- Email: [email protected]
Isolation and characterization of Dichelobacter nodosus from ovine and caprine footrot in Kashmir, India
Research in Veterinary Science 83 (2007) 141–144 www.elsevier.com/locate/rvsc
Isolation and characterization of Dichelobacter nodosus from ovine and caprine footrot in Kashmir, India S.A. Wani *, I. Samanta, S. Kawoosa Bacteriology Laboratory, Division of Microbiology & Immunology, Faculty of Veterinary Sciences & A.H., S.K. University of Agricultural Sciences and Technology of Kashmir, Shuhama (Alusteng), Srinagar 190006, India Accepted 13 November 2006
Abstract Footrot is a highly contagious and economically important disease of sheep and goats, caused by Dichelobacter nodosus, a slow growing anaerobic Gram-negative rod. The current Australian antigenic classification system, based on variation in the fimbriae, classifies D. nodosus into at least 10 serogroups (A–I and M) and 18 serotypes. This investigation was intended to determine the serological diversity of D. nodosus in this region of Kashmir, India. Exudates of footrot lesions were collected from 24 naturally infected sheep and 42 goats located in the Kashmir valley. Of these 66 samples, 24 yielded evidence of D. nodosus by PCR using 16SrDNA specific primers. Multiplex PCR using serogroup specific primers revealed the presence of serogroup B in all the samples except two, which showed the presence of serogroup E D. nodosus. This study also documents the isolation of D. nodosus and detection of serogroup E for the first time in India. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Dichelobacter nodosus; Footrot; Sheep; Goat; Isolation; PCR
1. Introduction Footrot is a highly contagious and economically important disease of the feet of sheep and goats, characterized by the separation of keratinous hoof from the underlying epidermal tissue resulting in severe lameness, loss of body condition and reduced wool production (Egerton et al., 1969). The disease is dependent on a mixed bacterial infection, but the essential causative agent is Dichelobacter nodosus, a slow growing anaerobic Gram-negative rod (Billington et al., 1996). The current Australian classification system, based on antigenic variation in the structure of fimbriae, classified D. nodosus into at least 10 serogroups (A–I and M) and 18 serotypes (Claxton, 1986; Ghimire et al., 1998). Traditionally the identification of D. nodosus has relied on the isolation of the causative agent from footrot lesion and biochemical tests on the resultant isolates (Pitman
*
Corresponding author. Tel./fax: +91 194 2262211. E-mail address: [email protected] (S.A. Wani).
0034-5288/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.rvsc.2006.11.006
et al., 1994). However, recently PCR based methods have been used for detection (La Fontaine et al., 1993) and characterization (Dhungyel et al., 2002) of D. nodosus without need to culture. The objective of the present investigation was to expand our earlier findings (Wani et al., 2004) for better understanding of the serological diversity of D. nodosus in this part of India. 2. Materials and methods 2.1. Collection of clinical samples Exudates of footrot lesions were collected during November 2003 to May 2004 from 24 naturally infected sheep and 42 goats of private owners from the Kangan (Srinagar) and Kawoosa (Budgam) area of the Kashmir valley. The site sampled was at the apex of the cleft that develops between the horn of the hoof and the sensitive underlying tissues. Samples were collected on cotton swabs, transported to the laboratory on ice, anaerobically cultured and stored in sterile tubes at 20 °C until further use.
142
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
2.2. DNA extraction
2.4. Serogrouping by multiplex PCR
Suspensions of the material present on the swabs were prepared in 1.5 ml microcentrifuge tubes in 100 ll of sterile phosphate buffered saline (PBS) by gentle vortexing. After removing the swabs, the samples were boiled for 5 min, cooled on ice for 10 min and centrifuged at 10,000g for 1 min. Similarly from the culture plates suspected colonies with characteristic morphology were directly suspended into 100 ll of sterile PBS and processed for the extraction of DNA as before. Two microlitres of the supernatant was used as the template for each PCR reaction.
The samples positive for D. nodosus as revealed by the amplification of 783 bp gene products were subjected to serogrouping by multiplex PCR using A–I serogroup specific primers (Dhungyel et al., 2002). The Oligonucleotide primers (Table 1) were procured from Bangalore Genei Pvt. Ltd, Bangalore, India. Positive control DNA samples kindly supplied by Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, were included in the PCR. Sterile distilled water was used as negative control. The PCR products were analyzed in 2.0% agarose gels, visualized and photographed as discussed above.
2.3. Detection of 16S rRNA gene of D. nodosus by PCR 2.5. Isolation of D. nodosus from clinical samples PCR amplification was performed in 25 ll in 0.2 ml thin walled PCR tubes (Tarson, India). The PCR mixture contained a final concentration of 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 3 mM MgCl2, 0.01% gelatin, 0.5 lM concentration of each primer, 0.2 mM concentrations of each 2 0 -deoxynucleoside 5 0 -triphosphate and 1U of Taq DNA polymerase (Bangalore Genei Pvt. Ltd, Bangalore, India). Oligonucleotide primers (Table 1) were also procured from Bangalore Genei Pvt. Ltd, Bangalore, India. The amplification cycles in a GeneAmp PCR System 2400 Thermal cycler (Applied Biosystems, USA) consisted of 94 °C for 2 min, followed by 5 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, and 25 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s for 25 cycles, and final extension at 72 °C for 4 min (La Fontaine et al., 1993). Positive control DNA samples kindly supplied by Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, were included in the PCR. Sterile distilled water was used as negative control. The PCR products were analysed in 0.8% agarose gels, stained with ethidium bromide and visualized under ultraviolet illumination and photographed with Gel Documentation System (GDS 8000 system, UVP, UK).
For the isolation of D. nodosus, lesion material from affected sheep and goats was streaked on Nutrient agar (HiMedia, India) plates with addition of 0.15% Serine, 0.5% arginine and 4% hoof powder. The hoof powder was prepared from dried hooves collected from healthy slaughtered sheep. The plates were placed in an anaerobic jar with Gaspacks (HiMedia, india) and incubated at 37 °C. After 4 days of incubation, suspected colonies (Thorley, 1976) were subcultured on the same medium (except the concentration of hoof powder was only 2%) for obtaining a pure culture of D. nodosus. Confirmation of the colonies as D. nodosus was by detection of speciesspecific 16SrDNA by PCR as described above except the hoof medium was used as a negative control. 3. Results Out of 24 samples collected from naturally infected sheep, 12 (50%) yielded the amplified product of the expected size of 783 bp (Fig. 1). The multiplex PCR assay for serogrouping was successfully applied to all the 12 specimens. Ten samples yielded a single band of 283 bp characteristic of serogroup B, whereas the remaining
Table 1 Details of the primers used in PCR assays Primer name
Nucleotide sequence (5 0 ! 3 0 )
Target gene
Size (bp)
Reference
Forward Reverse FP RA RB RC RD RE RF RG RH RI
CGGGGTTATGTAGCTTGC TCGGTACCGAGTATTTCTACCCAACACCT CCTTAATCGAACTCATGATTG3 0 5 0 AGTTTCGCCTTCATTATATTT3 0 5 0 CGGATCGCCAGCTTCTGTCTT3 0 5 0 AGAAGTGCCTTTGCCGTATTC3 0 5 0 TGCAACAATATTTCCCTCATC3 0 5 0 CACTTTGGTATCGATCAACTTGG3 0 5 0 ACTGATTTCGGCTAGACC3 0 5 0 CTTAGGGGTAAGTCCTGCAAG3 0 5 0 TGAGCAAGACCAAGTAGC3 0 5 0 CGATGGGTCAGCATCTGGACC3 0
16S rRNA – fimA fimA fimA fimA fimA fimA fimA fimA fimA fimA
783 – – 415 283 325 319 363 241 279 409 189
La Fontaine et al. (1993) Dhungyel et al. (2002)
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
143
4. Discussion
Fig. 1. Amplification of 16S rRNA gene of Dichelobacter nodosus from clinical samples of ovine and caprine footrot by PCR. Lane M-500 bp DNA marker, Lane 1, 2 – representative positive samples showing amplified product of 783 bp, Lane 3 – negative control, and Lane 4 – positive control.
Fig. 2. Serogroup specific PCR products of Dichelobacter nodosus from the clinical samples of sheep and goats affected with footrot. Lane M100 bp DNA marker, Lane 1 – representative positive sample showing amplified product of 283 bp specific for serogroup B, Lane 2 – representative positive sample showing amplified product of 363 bp specific for serogroup E, Lane 3 – negative control, and Lane 4 – positive control showing amplified product specific for both serogroup B and E.
two samples produced a serogroup E specific band of 363 bp (Fig. 2). Out of 42 clinical samples collected from affected goats, 12 (28.57%) were found positive for D. nodosus by 16S rDNA specific primers. All the 12 produced a 283 bp product by multiplex PCR and were identified as serogroup B. On primary culture in 4% hoof agar, samples yielded three types of colonies. Among them, greyish brown coloured, centrally elevated colonies were chosen for subculture. After subculture on 2% hoof agar medium, the DNA of the isolated colony was again confirmed as D. nodosus by PCR using 16SrDNA specific primers. Serogroup specificity of the isolates was again confirmed by multiplex PCR. Hoof medium was PCR negative.
Sheep and goat production is one of the important farm activities in the state of Jammu and Kashmir and footrot has become enzootic in sheep and goats in this part of India, for the last 15 years or more. There is need to control the disease by effective measures including vaccination. In countries where footrot is enzootic, there is a considerable antigenic diversity among the isolates of D. nodosus (Claxton et al., 1983; Gradin et al., 1993). Thus, for the development of an effective vaccine, it is essential to have up to date knowledge of serogroup and strain diversity of D. nodosus prevalent locally in the field. To date it is a common practice to prepare the commercial footrot vaccine containing representative serogroups available locally. This serogroup specific vaccination has been used successfully in eradicating virulent footrot from mixed flocks of sheep and goats in several countries including Nepal and Bhutan (Dhungyel et al., 2002; Ghimire et al., 1996; Jimenez et al., 2003). The detection of Serogroup B of D. nodosus in the present work in sheep and goats confirms our earlier findings in the valley (Wani et al., 2004). Further, the present study also unveiled the presence of serogroup E of D. nodosus. This is in agreement with the findings of Chetwin et al. (1991) and Ghimire et al. (1996) who also reported the presence of serogroup E of D. nodosus in sheep and goats affected with footrot in New Zealand and Nepal, respectively. Coincidentally, serogroup E is relatively uncommon in Australia (Claxton et al., 1983), United Kingdom (Hindmarsh and Fraser, 1985), United States of America (Gradin et al., 1993). The detection of serogroup B in almost all samples in the present investigation suggests that strain(s) of serogroup B could be an appropriate candidate for the development of an effective vaccine. Further studies in this direction and covering more geographical area will actually determine the formulation of an effective vaccine against the disease in this local region. Acknowledgements This work was carried out with the facilities available with the financial support of Indian Council of Agricultural Research (ICAR) and Department of Science and Technology (DST), New Delhi. The authors are highly thankful to Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, for the supply of positive control DNA of D. nodosus. References Billington, S.J., Johnston, J.L., Rood, J.I., 1996. Virulence regions and virulence factors of the ovine footrot pathogen, Dichelobacter nodosus. FEMS Microbiological Letter 145, 147–156. Chetwin, D.H., Whitehead, L.C., Thorley, E., 1991. The recognition and prevalence of Bacteroides nodosus serotype M in Australia and New Zealand. Australian Veterinary Journal 68, 154–155.
144
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
Claxton, P.D., Ribeiro, L.A., Egerton, J.R., 1983. Classification of Bacteroides nodosus by agglutination test. Australian Veterinary Journal 70, 123–126. Claxton, P.D., 1986. Serogrouping of Bacteroides nodosus isolates. In: Proceedings of a Workshop, Melbourne, 1985, CSIRO, Division of Animal Health and Australian Wool Corporation, Glebe, Sydney, N.S.W, Australia, pp. 131–134. Dhungyel, O.P., Whittington, R.J., Egerton, J.R., 2002. Serogroup specific single and multiplex PCR with pre-enrichment culture and immunomagnetic bead capture for identifying strains of D. nodosus in sheep with footrot prior to vaccination. Molecular and Cellular Probes 16, 285–296. Egerton, J.R., Roberts, D.S., Parsonson, I.M., 1969. The aetiology and pathogenesis of ovine footrot. I. A histological study of bacterial invasion. Journal of Comparative Pathology 79, 207–216. Ghimire, S.C., Egerton, J.R., Dhungyel, O.P., 1996. Characterization of Dichelobacter nodosus isolated from footrot in sheep and goats in Nepal. Small Ruminant Research 23, 59–67. Ghimire, S.C., Egerton, J.R., Dhungyel, O.P., Joshi, H.D., 1998. Identification and characterization of serogroup M among Nepalese isolates of Dichelobacter nodosus, the transmitting agent of footrot in small ruminants. Veterinary Microbiology 62, 217–233.
Gradin, J.L., Sonn, A.E., Petrosvka, L., 1993. Serogrouping of Bacteroides nodosus isolates from 62 sources in the United States. American Journal of Veterinary Research 54, 1069–1073. Hindmarsh, F., Fraser, J., 1985. Serogrouping of Bacteroides nodosus isolated from ovine footrot in Britain. Veterinary Record 116, 187– 188. Jimenez, R., Piriz, S., Martin-Palomino, P., Mateos, E., Vadillo, S., 2003. Aetiology of ovine footrot in the Portugese region of Alto Alentejo. Journal of Veterinary Medicine B 50, 118–120. La Fontaine, S., Egerton, J.R., Rood, J.I., 1993. Detection of Dichelobacter nodosus using species-specific oligonucleotides as PCR primers. Veterinary Microbiology 35, 101–117. Pitman, D.R., Palmer, M.A., Depiazzi, L.J., 1994. The laboratory culture of D. nodosus in footrot eradication programme. Australian Veterinary Journal 71, 109–112. Thorley, C.M., 1976. A simplified method for the isolation of Bacteroides nodosus from ovine footrot and studies on its colony morphology and serology. Journal of Applied Bacteriology 40, 301–309. Wani, S.A., Samanta, I., Buchh, A.S., Bhat, M.A., 2004. Molecular detection and characterization of Dichelobacter nodosus in ovine footrot in India. Molecular and Cellular Probes 18, 289–291.
Isolation and characterization of Dichelobacter nodosus from ovine and caprine footrot in Kashmir, India S.A. Wani *, I. Samanta, S. Kawoosa Bacteriology Laboratory, Division of Microbiology & Immunology, Faculty of Veterinary Sciences & A.H., S.K. University of Agricultural Sciences and Technology of Kashmir, Shuhama (Alusteng), Srinagar 190006, India Accepted 13 November 2006
Abstract Footrot is a highly contagious and economically important disease of sheep and goats, caused by Dichelobacter nodosus, a slow growing anaerobic Gram-negative rod. The current Australian antigenic classification system, based on variation in the fimbriae, classifies D. nodosus into at least 10 serogroups (A–I and M) and 18 serotypes. This investigation was intended to determine the serological diversity of D. nodosus in this region of Kashmir, India. Exudates of footrot lesions were collected from 24 naturally infected sheep and 42 goats located in the Kashmir valley. Of these 66 samples, 24 yielded evidence of D. nodosus by PCR using 16SrDNA specific primers. Multiplex PCR using serogroup specific primers revealed the presence of serogroup B in all the samples except two, which showed the presence of serogroup E D. nodosus. This study also documents the isolation of D. nodosus and detection of serogroup E for the first time in India. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Dichelobacter nodosus; Footrot; Sheep; Goat; Isolation; PCR
1. Introduction Footrot is a highly contagious and economically important disease of the feet of sheep and goats, characterized by the separation of keratinous hoof from the underlying epidermal tissue resulting in severe lameness, loss of body condition and reduced wool production (Egerton et al., 1969). The disease is dependent on a mixed bacterial infection, but the essential causative agent is Dichelobacter nodosus, a slow growing anaerobic Gram-negative rod (Billington et al., 1996). The current Australian classification system, based on antigenic variation in the structure of fimbriae, classified D. nodosus into at least 10 serogroups (A–I and M) and 18 serotypes (Claxton, 1986; Ghimire et al., 1998). Traditionally the identification of D. nodosus has relied on the isolation of the causative agent from footrot lesion and biochemical tests on the resultant isolates (Pitman
*
Corresponding author. Tel./fax: +91 194 2262211. E-mail address: [email protected] (S.A. Wani).
0034-5288/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.rvsc.2006.11.006
et al., 1994). However, recently PCR based methods have been used for detection (La Fontaine et al., 1993) and characterization (Dhungyel et al., 2002) of D. nodosus without need to culture. The objective of the present investigation was to expand our earlier findings (Wani et al., 2004) for better understanding of the serological diversity of D. nodosus in this part of India. 2. Materials and methods 2.1. Collection of clinical samples Exudates of footrot lesions were collected during November 2003 to May 2004 from 24 naturally infected sheep and 42 goats of private owners from the Kangan (Srinagar) and Kawoosa (Budgam) area of the Kashmir valley. The site sampled was at the apex of the cleft that develops between the horn of the hoof and the sensitive underlying tissues. Samples were collected on cotton swabs, transported to the laboratory on ice, anaerobically cultured and stored in sterile tubes at 20 °C until further use.
142
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
2.2. DNA extraction
2.4. Serogrouping by multiplex PCR
Suspensions of the material present on the swabs were prepared in 1.5 ml microcentrifuge tubes in 100 ll of sterile phosphate buffered saline (PBS) by gentle vortexing. After removing the swabs, the samples were boiled for 5 min, cooled on ice for 10 min and centrifuged at 10,000g for 1 min. Similarly from the culture plates suspected colonies with characteristic morphology were directly suspended into 100 ll of sterile PBS and processed for the extraction of DNA as before. Two microlitres of the supernatant was used as the template for each PCR reaction.
The samples positive for D. nodosus as revealed by the amplification of 783 bp gene products were subjected to serogrouping by multiplex PCR using A–I serogroup specific primers (Dhungyel et al., 2002). The Oligonucleotide primers (Table 1) were procured from Bangalore Genei Pvt. Ltd, Bangalore, India. Positive control DNA samples kindly supplied by Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, were included in the PCR. Sterile distilled water was used as negative control. The PCR products were analyzed in 2.0% agarose gels, visualized and photographed as discussed above.
2.3. Detection of 16S rRNA gene of D. nodosus by PCR 2.5. Isolation of D. nodosus from clinical samples PCR amplification was performed in 25 ll in 0.2 ml thin walled PCR tubes (Tarson, India). The PCR mixture contained a final concentration of 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 3 mM MgCl2, 0.01% gelatin, 0.5 lM concentration of each primer, 0.2 mM concentrations of each 2 0 -deoxynucleoside 5 0 -triphosphate and 1U of Taq DNA polymerase (Bangalore Genei Pvt. Ltd, Bangalore, India). Oligonucleotide primers (Table 1) were also procured from Bangalore Genei Pvt. Ltd, Bangalore, India. The amplification cycles in a GeneAmp PCR System 2400 Thermal cycler (Applied Biosystems, USA) consisted of 94 °C for 2 min, followed by 5 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, and 25 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s for 25 cycles, and final extension at 72 °C for 4 min (La Fontaine et al., 1993). Positive control DNA samples kindly supplied by Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, were included in the PCR. Sterile distilled water was used as negative control. The PCR products were analysed in 0.8% agarose gels, stained with ethidium bromide and visualized under ultraviolet illumination and photographed with Gel Documentation System (GDS 8000 system, UVP, UK).
For the isolation of D. nodosus, lesion material from affected sheep and goats was streaked on Nutrient agar (HiMedia, India) plates with addition of 0.15% Serine, 0.5% arginine and 4% hoof powder. The hoof powder was prepared from dried hooves collected from healthy slaughtered sheep. The plates were placed in an anaerobic jar with Gaspacks (HiMedia, india) and incubated at 37 °C. After 4 days of incubation, suspected colonies (Thorley, 1976) were subcultured on the same medium (except the concentration of hoof powder was only 2%) for obtaining a pure culture of D. nodosus. Confirmation of the colonies as D. nodosus was by detection of speciesspecific 16SrDNA by PCR as described above except the hoof medium was used as a negative control. 3. Results Out of 24 samples collected from naturally infected sheep, 12 (50%) yielded the amplified product of the expected size of 783 bp (Fig. 1). The multiplex PCR assay for serogrouping was successfully applied to all the 12 specimens. Ten samples yielded a single band of 283 bp characteristic of serogroup B, whereas the remaining
Table 1 Details of the primers used in PCR assays Primer name
Nucleotide sequence (5 0 ! 3 0 )
Target gene
Size (bp)
Reference
Forward Reverse FP RA RB RC RD RE RF RG RH RI
CGGGGTTATGTAGCTTGC TCGGTACCGAGTATTTCTACCCAACACCT CCTTAATCGAACTCATGATTG3 0 5 0 AGTTTCGCCTTCATTATATTT3 0 5 0 CGGATCGCCAGCTTCTGTCTT3 0 5 0 AGAAGTGCCTTTGCCGTATTC3 0 5 0 TGCAACAATATTTCCCTCATC3 0 5 0 CACTTTGGTATCGATCAACTTGG3 0 5 0 ACTGATTTCGGCTAGACC3 0 5 0 CTTAGGGGTAAGTCCTGCAAG3 0 5 0 TGAGCAAGACCAAGTAGC3 0 5 0 CGATGGGTCAGCATCTGGACC3 0
16S rRNA – fimA fimA fimA fimA fimA fimA fimA fimA fimA fimA
783 – – 415 283 325 319 363 241 279 409 189
La Fontaine et al. (1993) Dhungyel et al. (2002)
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
143
4. Discussion
Fig. 1. Amplification of 16S rRNA gene of Dichelobacter nodosus from clinical samples of ovine and caprine footrot by PCR. Lane M-500 bp DNA marker, Lane 1, 2 – representative positive samples showing amplified product of 783 bp, Lane 3 – negative control, and Lane 4 – positive control.
Fig. 2. Serogroup specific PCR products of Dichelobacter nodosus from the clinical samples of sheep and goats affected with footrot. Lane M100 bp DNA marker, Lane 1 – representative positive sample showing amplified product of 283 bp specific for serogroup B, Lane 2 – representative positive sample showing amplified product of 363 bp specific for serogroup E, Lane 3 – negative control, and Lane 4 – positive control showing amplified product specific for both serogroup B and E.
two samples produced a serogroup E specific band of 363 bp (Fig. 2). Out of 42 clinical samples collected from affected goats, 12 (28.57%) were found positive for D. nodosus by 16S rDNA specific primers. All the 12 produced a 283 bp product by multiplex PCR and were identified as serogroup B. On primary culture in 4% hoof agar, samples yielded three types of colonies. Among them, greyish brown coloured, centrally elevated colonies were chosen for subculture. After subculture on 2% hoof agar medium, the DNA of the isolated colony was again confirmed as D. nodosus by PCR using 16SrDNA specific primers. Serogroup specificity of the isolates was again confirmed by multiplex PCR. Hoof medium was PCR negative.
Sheep and goat production is one of the important farm activities in the state of Jammu and Kashmir and footrot has become enzootic in sheep and goats in this part of India, for the last 15 years or more. There is need to control the disease by effective measures including vaccination. In countries where footrot is enzootic, there is a considerable antigenic diversity among the isolates of D. nodosus (Claxton et al., 1983; Gradin et al., 1993). Thus, for the development of an effective vaccine, it is essential to have up to date knowledge of serogroup and strain diversity of D. nodosus prevalent locally in the field. To date it is a common practice to prepare the commercial footrot vaccine containing representative serogroups available locally. This serogroup specific vaccination has been used successfully in eradicating virulent footrot from mixed flocks of sheep and goats in several countries including Nepal and Bhutan (Dhungyel et al., 2002; Ghimire et al., 1996; Jimenez et al., 2003). The detection of Serogroup B of D. nodosus in the present work in sheep and goats confirms our earlier findings in the valley (Wani et al., 2004). Further, the present study also unveiled the presence of serogroup E of D. nodosus. This is in agreement with the findings of Chetwin et al. (1991) and Ghimire et al. (1996) who also reported the presence of serogroup E of D. nodosus in sheep and goats affected with footrot in New Zealand and Nepal, respectively. Coincidentally, serogroup E is relatively uncommon in Australia (Claxton et al., 1983), United Kingdom (Hindmarsh and Fraser, 1985), United States of America (Gradin et al., 1993). The detection of serogroup B in almost all samples in the present investigation suggests that strain(s) of serogroup B could be an appropriate candidate for the development of an effective vaccine. Further studies in this direction and covering more geographical area will actually determine the formulation of an effective vaccine against the disease in this local region. Acknowledgements This work was carried out with the facilities available with the financial support of Indian Council of Agricultural Research (ICAR) and Department of Science and Technology (DST), New Delhi. The authors are highly thankful to Dr. O.P. Dhungyel, Faculty of Veterinary Medicine, University of Sydney, Cambden, NSW 2570, Australia, for the supply of positive control DNA of D. nodosus. References Billington, S.J., Johnston, J.L., Rood, J.I., 1996. Virulence regions and virulence factors of the ovine footrot pathogen, Dichelobacter nodosus. FEMS Microbiological Letter 145, 147–156. Chetwin, D.H., Whitehead, L.C., Thorley, E., 1991. The recognition and prevalence of Bacteroides nodosus serotype M in Australia and New Zealand. Australian Veterinary Journal 68, 154–155.
144
S.A. Wani et al. / Research in Veterinary Science 83 (2007) 141–144
Claxton, P.D., Ribeiro, L.A., Egerton, J.R., 1983. Classification of Bacteroides nodosus by agglutination test. Australian Veterinary Journal 70, 123–126. Claxton, P.D., 1986. Serogrouping of Bacteroides nodosus isolates. In: Proceedings of a Workshop, Melbourne, 1985, CSIRO, Division of Animal Health and Australian Wool Corporation, Glebe, Sydney, N.S.W, Australia, pp. 131–134. Dhungyel, O.P., Whittington, R.J., Egerton, J.R., 2002. Serogroup specific single and multiplex PCR with pre-enrichment culture and immunomagnetic bead capture for identifying strains of D. nodosus in sheep with footrot prior to vaccination. Molecular and Cellular Probes 16, 285–296. Egerton, J.R., Roberts, D.S., Parsonson, I.M., 1969. The aetiology and pathogenesis of ovine footrot. I. A histological study of bacterial invasion. Journal of Comparative Pathology 79, 207–216. Ghimire, S.C., Egerton, J.R., Dhungyel, O.P., 1996. Characterization of Dichelobacter nodosus isolated from footrot in sheep and goats in Nepal. Small Ruminant Research 23, 59–67. Ghimire, S.C., Egerton, J.R., Dhungyel, O.P., Joshi, H.D., 1998. Identification and characterization of serogroup M among Nepalese isolates of Dichelobacter nodosus, the transmitting agent of footrot in small ruminants. Veterinary Microbiology 62, 217–233.
Gradin, J.L., Sonn, A.E., Petrosvka, L., 1993. Serogrouping of Bacteroides nodosus isolates from 62 sources in the United States. American Journal of Veterinary Research 54, 1069–1073. Hindmarsh, F., Fraser, J., 1985. Serogrouping of Bacteroides nodosus isolated from ovine footrot in Britain. Veterinary Record 116, 187– 188. Jimenez, R., Piriz, S., Martin-Palomino, P., Mateos, E., Vadillo, S., 2003. Aetiology of ovine footrot in the Portugese region of Alto Alentejo. Journal of Veterinary Medicine B 50, 118–120. La Fontaine, S., Egerton, J.R., Rood, J.I., 1993. Detection of Dichelobacter nodosus using species-specific oligonucleotides as PCR primers. Veterinary Microbiology 35, 101–117. Pitman, D.R., Palmer, M.A., Depiazzi, L.J., 1994. The laboratory culture of D. nodosus in footrot eradication programme. Australian Veterinary Journal 71, 109–112. Thorley, C.M., 1976. A simplified method for the isolation of Bacteroides nodosus from ovine footrot and studies on its colony morphology and serology. Journal of Applied Bacteriology 40, 301–309. Wani, S.A., Samanta, I., Buchh, A.S., Bhat, M.A., 2004. Molecular detection and characterization of Dichelobacter nodosus in ovine footrot in India. Molecular and Cellular Probes 18, 289–291.