Isolation and characterization of cytochrome c from the marine copepod Tigriopus californicus

Gene 248 (2000) 15–22 www.elsevier.com/locate/gene

Isolation and characterization of cytochrome c from the marine copepod Tigriopus californicus Paul D. Rawson a, *, Daniel A. Brazeau b, Ronald S. Burton a a Marine Biology Research Division, Scripps Institution of Oceanography, University of California, San Diego, La Jolla, CA, USA b Department of Zoology, University of Florida, Gainesville, FL 32611, USA Received 27 October 1999; received in revised form 25 February 2000; accepted 13 March 2000 Received by W.-H. Li

Abstract Mitochondrial energy production requires complex interactions among proteins encoded in both the nuclear and mitochondrial genomes. The intergenomic coevolution of interacting gene products has been previously suggested based on interspecific comparisons of cytochrome c (encoded by the nuclear CYC gene) and cytochrome c oxidase (partly encoded in the mitochondrial DNA by the COX1, COX2 and COX3 genes). In the intertidal copepod, Tigriopus californicus, non-synonymous substitutions in the COX1 gene have previously been found in interpopulation comparisons. In order to determine if CYC also shows interpopulation variation, this gene was isolated from a cDNA library using a degenerate primer/polymerase chain reaction approach. Characterization of a cDNA sequence and 25 genomic DNA sequences derived from four T. californicus populations yielded the following results: (1) the T. californicus CYC gene is interrupted by an intron that occurs at the same position as the intron found in vertebrate CYC genes; (2) there is extensive sequence variation within both the coding region and intron of this gene and the vast majority of this variation occurs between sequences drawn from geographically distinct populations; (3) the coding sequence variation includes a minimum of five amino acid replacement substitutions; (4) segregation of length variants among offspring in an interpopulation cross revealed genotypic ratios consistent with the proposed allelic nature of the CYC variants. These results demonstrate that the requisite genetic variation required for intergenomic coevolution exists in the CYC– COX system in T. californicus. © 2000 Elsevier Science B.V. All rights reserved. Keywords: cDNA; Genomic DNA; Intron; Molecular evolution; Phylogeny

1. Introduction Cytochrome c is a small heme protein that plays a crucial role in the synthesis of adenosine triphosphate (ATP). Although the gene encoding cytochrome c is located in the nuclear DNA of eukaryotic cells, the translated protein is imported to the outer surface of the inner mitochondrial membrane, where it facilitates the transfer of electrons from cytochrome c reductase to cytochrome c oxidase. This electron transport generates the proton gradient across the inner mitochondrial membrane that drives ATP synthesis (Moore and Abbreviations: COX1, cytochrome c oxidase subunit 1; CYC, cytochrome c; PCR, polymerase chain reaction; p, nucleotide diversity; UTR, untranslated region. * Corresponding author. Present address: School of Marine Sciences, 5751 Murray Hall, University of Maine, Orono, ME 04469-5751, USA. Tel.: +1-207-581-4326; fax: +1-207-581-2537. E-mail address: [email protected] (P.D. Rawson)

Pettigrew, 1990). In addition to its role in the electron transport system, cytochrome c is now known to function in the antioxidant defense system of eukaryotic cells and in apoptosis (Skulachev, 1998). Cytochrome c is among the most evolutionarily conserved proteins studied to date; an alignment of nearly 100 eukaryotic cytochrome c amino acid sequences, ranging from yeast to human, demonstrates that nearly 30% of the amino acid residues are invariant (Hampsey et al., 1986; Moore and Pettigrew, 1990). Because of this high degree of sequence conservation, molecular phylogenies based on cytochrome c have been used as a test of the classical views of eukaryotic evolution based on morphological and paleontological criteria [reviewed by Moore and Pettigrew (1990)]. We herein report the isolation and characterization of a cytochrome c (CYC ) gene from the marine intertidal copepod Tigriopus californicus. This species inhabits high intertidal and supralittoral rock pools along the

0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 14 5 - 1

16

P.D. Rawson et al. / Gene 248 (2000) 15–22

Pacific coast of North America. Although the habitat of T. californicus is ephemeral and local populations are susceptible to periodic extinction, Burton (1986, 1997) has found strong and temporally stable genetic differentiation among neighboring copepod populations. Burton and Lee (1994) have also documented extensive interpopulation DNA sequence divergence for a 500 base pair fragment of the mitochondrial encoded cytochrome oxidase subunit I (COXI ) gene. Although much of the variation among COXI sequences consists of silent substitutions, three amino acid substitutions distinguished central from southern California populations. Given the degree of interpopulation divergence and the extensive interactions between cytochrome c oxidase and cytochrome c necessary for ATP synthesis, we have hypothesized that the mitochondrial encoded COX and nuclear encoded CYC genes coevolve among T. californicus populations (Burton et al., 1999). Intergenomic coevolution has previously been demonstrated at the interspecific level by Osheroff et al. (1983), Cann et al. (1984) and Adkins et al. (1996). Our hypothesis of intraspecific coevolution presupposes that there is interpopulation amino acid sequence variation for T. californicus cytochrome c. Thus, as a first step in addressing this hypothesis we have isolated a cytochrome c cDNA sequence from T. californicus and examined the degree of nucleotide and amino acid variation for this gene among four populations of copepods.

2. Methods and materials 2.1. cDNA library construction Total RNA was prepared from adult T. californicus by homogenizing approximately 10 000 copepods (350 mg total wet weight) in 10 ml of guanidine thiocyanate buffer (Life Technologies) at room temperature with a polytron followed by centrifugation with cesium chloride (5.7 M, 24 h, 30 000 rpm, 20°C ). Poly(A)+ RNA was isolated using the PolyAtract III system (Promega) following the manufacturer’s protocols. Double-stranded cDNA was synthesized using NotI primer/adapters and then ligated to EcoRI linkers. After digestion with NotI and EcoRI the cDNAs were size fractionated via column chromatography and fragments >500 base pairs were cloned into NotI/EcoRI linearized pcDNA II plasmid vector (Invitrogen) and used to transform electro-competent Escherichia coli TOP10F ∞ cells. Following overnight growth on Luria Broth (LB)/ampicillin plates, all resulting colonies were suspended in LB and collected in a single 50 ml tube. 2.2. Isolation and characterization of a T. californicus cytochrome c cDNA Plasmid DNA was extracted from 1 ml of the resulting cDNA library and used as a template in the polymer-

ase chain reaction (PCR) with degenerate primers cc5 (MGNTGYGCNCARTGCCACAC ) and cc3 ( TTGGTNCCNGGDATRTAYTTCTT ), the design of which was based on the cytc-c-5 and cytc-c-3 primers of Palumbi and Baker (1994). Amplifications were performed with ~100 ng of cDNA library template, 2.5 nmol of each dNTP, 50 pmol of each primer, and 2.0 units of Taq polymerase (Promega) in a 100 ml reaction buffer containing 50 mM KCl, 10 mM Tris– HCl, 1.5 mM MgCl and 0.1% Triton-X100. The reac2 tions were initially denatured for 3 min at 94°C and then incubated for 35 cycles of 94°C for 30 s, 40°C for 1 min, and 72°C for 1 min. This reaction produced multiple distinct PCR products, all of which were cloned using a TA cloning system (Invitrogen). Several positive clones were isolated and sequenced in one direction using the vector-specific primer T7. These sequences, and all others in this study, were generated using the ABI Prism dye terminator sequencing protocol and were read on an ABI model 373 automated sequencer. One clone contained 156 base pairs of sequence with high similarity to bases 415 to 571 of the Drosophila melanogaster DC4 gene (GenBank accession no. X01760; Limbach and Wu, 1985). The putative T. californicus CYC sequence was used to design the primers, cyt6 (ATCGAGGCCGGCGGCAAGCA) and cyt9 (GGTAGATATCCAAAGTCTCCTCG), which were paired with the vector-specific M13 forward and M13 reverse primers respectively, to amplify the 5∞ and 3∞ ends of T. californicus CYC with the cDNA library again serving as template at an annealing temperature of 50°C. The sequences from the cc5–cc3 clone and the cyt6 and cyt9 PCR products have been aligned and submitted to GenBank (accession no. AF091460). 2.3. Characterization of genomic cytochrome c Adult copepods were sampled from high intertidal rock pools at four sites along the coast of California, San Diego (SD), Abalone Cove (AB), Carmel (CA), and Santa Cruz (SC; Fig. 1). DNA template was prepared for PCR by boiling individual copepods in 30 ml of distilled H O for 5 min; all 30 ml were used in 50 ml 2 PCR reactions (see above) with 50 pmol of each cyt10 (ACCAACCGACAACATCATGGG) and cyt13 (GAAATGTCTTCGAGCACGTGG) or cyt12 (CGTAATAACTACTAACCAACCG) and cyt13 primers, designed from the complete T. californicus CYC cDNA sequence (see Fig. 2). Reactions were denatured for 3 min at 94°C and then incubated for 35 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min. Although these reactions produced one primary band of 850 to 950 base pairs in length and a second faint band of 300 to 400 bases in length, only the primary product contained CYC sequence (data not shown). PCR products for four to five individuals from each population were

P.D. Rawson et al. / Gene 248 (2000) 15–22

17

Fig. 1. Sampling locations for T. californicus.

gel purified and sequenced once in each direction using the original amplification primers. An internal sequencing primer, cyt14 (GGAATGTACTTTTTGGGGTTCG), was used to sequence the middle of each PCR fragment. The sequences generated by direct sequencing methods for eight individuals (SC13, SC16, CA1, CA2, CA3, AB1, SD16, and SD18) contained overlapping sequences. Thus, for each of these individuals, PCR products were cloned using a TA cloning system (Invitrogen). Insert size for 10 to 15 positive colonies was confirmed for each cloning reaction using the vectorspecific primers M13 forward and M13 reverse and the PCR method of Palumbi and Baker (1994). Two clones differing in insert size were identified for each cloning reaction and were sequenced using the vector-specific and cyt14 primers. The T. californicus genomic CYC sequences were unambiguously aligned with one another using the Sequencher 3.0 software (Gene Codes Corp.); the aligned sequences have been submitted to GenBank under accession nos AF091461 to AF091485. Nucleotide diversity among intron, silent coding and replacement coding sites was estimated using the program DNAsp (ver. 3.0; Rozas and Rozas, 1999). The phylogenetic relationship among the CYC genomic sequences was estimated by a heuristic parsimony search with simple

step-wise addition of sequences and the tree-bisection reconnection branch swapping option in PAUP 3.1 (Swofford, 1993). To examine whether divergent cytochrome c sequences obtained from different populations are inherited in a Mendelian fashion a single SD male copepod was mated to a virgin SC female copepod. The genomic cytochrome c products for these parents differed substantially (~100 base pairs) and the mode of inheritance was inferred by scoring the size variation among the F1 and F2 progeny generated by this cross.

3. Results We obtained 488 base pairs of sequence for a CYC gene isolated from a T. californicus cDNA library. This sequence includes a short segment (~50 base pairs) of the 5∞ untranslated region ( UTR), an open reading frame of 315 nucleotides and the complete 3∞ UTR, as evidenced by the presence of a poly-A tail 155 base pairs downstream of the open reading frame. In addition, a putative polyadenylation signal (AATAA, Fig. 2) was identifiable 52 base pairs downstream from the coding region. In BLAST searches (to GenBank and other databases) the complete inferred amino acid

18

P.D. Rawson et al. / Gene 248 (2000) 15–22

Fig. 2. An alignment of the T. californicus cDNA sequence (clone) with a genomic sequence (SC17) from the same Santa Cruz population. The intron in the genomic sequence is indicated by lowercase symbols, exons and flanking sequences are presented in uppercase letters and the numbering refers to the position within the clone sequence relative to the start codon. Conserved sequences associated with intron–exon boundaries and a polyadenalation signal are underlined. A single synonymous substitution (pos. 72) and the 3∞ end of the position of primer annealing sites for the PCR primers employed in this study are indicated in bold.

sequence (105 residues) for this T. californicus CYC gene had the highest similarity (78–80%) to cytochrome c sequences isolated from several insect species, including the house fly (Musca sp.; accession no. 224144) and D. melanogaster ( X01761) and a lower degree of similarity

(74–78%) to cytochrome c sequences for mammalian species such as sheep (P00006), rat (M20622), and human (M22877). Comparison of the 25 genomic sequences we sampled from 18 individual copepods with the cDNA sequence

P.D. Rawson et al. / Gene 248 (2000) 15–22

indicates that T. californicus CYC contains an intron varying in size from 468 to 559 nucleotides. In all sequences the intron begins after the first 169 base pairs of coding sequence and is flanked by conserved sequence motifs typically found at intron–exon boundaries (Fig. 2). The 5∞ splice junction has the sequence AAGGTAACC, which is 78% similar to the consensus sequence MAG/gtragt (where M=A or C and r=A or G; Jacob and Gallinaro, 1989) and the 3∞ splice junction agrees completely with the yag/GT consensus sequence (where y=t or c; Keller and Noon, 1985). The size variation in the intron is due to the presence of several large indels (up to 49 base pairs in length) and numerous smaller indels, the presence of which is population specific (data not shown). Nucleotide variation among the intron sequences, even when ignoring the indels, was substantial. Nearly 22% (92 of 423) of the nucleotide sites compared across all 25 intron sequences were polymorphic and an estimate of nucleotide diversity (p=0.059) was likewise extremely high. Similar to the distribution of indels, the majority of nucleotide variation among T. californicus CYC intron sequences occurred between sequences drawn from different populations ( Fig. 3). Nearly identical results were also obtained when all silent sites (coding and intron) were used to estimate the phylogenetic relationships among CYC genomic sequences (data not shown). These highly divergent, population-specific CYC PCR products have a Mendelian mode of inheritance. All of the F1 offspring produced by a single pair mating between an SD male and SC female, whose PCR products differed in size by 100 base pairs, were heterozygous for the parental PCR products (n=18). Among 27 F2 offspring that were analyzed, the ratio of homozygotes to heterozygotes (7:15:5) was not significantly different from 1:2:1, the ratio expected under Mendelian inheritance ( Fisher’s exact test, P=0.876; Fig. 4). Because of the position of our upstream PCR primer (cyt10) and use of direct sequencing methods, nucleotides belonging to the first four codons could not be resolved for some sequences and these codons were removed from subsequent analyses. Nucleotide diversity at silent sites within the coding region (p=0.055; no. sites: 69.5) was virtually equal to that observed within the intron. In contrast, nucleotide diversity at nonsynonymous sites (p=0.010; no. sites: 236.5) was nearly sixfold lower than at silent sites. Even so, we observed nine replacement substitutions among the 26 predicted cytochrome c amino acid sequences. Four of these replacement substitutions were observed in single sequences within our dataset (singletons), whereas the other five replacements were fixed between populations. The majority of these (four of five) were clustered between amino acid residues 42 and 47 (numbering consistent with horse cytochrome c; Moore and Pettigrew, 1990) and none occurred at the sites that are

19

Fig. 3. An unrooted maximum parsimony phylogeny based on the number of nucleotide substitutions in the cytochrome c intron sequences. The phylogeny is a consensus of 57 trees, each 128 steps long. Each sequence is labeled as to the population and individual from which it was sampled; branch lengths are presented above a given branch and indicate the absolute number of substitutions out of the 423 nucleotides analyzed. Bootstrap values >80% are indicated below their respective branches. Indels were ignored in estimating this phylogeny but the size of the intron for each sequence, including indels, is indicated in parentheses next to each sequence label.

invariant among eukaryotic cytochrome c sequences ( Fig. 5).

4. Discussion Our analysis of cDNA and genomic DNA sequences indicates that the gene encoding T. californicus cytochrome c is interrupted by an intron located within the codon for glycine at position 57 in the amino acid sequence. This is the same position where an intron occurs among several vertebrate cytochrome c genes ( Kemmerer et al., 1991). In contrast, CYC genes isolated from several plant species appear to have two separate introns ( Kemmerer et al., 1991), whereas those from the insects D. melanogaster and Manduca sexta contain no introns (Limbach and Wu, 1985; Swanson et al., 1985). The observation of a single intron at the same position in T. californicus and mammalian cytochrome c genes suggests the possibility that the presence of this

20

P.D. Rawson et al. / Gene 248 (2000) 15–22

Fig. 4. Analysis of the inheritance of amplified cytochrome c products in a single pair mating between a male from San Diego (P1) and a virgin female from Santa Cruz (P2). Examples of the banding patterns observed among F1 and F2 progeny are shown in lanes 4–7 and 8–15 respectively. The lanes marked M are a 100 base pair size standard (Life Technologies Inc.) and the arrows on the right indicate the 500 base and 1 kb bands.

Fig. 5. Alignment of consensus amino acid sequences for each of the four T. californicus populations with the protein sequence for the prawn, Macrobrachium malcolmsonii. Arrows denote the heme attachment sites, an asterisk denotes charged residues interact with mitochondrial cytochrome c oxidase subunit II and underlined residues are those that are conserved among all taxa, including sites important to protein folding [see Hampsey et al. (1986) and Moore and Pettigrew (1990)].

intron is an ancestral trait among animal phyla predating the split between protostomes and deuterostomes and that the loss of this intron is a derived character among insects. At present, however, there is insufficient information regarding the phylogenetic distribution of CYC introns, particularly for invertebrate taxa, to be able to assess this hypothesis. Nucleotide variation among T. californicus CYC sequences is extensive; we observed a relatively constant level of nucleotide substitution for both the intron (p= 0.059) and silent coding sites (p=0.055). For comparison, Moriyama and Powell (1996) have surveyed intraspecific nucleotide polymorphism at 27 loci in D. melanogaster, Drosophila simulans, and Drosophila psuedoobscura. With the exception of the highly variable Est-6 locus in D. simulans (p=0.079), the maximum estimates of p for silent and non-coding sites among these three species of Drosophila were 0.033, 0.052, and 0.041 respectively. Much of the silent site variation, as well as the presence of numerous indels in the CYC

intron, is population specific. This observation is consistent with previous molecular studies involving T. californicus, which found high levels of sequence variation for the mitochondrial COX1 and nuclear histone H1 genes. Given the high degree of interpopulation divergence for the COX1 and histone H1 genes, Burton and Lee (1994) have suggested that T. californicus populations represent distinct genetic lineages that have been evolving independently for perhaps several million years; our observations for CYC provide further support for this conclusion. Nucleotide diversity at non-synonymous sites (p= 0.010) was nearly sixfold lower than at silent sites, as would be expected given the functional constraints imposed on the evolution of the amino acid sequence of cytochrome c. Out of the 105 amino acid residues that comprise T. californicus cytochrome c, however, we observed nine amino acid replacements. Four of these replacements were singletons and, given the low fidelity of native Taq polymerase (Cline et al., 1996), some of

P.D. Rawson et al. / Gene 248 (2000) 15–22

the singletons may represent amplification or sequencing artifacts. The other five amino acid replacements are fixed between populations and cannot be attributed to such artifacts. An alternate explanation for the high levels of amino acid variation is that they arise from the amplification of two different CYC genes. Intraspecific variation in cytochrome c observed in other species has often involved gene duplication. Divergent isoforms of cytochrome c have been identified in yeast (Montgomery et al., 1980), rice ( Kemmerer et al., 1991), D. melanogaster (Limbach and Wu, 1985), house flies (Inoue et al., 1984), mice and rats ( Virbasius and Scarpulla, 1988) and in some cases the different isoforms show tissue (mice and rats) or developmental stage (house flies) specific expression patterns. We addressed the possibility by examining the inheritance of the T. californicus CYC products amplified by our methods. The frequencies of homozygotes and heterozygotes in the F2 generation resulting from a single pair mating between an SD male and SC female copepods (Fig. 4) were consistent with the ratio expected under Mendelian inheritance. Although this experiment does not rule out the possibility that a second CYC locus exists in T. californicus, the results support our interpretation that the PCR products we have amplified and sequenced from the four T. californicus populations are allelic and not due to the amplification of paralogous CYC genes. Alignment of the consensus cytochrome c amino acid sequences for each of the four T. californicus populations sampled in this study indicates the conservation of residues that are invariant across large phylogenetic distances. For comparison, this alignment includes a cytochrome c protein sequence from the freshwater prawn, Machrobrachium, the only other crustacean CYC sequence we could identify in the GenBank or Swissprot databases. Copepods diverged from other Crustacean orders in the Cambrian approximately 500 Myr ago (Newman, 1992; Spears and Abele, 1997) and this is reflected in the high degree of divergence (~24%) between the copepod and prawn sequences. Despite this level of divergence, all of the amino acid residues identified as important for either heme binding, protein folding or direct interaction with cytochrome c oxidase (Hampsey et al., 1986; Moore and Pettigrew, 1990) are conserved (Fig. 5). Interestingly, four of the five fixed substitutions we observed are clustered between amino acid residues 42 and 47: sites that are solvent exposed. Three of these replacements result in a change from either an apolar to polar side chain (alanine to serine: position 44; and phenylalanine to tyrosine: position 46) or polar to charged side chain (glutamine to lysine: position 42). The amino acid variation we have observed among T. californicus populations is an essential prerequisite of our hypothesis that there is intraspecific coevolution

21

between the nuclear encoded CYC gene and the mitochondrial encoded cytochrome c oxidase subunits with which cytochrome c interacts. To understand the context in which these amino acid replacements in cytochrome c operate requires knowledge of the substitutions that occur within the reactive core of cytochrome c oxidase. Although Burton and Lee (1994) have published partial COX1 sequences for several copepods from the same four populations sampled in this study, complete sequences of COX1 and COX2, the subunits that form the reactive core of cytochrome c oxidase, currently are not available for T. californicus. Since crystalline structures of both eukaryotic cytochrome c [see Moore and Pettigrew (1990)] and cytochrome c oxidase [see Capaldi (1996)] have been resolved, detailed knowledge of the substitutions in each protein will provide an indication of whether parallel substitutions have occurred at interacting sites of enzyme and substrate. Such an analysis will be crucial to understanding the nature of the forces that have brought about the high levels of variation we have observed in T. californicus cytochrome c.

Acknowledgements We would like to thank W. Swanson and E. Metze for critiquing several versions of this manuscript. The support of NSF grants DEB 94-09066, DEB 98-15424, and OCE 94-15669 to R.S.B. and a National Science Foundation/Alfred P. Sloan Foundation Postdoctoral Fellowship in Molecular Evolution to P.D.R. are gratefully acknowledged.

References Adkins, R.M., Honeycutt, R.L., Disotell, T.R., 1996. Evolution of eutherian cytochrome c oxidase subunit II: heterogeneous rates of protein evolution and altered interaction with cytochrome c. Mol. Biol. Evol. 13, 1393–1404. Burton, R.S., 1986. Evolutionary consequences of restricted gene flow in the intertidal copepod Tigriopus californicus. Bull. Mar. Sci. 39, 526–535. Burton, R.S., 1997. Genetic evidence for the persistence of marine invertebrate populations in an ephemeral habitat. Evolution 51, 993–998. Burton, R.S., Lee, B.-N., 1994. Nuclear and mitochondrial gene genealogies and allozyme polymorphism across a major phylogeographic break in the copepod Tigriopus californicus. Proc. Natl. Acad. Sci. USA 91, 5197–5201. Burton, R.S., Rawson, P.D., Edmands, S., 1999. Genetic architecture of physiological phenotypes: empirical evidence for coadapted gene complexes. Am. Zool. 39, 451–462. Cann, R.L., Brown, W.M., Wilson, A.C., 1984. Polymorphic sites and the mechanism of evolution in human mitochondrial DNA. Genetics 104, 699–711. Capaldi, R.A., 1996. The complexity of a respiratory complex. Nature Struct. Biol. 3, 570–574. Cline, J., Braman, J.C., Hogrefe, H.H., 1996. PCR fidelity of pfu DNA

22

P.D. Rawson et al. / Gene 248 (2000) 15–22

polymerase and other thermostable DNA polymerases. Nucleic Acids Res. 24, 3546–3551. Hampsey, D.M., Das, G., Sherman, F., 1986. Amino acid replacements in yeast iso-1-cytochrome c. J. Biol. Chem. 261, 3259–3271. Inoue, S., Hirohoshi, T., Matsubara, H., Yamanaka, T., 1984. Complete amino acid sequences of two isocytchromes c of the housefly, Musca domestica L. and their developmental variation in different tissues. Biochim. Biophys. Acta 790, 188–195. Jacob, M., Gallinaro, H., 1989. The 5∞ splice site: phylogenetic evolution and variable geometry of association with U1 RNA. Nucleic Acids Res. 17, 2159–2180. Keller, E.B., Noon, W.A., 1985. Intron splicing: a conserved internal signal in introns of Drosophila pre-mRNAs. Nucleic Acids Res. 13, 4971–4981. Kemmerer, E.C., Lei, M., Wu, R., 1991. Isolation and molecular evolutionary analysis of a cytochrome c gene from Oryza sative (Rice). Mol. Biol. Evol. 8, 212–226. Limbach, K.J., Wu, R., 1985. Characterization of two Drosophila melanogaster cytochrome c genes and their transcripts. Nucleic Acids Res. 13, 631–644. Montgomery, D.L., Leung, D.W., Smith, M., Shalit, P., Faye, G., Hall, B.D., 1980. Isolation and sequence of the gene for iso2-cytochrome c in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 77, 541–545. Moore, G.R., Pettigrew, G.W., 1990. Cytochromes c: Evolutionary, Structural and Physiochemical Aspects. Springer, Berlin.

Moriyama, E.N., Powell, J.R., 1996. Intraspecific nuclear DNA variation in Drosophila. Mol. Biol. Evol. 13, 261–277. Newman, W.A., 1992. Origin of the Maxillopoda. Acta Zool. 73, 319–322. Osheroff, N., Speck, S.H., Margoliash, E., Veerman, E.C.I., Wilms, J., Konig, B.W., Muijsers, A.O., 1983. The reaction of primate cytochrome c with cytochrome c oxidase. J. Biol. Chem. 258, 5731–5738. Palumbi, S.R., Baker, C.S., 1994. Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales. Mol. Biol. Evol. 11, 426–435. Rozas, J., Rozas, R., 1999. DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15, 174–175. Skulachev, V.P., 1998. Cytochrome c in the apoptotic and antioxidant cascades. FEBS Lett. 423, 275–280. Spears, T., Abele, L.G., 1997. Crustacean phylogeny inferred from 18S rDNA. In: Fortey, R.A., Thomas, R.H. ( Eds.), Systematics Association Special Volume Series 55. Chapman and Hall, London. Swanson, M.S., Zieminn, S.M., Miller, D.D., Garber, E.A.E., Margoliash, E., 1985. Developmental expression of nuclear genes that encode mitochondrial proteins: insect cytochromes c. Proc. Natl. Acad. Sci. USA 82, 1964–1968. Swofford, D.L., 1993. PAUP: Phylogenetic Analysis Using Parsimony, version 3.1. Illinois Natural History Survey, Champaign. Virbasius, J.V., Scarpulla, R.C., 1988. Structure and expression of rodent genes encoding the testis-specific cytochrome c. J. Biol. Chem. 263, 6791–6796.