet. 2: 232–239. Hanes, S. D., and Brent, R. (1991). A genetic model for interaction of the homeodomain recognition helix with DNA. Science 251: 426 – 430. Heon, E., Mathers, W. D., Alward, W. L., Weisenthal, R. W., Sunden, S. L., Fishbaugh, J. A., Taylor, C. M., Krachmer, J. H., Sheffield, V. C., and Stone, E. M. (1995). Linkage of posterior polymorphous corneal dystrophy to 20q11. Hum. Mol. Genet. 4: 485– 488. Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522– 525. Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., Hastie, N., and van Heyningen, V. (1992). The human PAX6 gene is mutated in two patients with aniridia. Nat. Genet. 1: 328 –332. Levine, E. M., Hitchcock, P. F., Glasgow, E., and Schechter, N. (1994). Restricted expression of a new paired-class homeobox gene in normal and regenerating adult goldfish retina. J. Comp. Neurol. 348: 596 – 606.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
293
Liu, I. S., Chen, J. D., Ploder, L., Vidgen, D., van der Kooy, D., Kalnins, V. I., and McInnes, R. R. (1994). Developmental expression of a novel murine homeobox gene (Chx10): Evidence for roles in determination of the neuroretina and inner nuclear layer. Neuron 13: 377–393. Lu, M. F., Cheng, H. T., Kern, M. J., Potter, S. S., Tran, B., Diekwisch, T. G., and Martin, J. F. (1999). prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme. Development 126: 495–504. Mathers, P. H., Grinberg, A., Mahon, K. A., and Jamrich, M. (1997). The Rx homeobox gene is essential for vertebrate eye development. Nature 387: 603– 607. Padanilam, B. J., Stadler, H. S., Mills, K. A., McLeod, L. B., Solursh, M., Lee, B., Ramirez, F., Buetow, K. H., and Murray, J. C. (1992). Characterization of the human HOX 7 cDNA and identification of polymorphic markers. Hum. Mol. Genet. 1: 407– 410. Passini, M. A., Levine, E. M., Canger, A. K., Raymond, P. A., and Schechter, N. (1997). Vsx-1 and Vsx-2: Differential expression of two paired-like homeobox genes during zebrafish and goldfish retinogenesis. J. Comp. Neurol. 388: 495–505. Passini, M. A., Kurtzman, A. L., Canger, A. K., Asch, W. S., Wray, G. A., Raymond, P. A., and Schechter, N. (1998). Cloning of zebrafish vsx1: Expression of a paired-like homeobox gene during CNS development. Dev. Genet. 23: 128 –141. Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., Datson, N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel, B. U., Carey, J. C., and Murray, J. C. (1996). Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. 14: 392–399. Semina, E. V., Reiter, R. S., and Murray, J. C. (1997). Isolation of a new homeobox gene belonging to the Pitx/Rieg family: Expression during lens development and mapping to the aphakia region on mouse chromosome 19. Hum. Mol. Genet. 6: 2109 –2116. Semina, E. V., Ferrell, R. E., Mintz-Hittner, H. A., Bitoun, P., Alward, W. L., Reiter, R. S., Funkhauser, C., Daack-Hirsch, S., and Murray, J. C. (1998). A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat. Genet. 19: 167–170. Sanyanusin, P., Schimmenti, L. A., McNoe, L. A., Ward, T. A., Pierpont, M. E. M., Sullivan, M. J., Dobyns, W. B., and Eccles, M. R. (1995). Mutation of the PAX2 gene in a family with optic nerve colobomas, renal anomalies and vesicoureteral reflux. Nat. Genet. 9: 358 –364. Smith, R. S., Hawes, N. L., Kuhlmann, S. D., Heckenlively, J. R., Chang, B., Roderick, T. H., and Sundberg, J. (1996). Corn1: A mouse model for corneal surface disease and neovascularization. Invest. Ophthalmol. Vis. Sci. 37: 397– 404. Svendsen, P. C., and McGhee, J. D. (1995). The C. elegans neuronally expressed homeobox gene ceh-10 is closely related to genes expressed in the vertebrate eye. Development 121: 1253– 1262. Swaroop, A., Wang, Q. L., Wu, W., Cook, J., Coats, C., Xu, S., Chen, S., Zack, D. J., and Sieving, P. A. (1999). Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: Direct evidence for the involvement of CRX in the development of photoreceptor function. Hum. Mol. Genet. 8: 299 –305. Toma, N. M., Ebenezer, N. D., Inglehearn, C. F., Plant, C., Ficker, L. A., and Bhattacharya, S. S. (1995). Linkage of congenital hereditary endothelial dystrophy to chromosome 20. Hum. Mol. Genet. 4: 2395–2398. Varnum, D. S. (1983). Blind-sterile: A new mutation on chromosome 2 of the house mouse. J. Hered. 74: 206 –207.