Isolation and characterization of cyp19a1a and cyp19a1b promoters in the protogynous hermaphrodite orange-spotted grouper (Epinephelus coioides)

General and Comparative Endocrinology 175 (2012) 473–487

Contents lists available at SciVerse ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Isolation and characterization of cyp19a1a and cyp19a1b promoters in the protogynous hermaphrodite orange-spotted grouper (Epinephelus coioides) Weimin Zhang ⇑, Huijie Lu, Haiyan Jiang, Mu Li, Shen Zhang, Qiongyou Liu, Lihong Zhang ⇑ School of Life Sciences, Sun Yat-Sen University, Guanghzhou 510275, PR China

a r t i c l e

i n f o

Article history: Received 30 July 2011 Revised 20 November 2011 Accepted 2 December 2011 Available online 14 December 2011 Keywords: Epinephelus coioides cyp19a1a cyp19a1b Promoter FTZ-F1 Estradiol

a b s t r a c t Aromatase (CYP19A1) catalyzes the conversion of androgens to estrogens. In teleosts, duplicated copies of cyp19a1 genes, namely cyp19a1a and cyp19a1b, were identified, however, the transcriptional regulation of these two genes remains poorly understood. In the present study, the 50 -flanking regions of the orange-spotted grouper cyp19a1a (gcyp19a1a) and cyp19a1b (gcyp19a1b) genes were isolated and characterized. The proximal promoter regions of both genes were relatively conserved when compared to those of the other teleosts. Notably, a conserved FOXO transcriptional factor binding site was firstly reported in the proximal promoter of gcyp19a1a, and deletion of the region (112 to 60) containing this site significantly decreased the promoter activities. The deletion of the region (246 to 112) containing the two conserved FTZ-F1 sites also dramatically decreased the transcriptional activities of gcyp19a1a promoter, and both two FTZ-F1 sites were shown to be stimulatory cis-acting elements. A FTZ-F1 homologue isolated from ricefield eel (eFTZ-F1) up-regulated gcyp19a1a promoter activities possibly via the FTZ-F1 sites, however, a previously identified orange-spotted grouper FTZ-F1 homologue (gFTZ-F1) did not activate the transcription of gcyp19a1a promoter unexpectedly. As to gcyp19a1b promoter, all the deletion constructs did not show good promoter activities in either TM4 or U251-MG cells. Estradiol (100 nM) up-regulated gcyp19a1b promoter activities by about 13- and 36-fold in TM4 and U251-MG cells, respectively, via the conserved ERE motif, but did not stimulate gcyp19a1a promoter activities. These results are helpful to further elucidate the regulatory mechanisms of cyp19a1a and cyp19a1b expression in the orange-spotted grouper as well as other teleosts. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction The aromatase is an enzyme complex composed of a cytochrome P450 aromatase, the product of the cyp19a1 gene, and a NADPH-dependent cytochrome P450 reductase known as an ubiquitous flavoprotein [38], which catalyzes the biosynthesis of estrogens from androgens. Studies have shown that inhibition of aromatase activity induced the sex-reversal of genetic females to phenotypic males in several species, including chicken [9], Japanese flounder [22], newt [5], Nile tilapia [26], and reptiles [35,36,49]. These results suggested that aromatase plays important roles in gonadal differentiation and development in vertebrates including fish [12], and regulation of cyp19a1 expression is crucial to understand the mechanisms of these fundamental reproductive processes.

⇑ Corresponding authors. Address: Institute of Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China. Fax: +86 20 84113327 (W. Zhang). E-mail addresses: [email protected] (W. Zhang), [email protected] (L. Zhang). 0016-6480/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2011.12.005

In human, P450arom is encoded by a single CYP19A1 gene, and the tissue-specific expression is achieved by tissue-specific promoter usage and alternative splicing [13]. In contrast, most teleosts have duplicated cyp19a1 genes, with cyp19a1a predominantly expressed in the ovary while cyp19a1b predominantly in the brain [4,31,41,37,55,56]. The duplicated cyp19a1 genes are located on different chromosomes [14], and each isoform has its own distinct regulatory region. It was suggested that both cyp19a1 isoforms are involved in the sexual differentiation, regulation of the reproductive cycle, and male reproductive behavior in diverse teleost species [6]. So it would be of interest to identify and characterize the regulatory sequences of both cyp19a1a and cyp19a1b genes. Promoters for cyp19a1a and/or cyp19a1b have been isolated in some fish species, including catfish [21], humpback grouper, green coral goby, and barramundi [11], gilthead seabream [50], goldfish [42], grey mullet [31], Japanese medaka [25,30,40], Nile tilapia [4,52], rainbow trout [19,43], rare minnow [47], red-spotted grouper [16], sea bass [10], the gobiid fish [23], and zebrafish [20,44]. Some common putative regulatory elements were identified including estrogen response elements (ERE) in cyp19a1b promoter and steroidogenic factor-1 (SF-1) and cAMP response elements (CRE) in cyp19a1a promoter, but functional studies on

474

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

promoters and regulatory elements were only performed in limited species [12]. Among those, FTZ-F1 was shown to up-regulate rainbow trout cyp19a1a promoter activities via the FTZ-F1-binding sites [19]. Foxl2 and cAMP analog could activate the flounder cyp19a1 gene transcription in vitro [51]. In medaka, Dax1 inhibited Ad4BP/Sf-1- and Foxl2-mediated transactivation of cyp19a1a promoter [30], and liver receptor homologue-1 (LRH-1) activated cyp19a1b promoter [33]. In tilapia, FoxL2 was shown to activate, with Ad4BP/SF-1, cyp19a1a promoter activities by binding to the sequence ACAAATA [45], whereas Dmrt1 suppressed Ad4BP/ SF-1-activated cyp19a1a promoter activity by binding to the sequence ACATATGT [46]. In zebrafish, estradiol induced cyp19a1b promoter activities through the interaction of estrogen receptor and ERE in a glial cell context [29]. However, the information needs to be expanded as teleosts are the largest group of vertebrates, and have very diverse reproductive strategies. The orange-spotted grouper, Epinephelus coioides, is a protogynous hermaphroditic teleost and a favorite marine food fish in Southeast Asia. It matures as female first and starts to change sex around the age of 7 years. Previously, we have isolated cDNAs for the orange-spotted grouper cyp19a1a and cyp19a1b [56], and found that the expression levels of gonadal cyp19a1a was downregulated during MT-induced precocious sex change while the expression levels of hypothalamic cyp19a1b was transiently upregulated during early phase of induced sex change [54]. The homologue of FTZ-F1, which was shown to up-regulate cyp19a1a promoter activity in some fish species [19,48], was also identified in this species [53]. In the present study, promoters of the orange-spotted grouper cyp19a1a and cyp19a1b were isolated and characterized, which will aid towards the elucidation of the regulatory mechanisms of cyp19a1a and cyp19a1b genes and thus gonadal development in this species as well as other teleosts.

2. Materials and methods 2.1. Extraction of genomic DNA Genomic DNA was extracted using E.Z.N.A.Ò SQ tissue DNA Kit (Omega Bio-Tek, Inc., Norcross, GA) from the liver of female fish obtained from a local dealer in Guangzhou, Guangdong, China. The quality of the extracted DNA was checked with agarose gel electrophoresis.

2.2. Isolation of the 50 -flanking region of cyp19a1 genes The GenomeWalker libraries were constructed using a Universal GenomeWalker™ Kit (Clontech, Mountain View, CA) according to the manufacturer’s protocol. The 50 -flanking regions of the orange-spotted grouper cyp19a1a (gcyp19a1a) and cyp19a1b (gcyp19a1b) were isolated from the GenomeWalker libraries by a PCR-based genomic walker technique, and the oligonucleotide sequences of PCR primers used in this section were shown in Table 1. For gcyp19a1a promoter, adaptor primer AP1 and gene-specific primer aromA-W1 were used for the first PCR, and adaptor primer AP2 and gene-specific primer aromA-W2 for the nested PCR, which resulted in a partial 50 -flanking sequence. Based on this partial sequence, two gene-specific primers aromA-W3 and aromA-W4 were designed, and a second round of nested ‘‘genome-walking’’ PCR was performed as above. The PCR cycling conditions were: 94 °C for 3 min; 40 (the first) or 36 (the nested) cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 3 min; and final 30 min extension. The PCR products were gel purified, cloned, and sequenced in both directions. All the sequences were combined to obtain an about 2.6 kbp 50 -flanking region of gcyp19a1a (JF420889).

Table 1 Sequences of oligonucleotide primers used for the isolation of promoters. Primer name

Sequence (50 ? 30 )

cyp19a1a aromA-PF1 aromA-PR1 aromA-W1 aromA-W2 aromA-W3 aromA-W4

GAGGAGTTGATAAATTCTGTTCCGAC CACAAGCAGAGATGAGATCCATAAGAA CAAGATTAGGAGTCTGGTTGCCACGGAGAT CACAAGCAGAGATGAGATCCATAAGAA GTTGGGGGATTGGAGGACCCTGATT GTGGAGGGAGTTCTTAGAAAACAGC

cyp19a1b aromB-PF1 aromB-PR1 aromB-W1 aromB-W2 aromB-W3 aromB-W4 aromB-W5 aromB-W6

GTGCTGTCATGAGTACAGTAGCG TTTCCGACTCCTGACAAGTTAGA GTTTGTTCGGCTCCACGCAACGAGAAG TGAAGAGATGCAGTTCTCCCTCCGC AACGCCACCACTTTGGGGTTACGAG AAACGGGGTCAGTGCTCCACGACTT TGTTCCCCTTGTTCCCAACTTATT CAAAGCCAAGAGGAGAAGGATATGC

Adapter primer AP1 AP2

GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT

F, sense primer; R or W, antisense primer.

For gcyp19a1b promoter, adaptor primer AP1 and gene-specific primer aromB-W1 were used for the first PCR, and adaptor primer AP2 and gene-specific primer aromB-W2 for the nested PCR, which resulted in a partial 50 -flanking sequence. Then a second and third round of nested ‘‘genome-walking’’ PCR was performed sequentially with primers aromB-W3 and aromB-W4, and aromB-W5 and aromB-W6, respectively. The PCR cycling conditions were the same as the above, and PCR products analyzed in similar ways. An about 2.3 kbp 50 -flanking region of gcyp19a1b (FJ914569) was obtained. The entire 50 -flanking regions were amplified by PCR from genomic DNA using primers aromA-PF1 and aromA-PR1 for gcyp19a1a, and primers aromB-PF1 and aromB-PR1 for gcyp19a1b, and subcloned into pGEM-T Easy vector (Promega, Madison, WI). The resulting constructs were sequenced in both directions to confirm the authenticity of the amplicon, and designated as pGEM-Tgcyp19a1a and pGEM-T-gcyp19a1b, respectively. Promoter sequences were analyzed with the web-based software Neural Network Promoter Prediction (http://www. fruitfly.org/seq_tools/promoter.html) and Transcription Element Search System (TESS) (http://www.cbil.upenn.edu/tess) to search for putative transcription binding sites. 2.3. Plasmid construction The putative promoter regions were inserted upstream of the Firefly luciferase gene of the pGL3-basic vector (Promega) to generate reporter plasmids. To construct serial deletion promoter reporters, eight forward primers and one reverse primer located downstream of the transcription start site were synthesized for each gene, namely EC19A1-PF, EC19A1-PF1, EC19A1-PF2, EC19A1-PF3, EC19A1-PF4, EC19A1-PF5, EC19A1-PF6, EC19A1-PF7, and EC19A1-PR1 for gcyp19a1a, and EC19A2-PF, EC19A2-PF1, EC19A2-PF2, EC19A2-PF3, EC19A2-PF4, EC19A2-PF5, EC19A2-PF6, EC19A2-PF7, and EC19A2-PR1 for gcyp19a1b, where ‘‘F’’ and ‘‘R’’ denote forward and reverse primers, respectively. The sequences of these primers are illustrated in Table 2. All forward primers contained KpnI site at 50 ends, and the reverse primers had an added HindIII site at their 50 ends. The PCR amplification was carried out with high-fidelity Taq DNA polymerase PrimeStar (Takara) using template pGEM-T-gcyp19a1a for gcyp19a1a promoter reporters and pGEM-T-gcyp19a1b for gcyp19a1b promoter

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

475

Table 2 Sequences of oligonucleotide primers used for the construction of promoter reporters. Primer name

Sequence (50 ? 30 )

cyp19a1b EC19A1-PF EC19A1-PF1 EC19A1-PF2 EC19A1-PF3 EC19A1-PF4 EC19A1-PF5 EC19A1-PF6 EC19A1-PF7 EC19A1-PR1

GAGAGAGGTACCGAGGAGTTGATAAATTCTGTTCCGACA GAGAGAGGTACCTGACAAAATTACTCTTTA GAGAGAGGTACCCAGAAACAACAGCAAAA GAGAGAGGTACCTTTGAGTCTGCAAAATAA GAGAGAGGTACCAGATCCAGTTTAGCGCCT GAGAGAGGTACCTCTTTTGATGTTCAAAGG GAGAGAGGTACCGCTGTGACTGTATTGTTTA GAGAGAGGTACCCCCTGACCCAGCTCGT GAGAGAAAGCTTAAGGCAGATTTAAAACAA

cyp19a1b EC19A2-PF EC19A2-PF1 EC19A2-PF2 EC19A2-PF3 EC19A2-PF4 EC19A2-PF5 EC19A2-PF6 EC19A2-PF7 EC19A2-PR1

GAGAGAGGTACCGTGCTGTCATGAGTACAGTAGCG GAGAGAGGTACCACTGGAAAGACCACATTA GAGAGA GGTACCTGATGCAAGAAAAATATC GAGAGAGGTACCAAAAACTCCACTCCTCT GAGAGAGGTACCAGTGCTTCCTCTCAATAT GAGAGAGGTACCTTTCTTTTTTGAACTGCT GAGAGAGGTACCTCGGCCGATGAATTGGAC GAGAGAGGTACCCAACAGATAAAAGACCTG GAGAGAAAGCTTTCTCCTACCAAATAAATC

Mutagenesis of ERE motif EcEREm-F EcEREm-R

CCTACTCCCTTTGACACaGaTCAgTCTGACCaAGCTAATTAATTTCCCCATG CATGGGGAAATTAATTAGCTtGGTCAGAcTGAtCtGTGTCAAAGGGAGTAGG

Mutagenesis of FTZ-F1 site FTZ-mutF1 FTZ-mutR1 FTZ-mutF2 FTZ-mutR2

TGTACGCTCAAttGCACAGGCTCA TGAGCCTGTGCaaTTGAGCGTACA CAACCCCTCAAttCTGTGACTGTA TACAGTCACAGaaTTGAGGGGTTG

Mutated nucleotides are shown in bold and lowercase letters. F, sense primer; R, antisense primer.

reporters, and all PCR fragments were inserted into the pGL3-basic between KpnI and HindIII restriction sites to generate the 50 serially deleted promoter constructs. The orange-spotted grouper FTZ-F1 (gFTZ-F1, AY303389) and ricefield eel FTZ-F1 (eFTZ-F1, JN241681) coding sequences were subcloned into pcDNA3.0 (Invitrogen, Carlsbad, CA) to generate the expression constructs. All the constructs were sequenced in both directions to confirm the authenticity of the sequences. To assess the functionalities of ERE motif in gcyp19a1b promoter (2333/+7) to estradiol (E2) stimulation, the motif AGGTCAATCTGACCC was mutated to AGaTCAgTCTGACCa with primer set EcEREm-F and EcEREm-R using QuikChange SiteDirected Mutagenesis Kit (Stratagene, La Jolla, CA). The two FTZF1 sites in the proximal promoter region (246/+67) of gcyp19a1a were also mutated with fusion PCR. The primers FTZ-mutF1 and FTZ-mutR1 were used for the mutation of the upstream site from TCAA GGGCACA to TCAA ttGCACA, and FTZ-mutF2 and FTZmutR2 were used for the downstream site from TCAAGG CTGTG to TCAA ttCTGTG. The oligonucleotide sequences of these primers were also shown in Table 2. 2.4. Cell culture, transient transfection, and luciferase assay TM4 cells were grown in DMEM/F12 (Invitrogen) containing 5% fetal bovine serum (FBS, Gibco, Gaithersburg, MD) and 2.5% horse serum (HS, Gibco), and U251-MG cells in high-glucose DMEM (Gibco) containing 10% fetal calf serum (Gibco) or in corresponding phenol red-free media (Gibco) containing charcoal/dextran depleted serum (Gibco, for examining the effects of E2). All cell culture media contained 1 mg/ml penicillin–streptomycin (Gibco), and cells maintained at 37 °C in a humidified incubator under 5% CO2. The rationale for using two different cell lines here was to underscore the importance of some potential cis-acting elements in the promoters of orange-spotted grouper cyp19a1a and cyp19a1b genes, respectively.

TM4 and U251-MG were chosen here because the former is a mouse sertoli cell line and the latter a human astrocyte cell line of a glial cell type. As in the mammalian ovaries, Cyp19a1 expression in TM4 cells is driven by the proximal promoter PII [3]. Functional motifs like CRE (or CRE-like) and SF-1 (or FTZ-F1) were identified in PII and teleost (including the orange-spotted grouper) cyp19a1a promoters. In teleosts, cyp19a1a was also expressed in granulosa cells [45] and sertoli cells [24]. Thus it may be appropriate to study the regulation of the teleost cyp19a1a promoter in TM4 cells, particularly for the effects of FTZ-F1 homologues on the promoter. The expression of cyp19a1b was shown to be restricted to radial glial cells of the brain in teleosts [8], where its expression was up-regulated by E2 in vivo [29]. U251-MG represents a glial cell context and is estrogen receptor (ER)-negative [28]. Thus it may be appropriate to study the regulation of the teleost cyp19a1b promoter in U251-MG cells, especially for the E2-induction on the promoter. Plasmids for transfection were prepared from overnight bacteria culture using PureLink™ HI-Pure Plasmid DNA Purification Kit (Invitrogen) according to the manufacturer’s protocol. Twenty-four hours prior to transfection, cells were plated to 24-well plates (105 cells/well), and transiently co-transfected with promoter reporter vectors and an internal control vector pRL-TK using Lipofectamine 2000 (Invitrogen, 1 lL/well) according to the manufacturer’s instruction. The amounts of vectors used were specified in figure legends. The transfection medium was replaced with fresh medium without antibiotic 4 h later, and luciferase activities were measured 48 h later. To examine the effects of E2 on gcyp19a1a or gcyp19a1b promoter, TM4 and U251-MG cells were co-transfected with a goldfish ERa [17] expression vector and gcyp19a1a or gcyp19a1b promoter reporter plasmid. E2 was added 24 h before the end of cell culture. Co-transfection of a gFTZ-F1 expression vector and gcyp19a1a promoter reporter plasmid was employed to assess the effects of the orange-spotted grouper FTZ-F1 homologue on

476

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 1. The 50 -flanking region of the orange-spotted grouper cyp19a1a. The numbering is relative to the transcription initiation site, which was determined by comparing the sequences of promoter and cDNA (AY510711), boxed, and designated as +1. The consensus nucleotide sequences corresponding to the putative transcription factor binding sites were underlined and labeled. Only those sites with La scores higher than 12 were shown here. In case where there were two overlapping binding sites, the former one was underlined and the latter one gray-shaded.

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

477

Fig. 1 (continued)

the promoter activity. As a positive control, the co-transfection of a ricefield eel FTZ-F1 (eFTZ-F1) and gcyp19a1a promoter reporter plasmid was included in the present study. Each transfection reaction was carried out in triplicates, and the experiments were repeated at least three times. The Firefly and Renilla luciferase activities were measured for each sample using Dual-Luciferase Reporter Assay System (Promega). The Firefly luciferase data were corrected for transfection efficiency with Renilla luciferase activity. 2.5. RT-PCR analysis of gFTZ-F1 mRNA and eFTZ-F1 mRNA in TM4 cells Total RNA (1 lg) isolated from TM4 cells was first treated with DNase I (Invitrogen, Amplification Grade, CA, USA) to remove any genomic or plasmid DNA contamination. The RNA was then

reverse-transcribed using oligo(dT) primer and ThermoScript™ RT-PCR System (Invitrogen, CA, USA) according to the manufacturer’s instructions. Absence of genomic or plasmid DNA in RNA preparation was further verified by PCR performed without the reverse transcriptase. The integrity of all RNA samples was verified by the successful amplification of b-actin. The first-strand reaction (0.5 lL) was amplified for each target gene using the Biometra TGRADIENT thermal cycler. PCR was performed in 20-lL final volume containing 2.0 lL 10 reaction buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 0.2 lM of each primer, and 1.0 U Platinum Taq DNA Polymerase (Invitrogen, CA, USA). Water was used as a negative control in the RT-PCR reaction. To detect mRNA expression of target gene, the reaction mixture was heated at 94 °C for 2 min, followed by 33 cycles of amplification for FTZ-F1 homologues, and 26 cycles for b-actin. The primers

478

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 2. Multiple sequence alignment (CLUSTALW, version 1.83) of the proximal cyp19a1a promoter regions in teleosts. The conserved potential transcription factor binding site was boxed and labeled on the top. The FOXO binding site was revealed by rVISTA analysis (http://rvista.dcode.org/). Gaps were introduced to improve the alignment. The sequences used for analysis were downloaded from NCBI, and have following accession number: Nile tilapia (AF472620), Japanese medaka (D82969), gilthead seabream (AY779630), grey mullet (AY859426), barramundi perch (AY686690), and humpback grouper (AY686691).

were gFTZF1-F (50 -AGCTGGGAGAAACATGGAAACC-30 ) and gFTZF1R (50 -TCACGCCCAGCTGTGCTT-30 ) for gFTZ-F1 (AY303389), eFTZF1-F (50 -AGCAGAAGAAGGCTTTGATAC-30 ) and eFTZF1-R (50 -ATAGTGGAGTGGGCTCGGAG-30 ) for eFTZ-F1 (JN241681), and Mmb-actin-F (50 -AGAGGGAAATCGTGCGTGACA-30 ) and Mmb-actinR (50 -TAGAAGCACTTGCGGTGCACG-30 ) for b-actin (NM_007393), which generated PCR products of 639 bp, 556 bp, and 514 bp, respectively. The PCR products were separated on a 2.0% agarose gel, and visualized with ethidium bromide staining. 2.6. Statistical analysis All transfection data are presented as means ± SD (n = 3). The statistical significant differences were analyzed by one-way ANO-

VA followed by the Tukey multiple comparison test using the SPSS software package. Significance was set at P < 0.05.

3. Results 3.1. Analysis of 50 -flanking regions of gcyp19a1a and gcyp19a1b Analysis of an about 2.6-kbp 50 -flanking sequence of gcyp19a1a gene revealed a number of putative transcription factor binding sites (Fig. 1), including one cAMP responsive elements (CRE), one glucocorticoid receptor (GR) binding site, one-half estrogen response element (1/2ERE), two FTZ-F1 binding sites, two SRY binding sites, two activator protein 1 (AP-1) binding sites, four

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

479

Fig. 3. The 50 -flanking region of the orange-spotted grouper cyp19a1b. The numbering is relative to the transcription initiation site, which was determined by comparing the sequences of promoter and cDNA (AY510712), boxed, and designated as +1. The consensus nucleotide sequences corresponding to the putative transcription factor binding sites were underlined and labeled. Only those sites with La scores higher than 12 were shown here. In case where there are two overlapping binding sites, the former one was underlined and the latter one gray-shaded.

480

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 3 (continued)

fork-head transcription factor binding sites, five high mobility group box transcription factor (TCF-4E) binding sites, and seven POU transcriptional factor binding sites. In contrast to the low identities among the entire 50 -flanking sequences of teleost cyp19a1a, interestingly, relatively high were identified in the proximal promoter region (167 to 13 relative to gcyp19a1a promoter) among several teleost species, where the positions of one fork-head transcription factor binding site, two FTZ-F1 binding sites, and one 1/2ERE motif were highly conserved (Fig. 2). Analysis of an about 2.3-kbp 50 -flanking sequence of gcyp19a1b gene also identified a number of putative transcription factor binding sites (Fig. 3), including one CREB/ATF binding site, one estrogen response element (ERE), one GATA-1 binding site, one signal transducer and activator of transcription 1 (STAT1) binding site, one regulatory factor X protein (RFX) binding site, two C/EBPalpha binding site, two C/EBPbeta binding site, two retinoid X receptor alpha (RXR-alpha) binding sites, three AP-1 binding sites, three glucocorticoid receptor (GR) binding sites, four SRY binding sites, and 10 POU transcriptional factor binding sites. Similarly, the entire 50 -flanking sequences of cyp19a1b showed very low identities among teleosts, but the homologies in the proximal promoter regions (350 to +5 relative to gcyp19a1b promoter) were relatively

high among several species, where the positions of the ERE motif, STAT1 binding site, and RFX binding site were highly conserved (Fig. 4). 3.2. cis-acting element regulation of gcyp19a1a and gcyp19a1b promoter activities The deletion constructs for gcyp19a1a promoter were transiently transfected into TM4 and U251-MG cells to characterize the regulation of in vitro transcriptional activities by cis-acting elements (Fig 5). Similar results were obtained in these two cell lines. The deletion from 2656 to 1899 increased the transcriptional activities by 7- (TM cells) or 10 (U251-MG cells)-fold, suggesting some inhibitory elements in this region. Progressive deletion from 1899 to 246 did not dramatically alter transcriptional activities, with an only about 1.3-fold increase in TM4 cells and 1.7-fold increase in U251-MG cells. However, deletion from 246 to 112 dramatically reduced transcriptional activities by 4- (TM4 cells) or 2 (U251-MG cells)-fold, and a further 3- (TM4) or 2.5 (U251-MG cells)-fold reduction was observed with deletion of 112 to 60. These results suggested that some crucial positive elements are present in the region from 246 to 60.

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

481

Fig. 4. Multiple sequence alignment (CLUSTALW, version 1.83) of the proximal cyp19a1b promoter regions in teleosts. The conserved potential transcription factor binding site was boxed and labeled on the top. The RFX and STAT1 binding sites were revealed by rVISTA analysis (http://rvista.dcode.org/). Gaps are introduced to improve alignment. The sequences used for analysis were downloaded from NCBI, and have following accession number: broad-barred goby (AY686695), Nile tilapia (AF472621), grey mullet (AY859424), barramundi perch (AY686693), Japanese medaka (AY705086), and humpback grouper (AY686694).

The deletion constructs for gcyp19a1b promoter were transiently transfected into TM4 or U251-MG cell lines to characterize the regulation of in vitro transcriptional activities by cis-acting elements (Fig. 6). In both cell lines, the 50 -flanking region did not show good promoter activities, especially in U251-MG cells when compared to the promoter-less pGL3-basic vector. In U251-MG cells, progressive deletion from 2333 to 378 gradually increased the transcriptional activities by about 5-fold, suggesting some inhibitory elements in this region. In TM4 cells, the highest promoter activity was observed on construct 1225/+7, which was about 3-fold higher than the pGL3-basic. The deletion from 1563 to 1225 increased the promoter activity by about 2-fold, suggesting some inhibitory elements in this region. The deletion from 1225

to 921 decreased the promoter activity by about 1.8-fold, suggesting some positive elements in this region. 3.3. Functional analysis of FTZ-F1 binding sites and FTZ-F1 homologues on gcyp19a1a promoter activities Two putative FTZ-F1 binding sites (50 -TCAAGGGCA-30 and 50 TCAAGGCTG-30 ) were located at nucleotides from 145 to 136 and from 117 to 108, respectively, in gcyp19a1a promoter. To examine the functional significances of these motifs, promoter (246/+67) reporter vectors containing site-directed mutated FTZ-F1 motif(s) with GG substituted by TT were constructed and transiently transfected into TM4 cells. Single mutation of either

482

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 4 (continued)

Fig. 5. Effects of progressive 50 -deletion on the orange-spotted grouper cyp19a1a promoter activities. At the top is the schematic diagram representing the first 67 nucleotides of gcyp19a1a exon and 2.565 kbp of its 50 -flanking region, where the potential transcription factor binding sites and the sizes of 50 deleted promoters are shown. Numbering refers to the transcription initiation site designated as +1. Deletion constructs of cyp19a1a promoter (380 ng) and an internal control vector pRL-TK (20 ng/well) were cotransfected into TM4 (black bars) or U251-MG (white bars) cells, and luciferase activities were measured 48 h later. The relative luciferase activity was calculated by dividing the Firefly luciferase activity with the Renilla luciferase activity. Each bar represents mean ± SD (n = 3). ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 for differences between the two marked corresponding deletion promoter constructs.

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

483

Fig. 6. Effects of progressive 50 -deletion on the orange-spotted grouper cyp19a1b promoters activities. At the top is the schematic diagram representing the first seven nucleotides of gcyp19a1b exon and 2.333 kbp of its 50 -flanking region, where the potential transcription factor binding sites and the sizes of 50 deleted promoters are shown. Numbering refers to the transcription initiation site designated as +1. Deletion constructs of gcyp19a1b promoter (380 ng) and an internal control vector pRL-TK (20 ng/well) were co-transfected into TM4 (black bars) or U251-MG (white bars) cells, and luciferase activities were measured 48 h later. The relative luciferase activity was calculated by dividing the Firefly luciferase activity with the Renilla luciferase activity. Each bar represents mean ± SD (n = 3). ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 for differences between the two marked corresponding deletion promoter constructs.

Fig. 7. Functional analysis of putative FTZ-F1 binding sites in the proximal promoter of the orange-spotted grouper cyp19a1a. Wild-type (wtFTZ-F1) or FTZ-F1 site-mutated (mutFTZ-F1) gcyp19a1a promoter (246/+67) constructs (280 ng) were co-transfected with (grey bar) or without (white bar) ricefield eel FTZ-F1 (eFTZ-F1) expression vector (100 ng), and an internal control vector pRL-TK (20 ng/well) in TM4 cell. The total amount of plasmid was adjusted to 400 ng /transfection using an empty expression vector (pcDNA3.0). The mutated FTZ-F1 site was indicated by an ‘‘X’’. mutFTZ-F1 I, the upstream site mutated; mutFTZ-F1 II, the downstream site mutated; allmutFTZ-F1, both sites mutated. The luciferase activities were measured 48 h after transfection. The Relative luciferase activity was calculated by dividing the Firefly luciferase activity with the Renilla luciferase activity. Each bar represents mean ± SD (n = 3). ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 vs. wild-type promoter; #significant difference (P < 0.001) observed with eFTZ-F1 overexpression; ns, P > 0.05 in response to eFTZ-F1 overexpression.

FTZ-F1 motifs did not change the basal transcriptional activities significantly, but attenuated the stimulatory effects of eFTZ-F1, a FTZ-F1 homologue of ricefield eel (a teleost in Symbranchiformes) (Fig. 7). Double mutations of both FTZ-F1 motifs caused an about 70% reduction in the basal transcriptional activities, as well as abolished the activational effects of eFTZ-F1 (Fig. 7). The effects of the orange-spotted grouper FTZ-F1 (gFTZ-F1) on the in vitro transcriptional activities of gcyp19a1a promoter was examined in TM4 cells using reporter construct containing region from 246 to +67. gFTZ-F1 did not have any significant stimulatory effects on promoter activities at either low (10 ng) or high (200 ng) doses (Fig. 8A). However, eFTZ-F1 significantly up-regulated

gcyp19a1a promoter activities at all the doses examined (10–200 ng, Fig. 8A). Both constructs for gFTZ-F1 (Fig. 8B) and eFTZ-F1 (Fig. 8C) were transcribed in the transfected TM4 cells. Similar results were observed when using the reporter construct containing region from 2565 to +67, or performing the cotransfection experiments in COS-7 cells (data not shown). 3.4. E2 regulation of gcyp19a1a and gcyp19a1b promoters The regulation of gcyp19a1a or gcyp19a1b promoter activities by E2 was examined in both TM4 and U251-MG cells. E2 did not stimulate gcyp19a1a promoter activities, but up-regulated gcyp19a1b

484

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 8. Functional analysis of transcriptional activation of gcyp19a1a promoter by FTZ-F1 homologues in TM4 cells (A). Cells were transiently co-transfected with a gcyp19a1a promoter (246/+67) reporter vector, an internal control vector pRL-TK (20 ng/well), and orange-spotted grouper FTZ-F1 (gFTZ-F1) or ricefield eel FTZ-F1 (eFTZ-F1) expression vector (10–200 ng/well). The total amount of plasmid was adjusted to 500 ng/transfection using an empty expression vector (pcDNA3.0). , no addition of corresponding constructs. Luciferase activities were measured 48 h after transfection. Relative luciferase activity was calculated by dividing the Firefly luciferase activity with the Renilla luciferase activity. Each bar represents mean ± SD (n = 3). ⁄⁄⁄P < 0.001 vs. FTZ-F1 at 0 ng. (B and C) RT-PCR analysis of gFTZ-F1 mRNA and eFTZ-F1 mRNA in TM4 cells, respectively. 1, un-transfected cells; 2, pGL3-basic; 3, promoter (246/+67); 4, 5, 6, and 7, promoter (246/+67) co-transfected with 10, 50, 100, and 200 ng FTZ-F1, respectively; RT-, without reverse transcriptase; NC, water used as template.

promoter activities does-dependently in both TM4 and U251-MG cells, with a 13-fold increase in the former whereas a 36-fold increase in the latter at E2 of 100 nM (Fig. 9). Furthermore, mutation of the ERE motif in gcyp19a1b promoter substantially attenuated its responsiveness to E2 (10 nM), from about 31-fold to only about 4-fold induction in U251-MG cells, or abolished its responsiveness in TM4 cells (Fig. 9).

4. Discussion In the present study, the 50 -flanking regions of the orangespotted grouper cyp19a1a and cyp19a1b were isolated and characterized. Like other teleosts [12], different transcription factor binding sites were predicated for the two cyp19a1 promoters of the orange-spotted grouper, respectively, notably FTZ-F1 sites only identified in gcyp19a1a promoter whereas an ERE motif only in gcyp19a1b promoter. Furthermore, the 50 -flanking regions of gcyp19a1a but not gcyp19a1b showed good promoter activities in TM4 and U251-MG cells. These results support the distinctive transcriptional regulation of the cyp19a1a and cyp19a1b genes in the orange-spotted grouper. Sequence analysis showed that the proximal promoter regions of the orange-spotted grouper cyp19a1a and cyp19a1b were relatively conserved when compared to their counterparts in other teleosts. Together with the recent report of

the conservation of cyp19a1a proximal promoter [16], these results suggest some common regulatory mechanisms for teleost cyp19a1a and cyp19a1b genes, respectively. Of the conserved putative cis-acting motifs in cyp19a1a proximal promoters in teleosts, FOXO1/4 (FOXO1 and FOXO4) binding sites were noted for the first time in the present study. FOXO1 and FOXO4 are fork-head transcription factors in the FOXO subfamily involved in the regulation of cell cycle and cell metabolism [1]. FOXO transcription factors bind DNA as a monomer at the IRE consensus sequence TT(A/G)TT(T/G)(A/G)(T/C) on target genes [1] and function both as activators and repressors of gene transcription [34]. In rat primary granulosa cell cultures, FOXO1 was shown to repress the expression of aromatase [34]. Interestingly, in the orange-spotted grouper however, deletion of the region (112/60) containing FOXO1/4 binding sites reduced transcriptional activities of gcyp19a1a promoter by about threefold in vitro, suggesting that unlike the case in rat granulose cells, FOXO transcription factors may activate gcyp19a1a promoter activities possibly via FOXO1/4 binding sites, which is worth further study. Currently, the cloning and characterization of FOXO transcription factors in the orangespotted grouper are under way in our laboratory. Like other teleosts [12], two adjacent FTZ-F1 binding sites (145 to 136 and 117 to 108) were conserved in the proximal promoter of orange-spotted grouper cyp19a1a. Deletion of the region containing the two FTZ-F1 sites or double mutation of the

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

Fig. 9. Estradiol regulation of transcriptional activities of gcyp19a1a and gcyp19a1b promoters. TM4 and U251-MG cells were co-transfected with 330 ng of gcyp19a1a or cyp19a1b promoter reporter vectors containing ERE (gcyp19a1b) or site-mutated ERE motif (gcyp19a1b mutant), an internal control vector pRL-TK (20 ng/well), and a goldfish ERa expression construct (50 ng), and treated with E2 or 0.1% DMSO vehicle (as control) for 24 h before luciferase activities were measured. The results are expressed as fold changes relative to the control. Each bar represents mean ± SD (n = 3). ⁄⁄⁄P < 0.001 relative to DMSO (E2 at 0 nM).

two FTZ-F1 sites dramatically reduced transcriptional activities of orange-spotted grouper cyp19a1a promoter. Furthermore, the activational effects of ricefield eel FTZ-F1 were significantly decreased by the mutation of either FTZ-F1 site, and abolished by double mutation of both FTZ-F1 sites, indicating that both motifs were important for promoter activities of orange-spotted grouper cyp19a1a. Similarly in tilapia, deleting the region 438 to 119 of cyp19a1a promoter which contains two conserved adjacent SF-1 binding sites also led to a significant reduction of promoter activity [45], and mutation of either of the FTZ-F1 sites in rainbow trout abolished the transcriptional activation of cyp19a1a promoter by rtFTZ-F1 [19]. These results suggest the critical roles of the two adjacent FTZ-F1 binding sites in the transcriptional regulation of cyp19a1a promoter activities in the orange-spotted grouper as well as other teleosts. The activation of cyp19a1a promoter by FTZ-F1, an orphan nuclear receptor protein, was demonstrated in several teleosts, including medaka [48], Nile tilapia [45,52], and rainbow trout [19]. Furthermore, the expression profile of medaka FTZ-F1 during oogenesis parallels the transcription profile of aromatase [48]. Parallel expression of cyp19a1a and SF1/Ad4BP in the course of ovarian growth was also demonstrated in tilapia [52]. These

485

studies suggested possible physiological roles of FTZ-F1 in the regulation of cyp19a1a genes. However, the orange-spotted grouper FTZ-F1 homologue identified previously in our laboratory [53] could not up-regulate gcyp19a1a promoter activity in our present study. Due to the unavailability of antibodies against fish FTZ-F1, the presence of gFTZ-F1 proteins in the transfected TM4 cells could not be checked at present with Western blot analysis in our lab. However, RT-PCR analysis showed that the construct for gFTZ-F1 was transcribed in the transfected TM4 cells. Furthermore, a parallel control assay showed that ricefield eel FTZ-F1 up-regulated gcyp19a1a promoter activity dose-dependently possibly through the two adjacent FTZ-F1 sites. These lines of evidence suggested that the experimental set-up in the present study is feasible to check the activities of transcription factors from fish, and the inability of gFTZ-F1 to activate gcyp19a1a promoter is most likely due to its particular molecular structure rather than the experimental conditions. The gFTZ-F1 contained the typical structures of FTZ-F1 homologues with a highly conserved FTZ-F1 box, and exhibited similar tissue-specific patterns of mRNA expression as those in other vertebrates [53], suggesting it may be a functional FTZ-F1 homologue in the orange-spotted grouper. Phylogenetic analysis categorized both gFTZ-F1 and eFTZ-F1 in the NR5A4 group (data not shown). When compared to tilapia SF-1, which was demonstrated to up-regulate tilapia cyp19a1a promoter [45], eFTZ-F1 showed identical sequences in functional domains PRD, PID, and AF-2, and 94% and 85% identities in I-box and DRD, respectively. However, gFTZ-F1 showed only 30% identity in PRD, 57% in PID, around 62% in I-box and DRD, and 83% in AF-2. These lower identities in the presumably conserved functional domains, particularly the PRD, may contribute to the failure of gFTZ-F1 to up-regulate gcyp19a1a promoter, which awaits further study. As gFTZ-F1 was predominantly expressed in the hypothalamus and pituitary of the orange-spotted grouper [53], it might serve as an important transcription factor in these tissues rather than regulating cyp19a1a expression in the gonads. Thus it would be of great interest to look at the structure/function relationship of FTZ-F1 homologues in the activation of cyp19a1a promoters in teleosts. The conservation of two adjacent FTZ-F1 binding sites in the proximal promoter region suggested that there must be some FTZ-F1 homologues capable of regulating cyp19a1a in the orange-spotted grouper, which is currently under research in our laboratory. Studies in mammals have shown that the expression of cyp19a1 gene in ovarian granulose cells was stimulated by gonadotropins via the cAMP second messenger [39,15]. Similarly, there are CRE sites in the 50 -flanking region of cyp19a1a genes in most fish [12], including the red-spotted grouper [16], a species closely related to the orange-spotted grouper. Promoter deletion analysis indicated that CREB regulation region from 1010 to 898 might be a major cis-acting element to cyp19a1a promoter in the redspotted grouper [16]. As in gilthead seabream [50], red seabream [18], and Atlantic croaker [32], gonadotropins have also been shown to induce ovarian cyp19a1a expression in the orangespotted grouper [7]. Our present study further identified CRE sites in the 50 -flanking region of the orange-spotted grouper cyp19a1a gene. Taken together, these lines of evidence suggested that the cAMP second messenger might also potentially mediate the up-regulation of cyp19a1a by gonadotropins in the ovary of the orange-spotted grouper. As in other teleosts [12], the proximal region of gcyp19a1b promoter contained a conserved binding site for ER. In addition, the binding sites for STAT1 and RFX are also highly conserved in the proximal promoter regions, suggesting their conserved roles in regulating cyp19a1b expression in teleosts. In zebrafish, EREmediated up-regulation of cyp19a1b transcriptional activity by E2 was analyzed in detail and an auto-regulatory positive feedback loop was suggested to be a possible mechanism responsible for

486

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487

the high level of brain aromatase [8,27]. In the present study, mutation of ERE motif dramatically reduced or abolished the E2-activation of the orange-spotted grouper cyp19a1b promoter activities, suggesting the effects of E2 on gcyp19a1b promoter were largely mediated by the ERE motif. The much higher potencies of E2 on gcyp19a1b promoter activities in U251-MG as compared to TM4 cells implied that a glial cell context was also important for the up-regulation of gcyp19a1b promoter by E2, similar to the case in zebrafish [27,29]. Considering the high expression of orangespotted grouper cyp19a1b in the brain [56], it is very likely that an auto-regulatory positive feedback loop may also exist in this species as proposed in zebrafish [8]. Although gcyp19a1a proximal promoter region contained a half-ERE site and two FTZ-F1 sites, transfection assays did not reveal any stimulatory effects of E2 on the promoter construct either in TM4 cells or U251-MG cells, suggesting that estrogens may not be involved in the regulation of cyp19a1a expression in the orange-spotted grouper. Similarly in goldfish and zebrafish, studies have shown that estrogens upregulated the mRNA expression of cyp19a1b but not cyp19a1a in adults as well as embryos [2]. In conclusion, our present study demonstrated that the proximal promoter regions and regulation of cyp19a1a and cyp19a1b genes were conserved to some extent among teleosts. Estradiol up-regulated the promoter activities of gcyp19a1b, but not gcyp19a1a, via the conserved ERE motif. cis-acting FTZ-F1 binding sites were critical for the transcriptional activities of gcyp19a1a promoter, but a previously identified FTZ-F1 homologue from the orange-spotted grouper did not show any stimulatory effect. Some conserved motifs, which were not reported previously, were identified in the proximal promoter regions, like binding sites for FOXO1/4 in cyp19a1a promoter and STAT1 and RFX in cyp19a1b promoter in teleosts, which are worth further study.

[11] [12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

Acknowledgments [23]

This work was supported by National Key Technology Research and Development Program (2008AA09Z406), and the Natural Science Foundation of China (30471346, 30970359, 31072197).

[24]

References

[25]

[1] B.M. Burgering, G.J. Kops, Cell cycle and death control: long live Forkheads, Trends Biochem. Sci. 27 (2002) 352–360. [2] G.V. Callard, A.V. Tchoudakova, M. Kishida, E. Wood, Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish, J. Steroid Biochem. Mol. Biol. 79 (2001) 305–314. [3] S. Catalano, V. Pezzi, A. Chimento, C. Giordano, A. Carpino, M. Young, M.J. McPhaul, S. Andò, Triiodothyronine decreases the activity of the proximal promoter (PII) of the aromatase gene in the mouse Sertoli cell line, TM4, Mol. Endocrinol. 17 (2003) 923–934. [4] X.T. Chang, T. Kobayashi, B. Senthilkumaran, H. Kobayashi-Kajura, C.C. Sudhakumari, Y. Nagahama, Two types of distribution aromatase with different encoding genes, tissue and developmental expression in Nile tilapia (Oreochromis niloticus), Gen. Comp. Endocrinol. 141 (2005) 101–115. [5] D. Chardard, C. Dournon, Sex reversal by aromatase inhibitor treatment in the newt Pleurodeles waltl, J. Exp. Zool. 283 (1999) 43–50. [6] K. Cheshenko, F. Pakdel, H. Segner, O. Kah, R.I. Eggen, Interference of endocrine disrupting chemicals with aromatase CYP19 expression or activity, and consequences for reproduction of teleost fish, Gen. Comp. Endocrinol. 155 (2008) 31–62. [7] M. Cui, W. Li, W. Liu, K. Yang, Y. Pang, L. Haoran, Production of recombinant orange-spotted grouper (Epinephelus coioides) luteinizing hormone in insect cells by the baculovirus expression system and its biological effect, Biol. Reprod. 76 (2007) 74–84. [8] N. Diotel, Y. Le Page, K. Mouriec, S.K. Tong, E. Pellegrini, C. Vaillant, I. Anglade, F. Brion, F. Pakdel, B.C. Chung, O. Kah, Aromatase in the brain of teleost fish: expression, regulation and putative functions, Front. Neuroendocrinol. 31 (2010) 172–192. [9] A. Elbrecht, R.G. Smith, Aromatase enzyme activity and sex determination in chickens, Science 255 (1992) 467–470. [10] M. Galay-Burgos, C. Gealy, L. Navarro-Martín, F. Piferrer, S. Zanuy, G.E. Sweeney, Cloning of the promoter from the gonadal aromatase gene of the

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

European sea bass and identification of single nucleotide polymorphisms, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 145 (2006) 47–53. L. Gardner, T. Anderson, A.R. Place, B. Dixon, A. Elizur, Sex change strategy and the aromatase genes, J. Steroid Biochem. Mol. Biol. 94 (2005) 395–404. Y. Guiguen, A. Fostier, F. Piferrer, C.F. Chang, Ovarian aromatase and estrogens: a pivotal role for gonadal sex differentiation and sex change in fish, Gen. Comp. Endocrinol. 165 (2010) 352–366. N. Harada, T. Utsumi, Y. Takagi, Tissue-specific expression of the human aromatase cytochrome P-450 gene by alternative use of multiple exons 1 and promoters, and switching of tissue-specific exons 1 in carcinogenesis, Proc. Natl. Acad. Sci. USA 90 (1993) 11312–11316. S.C. Harvey, J.Y. Kwon, D.J. Penman, Physical mapping of the brain and ovarian aromatase genes in the Nile Tilapia, Oreochromis niloticus, by fluorescence in situ hybridization, Anim. Genet. 34 (2003) 62–64. G.J. Hickey, J.S. Krasnow, W.G. Beattie, J.S. Richards, Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 30 ,50 -monophosphate-dependent and independent regulation. Cloning and sequencing of rat aromatase cDNA and 50 genomic DNA, Mol. Endocrinol. 4 (1990) 3–12. W. Huang, L. Zhou, Z. Li, J.F. Gui, Expression pattern, cellular localization and promoter activity analysis of ovarian aromatase (cyp19a1a) in protogynous hermaphrodite red-spotted grouper, Mol. Cell. Endocrinol. 307 (2009) 224– 236. B. Jiao, C.H. Cheng, Disrupting actions of bisphenol A and malachite green on growth hormone receptor gene expression and signal transduction in seabream, Fish Physiol. Biochem. 36 (2010) 251–261. H. Kagawa, K. Gen, K. Okuzawa, H. Tanaka, Effects of luteinizing hormone and follicle-stimulating hormone and insulin-like growth factor-I on aromatase activity and P450 aromatase gene expression in the ovarian follicles of redseabream, Pagrus major, Biol. Reprod. 68 (2003) 1562–1568. H. Kanda, T. Okubo, N. Omori, H. Niihara, N. Matsumoto, K. Yamada, S. Yoshimoto, M. Ito, S. Yamashita, T. Shiba, N. Takamatsu, Transcriptional regulation of the rainbow trout CYP19a gene by FTZ-F1 homologue, J. Steroid Biochem. Mol. Biol. 99 (2006) 85–92. Y. Kazeto, S. Ijiri, A.R. Place, Y. Zohar, J.M. Trant, The 50 -flanking regions of CYP19A1 and CYP19A2 in zebrafish, Biochem. Biophys. Res. Commun. 288 (2001) 503–508. Y. Kazeto, J.M. Trant, Molecular biology of channel catfish brain cytochrome P450 aromatase (CYP19A2): cloning, preovulatory induction of gene expression, hormonal gene regulation and analysis of promoter region, J. Mol. Endocrinol. 35 (2005) 571–583. T. Kitano, K. Takamune, Y. Nagahama, S.I. Abe, Aromatase inhibitor and 17alpha-methyltestosterone cause sex-reversal from genetical females to phenotypic males and suppression of P450 aromatase gene expression in Japanese flounder (Paralichthys olivaceus), Mol. Reprod. Dev. 56 (2000) 1–5. Y. Kobayashi, T. Sunobe, T. Kobayashi, Y. Nagahama, M. Nakamura, Promoter analysis of two aromatase genes in the serial-sex changing gobiid fish, Trimma okinawae, Fish Physiol. Biochem. 31 (2005) 123–127. M. Kotula-Balak, R. Zielin´ska, J. Glogowski, R.K. Kowalski, B. Sarosiek, B. Bilin´ska, Aromatase expression in testes of XY, YY, and XX rainbow trout (Oncorhynchus mykiss), Comp. Biochem. Physiol. A Mol. Integr. Physiol. 149 (2008) 188–196. A.J. Kuhl, S. Manning, M. Brouwer, Brain aromatase in Japanese medaka (Oryzias latipes): molecular characterization and role in xenoestrogen induced sex reversal, J. Steroid Biochem. Mol. Biol. 96 (2005) 67–77. J.Y. Kwon, V. Haghpanah, L.M. Kogson-Hurtado, B.J. McAndrew, D.J. Penman, Masculinization of genetic female Nile tilapia (Oreochromis niloticus) by dietary administration of an aromatase inhibitor during sexual differentiation, J. Exp. Zool. 287 (2000) 46–53. Y. Le Page, A. Menuet, O. Kah, F. Pakdel, Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene, Mol. Reprod. Dev. 75 (2008) 1549–1557. Y. Le Page, M. Scholze, O. Kah, F. Pakdel, Assessment of xenoestrogens using three distinct estrogen receptors and the zebrafish brain aromatase gene in a highly responsive glial cell system, Environ. Health Perspect. 114 (2006) 752– 758. A. Menuet, E. Pellegrini, F. Brion, M.M. Gueguen, I. Anglade, F. Pakdel, O. Kah, Expression and estrogen-dependent regulation of the zebrafish brain aromatase gene, J. Comp. Neurol. 485 (2005) 304–320. M. Nakamoto, D.S. Wang, A. Suzuki, M. Matsuda, Y. Nagahama, N. Shibata, Dax1 suppresses P450arom expression in medaka ovarian follicles, Mol. Reprod. Dev. 74 (2007) 1239–1246. J.N. Nocillado, A. Elizur, A. Avitan, F. Carrick, B. Levavi-Sivan, Cytochrome P450 aromatase in grey mullet: cDNA and promoter isolation; brain, pituitary and ovarian expression during puberty, Mol. Cell. Endocrinol. 263 (2007) 65–78. B.S. Nunez, S.L. Applebaum, Tissue- and sex-specific regulation of CYP19A1 expression in the Atlantic croaker (Micropogonias undulatus), Gen. Comp. Endocrinol. 149 (2006) 205–216. Y. Ohmuro-Matsuyama, K. Okubo, M. Matsuda, S. Ijiri, D. Wang, G. Guan, T. Suzuki, M. Matsuyama, K. Morohashi, Y. Nagahama, Liver receptor homologue1 (LRH-1) activates the promoter of brain aromatase (cyp19a2) in a teleost fish, the medaka, Oryzias latipes, Mol. Reprod. Dev. 74 (2007) 1065–1071. Y. Park, E.T. Maizels, Z.J. Feiger, H. Alam, C.A. Peters, T.K. Woodruff, T.G. Unterman, E.J. Lee, J.L. Jameson, M. Hunzicker-Dunn, Induction of cyclin D2 in rat granulosa cells requires FSH-dependent relief from FOXO1 repression coupled with positive signals from Smad, J. Biol. Chem. 280 (2005) 9135–9148.

W. Zhang et al. / General and Comparative Endocrinology 175 (2012) 473–487 [35] T. Rhen, J.W. Lang, Temperature-dependent sex determination in the snapping turtle: manipulation of the embryonic sex steroid environment, Gen. Comp. Endocrinol. 96 (1994) 243–254. [36] N. Richard-Mercier, M. Dorizzi, G. Desvages, M. Girondot, C. Pieau, Endocrine sex reversal of gonads by the aromatase inhibitor Letrozole (CGS 20267) in Emys orbicularis, a turtle with temperature-dependent sex determination, Gen. Comp. Endocrinol. 100 (1995) 314–326. [37] S.J. Sawyer, K.A. Gerstner, G.V. Callard, Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation, Gen. Comp. Endocrinol. 147 (2006) 108–117. [38] E.R. Simpson, Aromatase cytochrome-P450 – structure, function and regulation, FASEB J. 8 (1994) A1241. [39] M.P. Steinkampf, C.R. Mendelson, E.R. Simpson, Regulation by folliclestimulating hormone of the synthesis of aromatase cytochrome P-450 in human granulosa cells, Mol. Endocrinol. 1 (1987) 465–471. [40] M. Tanaka, S. Fukada, M. Matsuyama, Y. Nagahama, Structure and promoter analysis of the cytochrome P-450 aromatase gene of the teleost fish, medaka (Oryzias latipes), J. Biochem. 117 (1995) 719–725. [41] A. Tchoudakova, G.V. Callard, Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary, Endocrinology 139 (1998) 2179–2189. [42] A. Tchoudakova, M. Kishida, E. Wood, G.V. Callard, Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish, J. Steroid Biochem. Mol. Biol. 78 (2001) 427–439. [43] V. Toffolo, P. Belvedere, L. Colombo, L.D. Valle, Tissue-specific transcriptional initiation of the CYP19 genes in rainbow trout, with analysis of splicing patterns and promoter sequences, Gen. Comp. Endocrinol. 153 (2007) 311– 319. [44] S.K. Tong, B.C. Chung, Analysis of zebrafish cyp19 promoters, J. Steroid Biochem. Mol. Biol. 86 (2003) 381–386. [45] D.S. Wang, T. Kobayashi, L.Y. Zhou, B. Paul-Prasanth, S. Ijiri, F. Sakai, K. Okubo, K. Morohashi, Y. Nagahama, Foxl2 up-regulates aromatase gene transcription in a female-specific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1, Mol. Endocrinol. 21 (2007) 712–725. [46] D.S. Wang, L.Y. Zhou, T. Kobayashi, M. Matsuda, Y. Shibata, F. Sakai, Y. Nagahama, Doublesex- and Mab-3-related transcription factor-1 repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia, Endocrinology 151 (2010) 1331–1340.

487

[47] J. Wang, X. Liu, H. Wang, T. Wu, X. Hu, F. Qin, Z. Wang, Expression of two cytochrome P450 aromatase genes is regulated by endocrine disrupting chemicals in rare minnow Gobiocypris rarus juveniles, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 152 (2010) 313–320. [48] M. Watanabe, M. Tanaka, D. Kobayashi, Y. Yoshiura, Y. Oba, Y. Nagahama, Medaka (Oryzias latipes) FTZ-F1 potentially regulates the transcription of P450 aromatase in ovarian follicles: cDNA cloning and functional characterization, Mol. Cell. Endocrinol. 149 (1999) 221–228. [49] T. Wibbels, D. Crews, Putative aromatase inhibitor induces male sex determination in a female unisexual lizard and in a turtle with temperaturedependent sex determination, J. Endocrinol. 141 (1994) 295–299. [50] T.T. Wong, S. Ijiri, Y. Zohar, Molecular biology of ovarian aromatase in sex reversal: complementary DNA and 50-flanking region isolation and differential expression of ovarian aromatase in the gilthead seabream (Sparus aurata), Biol. Reprod. 74 (2006) 857–864. [51] T. Yamaguchi, S. Yamaguchi, T. Hirai, T. Kitano, Follicle-stimulating hormone signaling and Foxl2 are involved in transcriptional regulation of aromatase gene during gonadal sex differentiation in Japanese flounder, Paralichthys olivaceus, Biochem. Biophys. Res. Commun. 359 (2007) 935–940. [52] Y. Yoshiura, B. Senthilkumaran, M. Watanabe, Y. Oba, T. Kobayashi, Y. Nagahama, Synergistic expression of Ad4BP/SF-1 and cytochrome P-450 aromatase (ovarian type) in the ovary of Nile tilapia, Oreochromis niloticus, during vitellogenesis suggests transcriptional interaction, Biol. Reprod. 68 (2003) 1545–1553. [53] W. Zhang, X. Li, Y. Zhang, L. Zhang, J. Tian, G. Ma, CDNA cloning and mRNA expression of a FTZ-F1 homologue from pituitary of orange-spotted grouper, Epinephelus coioides, J. Exp. Zool. A Comp. Exp. Biol. 301 (2004) 691–699. [54] W. Zhang, Y. Zhang, L. Zhang, H. Zhao, X. Li, H. Huang, H. Lin, The mRNA expression of P450 aromatase, gonadotropin b-subunits and FTZ-F1 in the orange-spotted grouper (Epinephelus coioides) during 17amethyltestosterone-induced precocious sex change, Mol. Reprod. Dev. 74 (2007) 665–673. [55] Y. Zhang, W. Zhang, H. Yang, W. Zhou, C. Hu, L. Zhang, Two cytochrome P450 aromatase genes in the hermaphrodite ricefield eel Monopterus albus: mRNA expression during ovarian development and sex change, J. Endocrinol. 199 (2008) 317–331. [56] Y. Zhang, W. Zhang, L. Zhang, T. Zhu, J. Tian, X. Li, H. Lin, Two distinct cytochrome P450 aromatases in the orange-spotted grouper (Epinephelus coioides): cDNA cloning and differential mRNA expression, J. Steroid Biochem. Mol. Biol. 92 (2004) 39–50.