Isolation and characterization of highly purified rat intestinal intraepithelial lymphocytes

JOURNAL OF IMMUNOLOGICAL METHODS ELSEVIER

Journal of Immunological

Methods

194 (1996) 35-48

Isolatiov and characterization of highly purified rat intestinal intraepithelial lymphocytes Joy A. Kearsey, Andrew W. Stadnyk Depurtments

of Microbiology

and 1mmunolog.v. und Pediatrics,

Received 27 November

Dalhousir

1995; revised 12 February

Unilvrsity.

* Hal$x

1996; accepted 29 February

NOLYI Scotia. Cunada

1996

Abstract The study of intestinal intraepithelial lymphocytes (IEL) has been hindered by the difficulty of isolating a population of lymphocytes which is free of epithelial cell or lamina propria cell contaminants and representative of the in vivo population of IEL in both phenotype and function. We describe an improved technique for the extraction and purification of IEL from the proximal small intestine of the rat. This technique rapidly and reproducibly isolates 5-10 X lo6 IEL/rat with 90-95% purity and viability without the use of enzymes which affect lymphocyte function. The resulting cell population, which is 75% a@ T cell receptor (TCR)+, 70% CD8+, and 33% CD4+ T cells, and only 5% B cells and 2% macrophages, is of suitable purity to allow for flow cytometric analysis of the entire population of cells without requiring gating on lymphocytes. IEL are comprised of a unique T cell repertoire in that 27% of cells co-express the CD4 and CD8 molecules, but only 11% of CD4+ cells co-express CD45RC. All CD4+ cells express the (-w(STCR. but 9% of IEL are CD8+CD4_a@TCR-. The adhesion molecules (Ye integrin and L-selectin are expressed on 57% and less than 1% of IEL. respectively. The isolated IEL population contains mRNA for IL- la, IL- I p, IL-IR. IL-IRA, IL-2, IL-6R, IFN-y. TGF-a, TGF-P,, and TNF-a. Mesenteric lymph node cells (MLNC) were examined in parallel. This technique allows for the isolation of rat IEL appropriate for phenotypic analysis by flow cytometry and for cytokine analysis by reverse transcription/polymerase chain reaction. Kewrords: Intraepithelial teric lymph node cell

lymphocyte;

Isolation

procedure,

rat; Flow cytometry;

Reverse transcription/polymerase

chain reaction:

Mesen-

1. Introduction

Abbreviations: BSA, bovine serum albumin; CINC, cytokine induced neutrophil chemoattractant; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid: IEL, intraepithelial lymphocytes; FITC. fluorescein isothiocyanate: IFN, interferon: IL, interleukin: IL-R, interleukin receptor: IL-RA, interleukin receptor antagonist; MLNC, mesenteric lymph node cells; PBS, phosphate buffered saline: PCR, polymerase chain reaction: PE, R-phycoerythrin: RT, reverse transcription; TC, Tri-Color: TCR. T cell receptor; TGF, transforming growth factor; TGF-MP, transforming growth factor masking protein: TNF, tumor necrosis factor. 0022. I759/96/$15.00 Copyright PIf SOO22- 1759(96)00052-X

Unlike studies of lymphocytes from the spleen or lymph nodes, the study of intestinal intraepithelial lymphocytes is complicated by the difficulties of

* Corresponding author. At: Infection and Immunology Research Laboratory. IWK Children’s Hospital, 5850 University Avenue, Halifax, Nova Scotia B3J 3G9, Canada. Tel.: (902)4288491; Fax: (9021428.3217.

0 1996 Elsevier Science B.V. All rights reserved

36

J.A. Kearsey. A. W. Stadnyk/

Journal

of Itnnwzological

obtaining pure preparations of cells and using isolation procedures which do not alter the functional capabilities of the cells. As a result, different protocols for purifying IEL cause varying artifacts, resulting in wide discrepancies in reports of the phenotypes and functions of IEL. Most isolation procedures currently used for IEL purification involve opening the intestine longitudinally and cutting it laterally into small pieces prior to disruption of the epithelium (Davies and Parrott. 1981; Lundqvist et al., 1992; Mosley and Klein, 1992). This practice is unnecessary for the extraction of IEL from rodent intestines and serves only to expose the sub-epithelial layers of the intestine, increasing the probability of lamina propria cell contamination. Chelating or enzymatic methods of removing the intestinal epithelium (such as ethylenediaminetetraacetic acid (EDTA) or collagenase treatment) have been shown to cause the release of cellular factors which influence the cytotoxic activities and cell survival of peripheral blood lymphocytes (Chiba et al., 1981; Gibson et al., 1985). We describe an improved IEL extraction and purification technique which is a modification of a protocol originally described by Mayrhofer and Whately (1983). This procedure allows for the reproducible and efficient isolation of highly purified and viable IEL without the use of enzymes or the release of sub-epithelial leukocytes. Our phenotypic observations of IEL from adult Lewis rats confirm the findings of others, and expand on them by reporting the expression of adhesion molecules and cytokine mRNAs. We have examined the cells from the draining lymph node of the intestine, the mesenteric lymph node (MLNC), in parallel with IEL.

2. Materials and methods

2.1. Animals Lewis strain adult male rats (Harlan Sprague Dawley, Indianapolis, IN) were used in all experiments. Rats were housed in compliance with the guidelines established by the Canadian Council on Animal Care.

Methods

(I 9%~35-48

194

Intestine

Evert, Distend, Ligate ends

I

Place in PBS with DT

vortex

A

Supematant

10s

Intestine

(discard)

I

Place I” complete

A

vonex

Supernatant Suspend

Intestine

cells in 30%Pcrcoll.

Centrifuge

5OOxg. 15 min

(discard

,22”C

or histology)

I

dead cells, enterocytes

-mucus, 30 Resuspendpellet

RPM.

4x15s

(dncard

orexamme)

u

m45%Percoll

Layer above 75% Percoll Centrifbge

sooxg,

22°C I

30 InI”,

(discardorexamme) Wash

3x in complete -

RPhll

I

erytbrocytes, debris (discard

or examine)

bL I Fig. 1. Flow diagram lymphocytes.

of the isolation

protocol

for intraepithelial

2.2. Isolation of cells Intraepithelial lymphocytes were isolated from the proximal 2/3 of the rat small intestine by a modified version (Fig. 1) of the method described by Mayrhofer and Whately (1983). The proximal 2/3 of the small intestine of one rat was removed, cut into two pieces, and flushed with phosphate buffered saline (PBS). Each segment was everted, filled with PBS, and the ends were ligated. The segments were each placed in a 50 ml screw-cap tube containing 45 ml PBS with 2 mM dithiothreitol (DTT; Life Technologies, Burlington. Ontario. Canada). Each tube was vibrated for 10 s on a vortex mixer to remove mucus and debris from the intestine, and the intestinal segments were placed into fresh tubes containing approximately 30 ml of complete RPM1 (containing 5% (v/v) fetal bovine sera. 2 mM L-glutamine, 10

J.A. Kearsey, A. W. Stadnyk/Journal

mM Hepes buffer, 50 U/ml penicillin, 50 pg/ml streptomycin; Life Technologies) and vortexed at high speed for four bursts of 15 s each to remove the epithelium. The intestinal segments were then removed from the cell suspension and discarded or examined by histological section. Formalin fixed paraffin-embedded tissue sections stained with hematoxylin and eosin were prepared by the Anatomical Pathology/Support Unit, IWK Children’s Hospital, Halifax, Nova Scotia, Canada. Purification of IEL from the cell suspension included pipetting of the cell suspension to release the lymphocytes from clumps of enterocytes, passing the cell suspension through two layers of cheesecloth (Fisher Scientific, Nepean, Ontario) to remove mucus and sheets of epithelium, and centrifugation of cells through Percoll (Pharmacia Canada, Baie d’Urfe, Quebec, Canada). The cell suspension in each tube was made up to a 35 ml volume with complete RPMI. Percoll was added to each tube to give 30% (v/v) Percoll (final volume 50 ml/tube). The contents of each tube were split in half and the four tubes were centrifuged at 500-550 X g for 15 min at room temperature. The cells which passed through 30% Percoll were resuspended in 45% (v/v) Percoll and combined (total final volume 15 ml). A discontinuous Percoll gradient was made by layering the 15 ml of 45% Percoll above 15 ml of 75% (v/v> Percoll in a 50 ml tube. The gradient was centrifuged at 500-550 X g for 30 min at room temperature. Cells were recovered from the 45-75 interface and washed three times in PBS. Variations on this protocol, including other densities of Percoll, were tested, but this procedure was shown to result in the highest yield and purity. In each experiment, the intestine from each of two rats was processed as outlined above and the cells were combined for analysis. To assess the purity of the lymphocyte population, IEL were examined on Diff-Quik (Baxter Scientific Products, Miami, Florida) stained cytospin (Shandon Elliot Cytospin, Pittsburgh, Pennsylvania) smears and the forward and side light scatter properties of the cells were examined by flow cytometry. The efficiency of the IEL isolation procedure was also monitored by examining the light scatter properties and cytospin smears of cells excluded during the Percoll fractionation. Cell viability was determined

of Immunological

37

Methods 194 (1996135-G

using trypan blue (Flow Laboratories, McLean, VA) staining of cells after recovering and washing them free of Percoll. Mesenteric lymph nodes were removed from the same animals and processed to single cell suspension by pressing through a fine stainless steel screen. Processing MLNC as for IEL isolation results in the retrieval of virtually all MLNC from the 45-75% Percoll interface, therefore, MLNC were not routinely subjected to the Percoll isolation procedure. The resulting MLNC were analyzed in parallel with IEL since we expected some subsets of MLNC to serve as positive-staining controls for lymphocyte markers that might not be detected among the IEL. 2.3. Antibodies The following monoclonal antibodies (purchased from Serotec Canada, Toronto, Ontario) were used for flow cytometry analysis: W3/25 and Rphycoerythrin (PE)-conjugated W3/25 (anti-CD4), R73 (anti-al3 T cell receptor), MRC OX-l (antileukocyte common antigen), MRC OX-8 (anti-CD8), MRC OX-22 and fluorescein isothiocyanate (FITC)conjugated MRC OX-22 (anti-CD45RC), MRC OX42 (anti-complement receptor type 3), and MRC OX-33 (anti-CD45, B cell form). Tri-Color (TC)conjugated MRC OX-8 (anti-CD81 was purchased from Caltag Laboratories (San Francisco, CA). Monoclonal antibodies TA-2 (anti-o, integrin; Issekutz and Wykretowicz, 199 1) and TA-5.1 (anti-L-selectin) were kindly provided by Thomas Issekutz (University of Toronto, Toronto, Ontario, Canada). Monoclonal antibody B9 (anti-Bordetella pertussis toxin; Halperin et al., 19911, kindly provided by Scott Halperin (Dalhousie University, Halifax, Nova Scotia, Canada) was used as a non-specific antibody (isotype) control. A rabbit anti-mouse IgG FITC-conjugated antibody (ST-AR 38, Serotec Canada) was used as the secondary antibody. All monoclonal antibodies are ascites and of the mouse IgGl isotype with the exception of MRC OX-42 which is a mouse IgG2a antibody and TA-5.1 which is a culture supernatant. 2.4. Irnmunojluorescence

staining and analysis

For single color immunofluorescence, cells were incubated in 0.1 ml of saturating

1 X lo6 concen-

trations of antibody in PBS with 0.5% bovine serum albumin (BSA) for 30 min at 4°C with frequent mixing. The cells were washed twice in chilled PBS with 0.5% BSA. resuspended in 0.1 ml of the secondary FITC-conjugated antibody diluted in PBS with 0.5% BSA, and incubated for 30 min at 4°C in the dark with frequent mixing. The cells were washed twice, resuspended in chilled 2% paraformaldehyde in PBS, and stored in the dark at 4°C until analyzed. For two color immunofluorescence, 1 X 10’ cells were incubated in 0.1 ml of saturating concentrations of FITC-conjugated and PE-conjugated monoclonal antibodies in PBS with 0.5% BSA for 30 mm at 4°C with frequent mixing. Cells were washed twice, resuspended in 2% paraformaldehyde in PBS. and stored in the dark at 4°C until analyzed. For three color immunofluorescence. 1 X 10’ cells were incubated as for single color immunofluorescence with a primary monoclonal antibody and then the secondary FITC-conjugated antibody. After the cells were washed twice, they were incubated in the isotype control antibody diluted in PBS with 0.5% BSA for 10 min at 4°C. The PE-conjugated and

Table I Oligodeoxyribonucleotide

primer sequences

Molecule

5’ (sense) primer

p-actin

CTGGAGAAGAGCTATGAGC

’

TC-conjugated monoclonal antibodies were then added to the mixture at saturating concentrations. Cells were incubated in the antibody mixture for 30 min at 4°C washed twice, resuspended in 2% paraformaldehyde in PBS, and stored in the dark at 4°C until analyzed. Cells were analyzed on a Becton Dickinson FACScan flow cytometer (Becton Dickinson Immunocytometry Systems, Mountain View, California) and results were generated using the Consort 30 or the FACScan Research computer software programs. Cells from the entire contour plot (Fig. 3~1 were examined for tluorescence. The percentage of cells labelled by each monoclonal antibody was calculated in comparison with cells stained with an isotype control antibody. Results generated in two and three color immunofluorescence studies were comparable to the results for each antibody in single color immunofluorescence performed in parallel. 2.5. RNA Total cellular RNA was extracted from cells using Trizol Reagent (Life Technologies) by a modified

’ for PCR and the predicted 3’ (antisense)

product sizes for rat cytokines

primer

AGGATAGAGCCACCAATCC

IFN-y r IL-la, L

CACGAAAATACTTGAGAGCC

IL-1p c IL-IRA’ IL-lRJ IL-2 * IL-4 i IL-6 ’ IL-6R c TGF-ci ’ TGF-P, ’ TGF-PMP TNF-ol L CINC *

CAACAAAAATGCCTCGTGC

TGCTGATGTACCAGTTGGG

CATGGTGCCTATTGACTTTCG

TCTAGTGTTGTGCAGAGGAACC

CTGATGGTGATGAATGTGG

CTTAACGAAGCAGATGAACGG

a h ’ ’ z

GTAAGAGAAGAGCAAAGCC

’

TCTCTACCCCAGAATCAGCACC’ CAACTTTATCCTACCCATCCG

Predicted cDNA product size

Predicted gDNA product size

Sequence reference h

330 297 287 331 237 405

542 bp > 2.4 kb N.D. = 1.1 kh N.D. N.D. N.D. > 4 kb 1.6 kb N.D. N.D. N.D. N.D. I.2 kh 151 hp

JO069 1 M293 15.6,7 DO0103 M98810

AGCTGTTGCTGGACTTACAGG

CAGAAATTCCACCACAGTTGC

311

GAACCAGGTCACAGAAAAAGG

CTGCAAGTATTTCCCTCGTAGG

AAATCTGCTCTGGTCTTCTGG

TTAGATACCCATCGACAGG

ATGACTCTGAATAGAGACGCCC

CATTCCTCATAAGCCATCAGGC

ATCTGGTGGAAGGAGAGAACC

TCACAGGCACTAGGAAACC

313 380 298 108 51-l 430

CTACTACGCCAAAGAAGTCACC ‘CAGGAAGGTTATACTTGCG

CTGATCCCATTGATTTCCACG

TACTGAACTTCGGGGTGATCG

AATGTCCATTTGGTCTGTCGC CCTTGTCCCTTGAAGAGAACC

TCCAGAGTTTGAAGGTGATGC

CTTTCTCCATTACTTGGGG

297

160

bp bp bp bp bp bp bp hp bp bp bp bp bp hp bp

All sequences are written 5’ ---) 3’. GenBank accession number. Oligodeoxyrihonucleotide primers synthesized by the Gene Probe Laboratory, Dalhousie University. Halifax. Oligodeoxyribonucleotide primers synthesized by OligoExpresa. Bio/Can Scientific. Mississauga. Ontario. Primers contain a 7 haae EcoRI linker (TGAATTC) on the 5’ end; actual fragment appears as 31 I hp. (Eisenherg et al.. 1991). N.D.. not determined.

I

M95578 M72899 X 16058 M26735 JO5668 x02004 X52398 M5513 I LOO98 I DI 1415

J.A. Kearsey. A. W. Stadrzk/ Journal of immunological Methods 194 (19961 35-48

39

Fig. 2. Removal of the intestinal epithelium and purification of IEL. a: normal small intestinal villi (original magnification 200 X ).h: small intestinal villi after removal of the epithelium. Note that the basement membrane and lamina propria core are intact, and that the epithelium has been stripped from both the villi and the crypts (original magnification 200 X ). c: small intestinal intraepithelial lymphocytes. The purified IEL population includes lymphocytes with large or fine cytoplasmic granules (original magnification 400 x ).

version of the method originally described by Chomczynski and Sacchi (1987). The final pellet of RNA was resuspended in water, heated to 60°C for 10 min, cooled to room temperature, and stored at - 80°C until examination for specific cytokine mR-

a. Above 30%

b. Above 45%

NAs using the reverse transcription/polymerase chain reaction (RT/PCR). Spectrophotometric analysis allowed for the determination of RNA concentration and purity. RNA samples were consistently of high purity.

c.

IEL (45/75%)

d. Below 75%

,s

I

: .’ _‘. :

__.. PO

Forward

¶a

Scatter

Fig. 3. Cells from each stage of the IEL purification process characterized by size and granularity (forward angle and side angle light scatter, respectively). Note that in addition to the selective loss of contaminants in the IEL population cc), the discarded cell populations are also selectively depleted of IEL. Light microscopic examination of the discarded fractions reveals that ceils which do not pass through 30% Percoll (a) are largely dead cells and enterocytes. cells which do not pass through 35% Percoll (h) are primarily enterocytes, and the material which passes through 75% Percoll (d) is erythrocytes and debris.

J.A. Kearsey. A. W. Stadnyk/Joumal

IEL

of Immunological

41

Methods 194 (1996135-48

MLNC Leukocyte (OX-I)

c@TCR (R73)

B Cell (0X-33)

:.., l!!!Y!L

Macrophage

‘.

ala0

10'

d

(0X-42)

103

Log Fluorescence Intensity

Fig. 4. Expression of leukocyte antigens on the entire population of IEL and MLNC isolated from adult Lewis rats. Cells were stained with the mouse anti-rat monoclonal antibodies MRC OX-l (anti-leukocyte common antigen). R73 (anti-oBTCR1, MRC OX-33 (anti-CD45, B cell form). and MRC OX-42 (anti-complement receptor type 3 on macrophages, granulocytes, and dendritic cells) followed by a FITC-conjugated rabbit anti-mouse IgG and analyzed on a Becton-Dickinson FACScan flow cytometer. The percent of IEL and MLNC expressing each marker was calculated in comparison with cells from the same sample stained with the negative isotype control antibody (dotted histogram). Histograms are representative of 3-7 experiments. Representative IEL and MLNC histograms for each marker are from the same experiment. The mean percentages ( f 1 standard deviation) of cells expressing each marker are summarized in the text.

2.6. ReL,erse transcription / polynerase tion (RT/ PCRI

chain reac-

26.1. Reverse transcription /cDNA syrlthesis CRT) 1 pg of total RNA was reverse transcribed in a 20 p.1 reaction mixture containing 1 X manufacturer supplied buffer (Life Technologies), 0.01 M DTT. 0.5 mM dNTPs (Life Technologies), 1 pg random hexamers (Pharmacia Canada), and 200 U of murine Moloney leukemia virus reverse transcriptase (Life Technologies). After the mixture was allowed to sit at room temperature for 10 min. the reaction was performed at 37°C for 1 h, then heated to 94°C for 10 min to inactivate the enzyme. Analysis of all mRNA transcripts for different cytokines was performed on the same first strand cDNA sample. 2.6.2. Polynerase chain reaction (PCR) Using an algorithm designed by Lowe et al. (I 990). the published gene or cDNA sequences were used to identify oligodeoxyribonucleotide sequences suitable for use as primers in the PCR. Table 1 contains sequences of the oligodeoxyribonucleotide primer pairs and the predicted fragment sizes of PCR products for p-actin, interleukin- 1(Y (IL- I CY ), interleukin- 1p (IL- 1PI. interleukin- 1 receptor antagonist (IL- IRA). interleukin-2 (IL-2). interleukin-4 (IL-41. interleukin-6 (IL-61, transforming growth factor-o (TGF-o 1, transforming growth factor-p, (TGF-PI 1, transforming growth factor-l3 masking protein (TGFPMP). tumor necrosis factor-a (TNF-o 1. cytokine induced neutrophil chemoattractant (CINC), type 1 interleukin- 1 receptor (IL- 1Rl. and the interleukin-6 receptor (IL-6R). Primers for the control transcript, p-actin, were designed to amplify products from the gene and cDNA of similar but unequal size to allow for detection of contaminating genomic DNA in the RNA preparations. The specificities of most of the cytokine-specific primers were confirmed by sequence analysis of amplified products or by probing a Southern blot of the PCR products with a third oligodeoxyribonucleotide unique to the cytokine. All

primer pairs amplify products of the predicted size based on the published gene or cDNA sequences. 3 pl of the cDNA and of a l/l0 dilution of the cDNA generated by the reverse transcription were used as template in the PCR reactions for cytokines and the control transcript p-actin. respectively. The PCR reaction mixture (50 p,l final volume) consisted of the following reagents in final concentration: 1X reaction buffer (50 mM KC], 20 mM Tris-HCl pH 8.4, 2.5 mM MgCl,. 0.1 kg/ml BSA), 0.2 mM dNTPs, 2.5 pmol each of the 5’ and 3’ oligodeoxyribonucleotide primers (Table 1). and 2.5 U of Taq DNA polymerase (Pharmacia Canada). The PCR for all cytokines was performed in a BioOven thermocycler (BioTherm, Arlington, VA1 programmed for 35 cycles. cycling between 92°C and 60°C each for 30 s. followed by a final 5 min incubation at 72°C. 1 pl of a 100 bp DNA ladder (Life Technologies) or 8 pl of the PCR products were electrophoresed through a 1.5% agarose gel (ICN Biomedicals. Aurora. OH) containing 0.5 kg/ml ethidium bromide. Polaroid photographs of the stained products were taken under UV exposure using Kodak 667 film. Cloned cDNAs served as templates in positive controls for the PCR: contamination controls with no added template were consistently negative.

3. Results 3. I. Purity

of IEL preparations

Histological sections of the intestine before and after removal of the epithelium by vortexing show that the epithelial layer is efficiently removed from both the villi and crypts without the release of lamina propria lymphocytes (Fig. 21 or Peyer’s patch lymphocytes (not shown). Mayrhofer and Whately (1983) first reported similar results with eversion, distension. and mechanical disruption of the epithelium. Cytospin smears and the light scatter properties (size and granularity) of the fractions of cells ob-

Fi g. 5. T cell s&sets of IEL and MLNC of adult Lewis rats. Cells were stained with MRC OX-22 (anti-CD45RC)-FITC and W3/25 (anti-CD4)-PE. or R73 (anti-alp TCR) and the FITC-conjugated secondary antibody. W3/24-PE. and MRC OX-8 (anti-CDS)-TC. Cells were analyzed on a Becton-Dickinson FACScan flow cytometer. Dot plots are representative of the entire population of isolated IEL or MLNC from 3-5 experiments. The mean percentages (i I standard deviation) of cell\ in each T cell subset are summarized in the text.

J.A. Kearsev. A. W. Stadn,vX/ Journal

oflmmmunologicol Methods 194 (19961 35-48

MLNC

IEL CD4

I.:

(W3/25)

CD45RC

(0X-22)

CD4 (W3/25)

CD8 (OX-81 I.* ctPTCR (R73)

X-8)

CD4 (W3/25)

aPTCR (R73)

Log Fluorescence Intensity

43

11

J.A. Kenrsey,

A. W. StadnFk/

Jourml

of Itnmunological

tained by Percoll separation confirm that debris, dead cells, erythrocytes, and enterocytes are efficiently removed from the IEL population with minimal loss of lymphocytes (Fig. 3). The average yield of IEL is 5.6 k 2.1 X lo6 cells per rat (n = 101. Based on morphology, these cell populations are consistently enriched to 92 k 1% lymphocytes, 28 + 1 1% of which contain either large or fine cytoplasmic granules (Fig. 2~). Isolated cells are consistently greater than 95% viable. and any dead cells are typically large, non-lymphocytes. Flow cytometry of the entire population recovered from the 45-75s Percoll interface reveals two subpopulations of lymphocytes (Fig. 3c) according to relative size (forward light scatter) and granularity (side light scatter). The smaller sized lymphocytes include 24.5

IEL

Methods

194 (199613548

k 4.6% of the cells in the IEL preparation; the larger sized lymphocytes include 68.6 + 4.8% of the cells in the IEL preparation. Similarly, cells isolated in parallel from the mesenteric lymph node (average yield of 6.0 k 2.1 X 10’ cells/rat; II = 10) include two subpopulations of lymphocytes, with 33.4 Ifr 8.8% small cells, 64.4 + 9.3% large cells, and no granulated lymphocytes. 3.2. PherwQpe of IEL ard MLNC Our observations of rat IEL isolated by the protocol described in this report confirm and expand on the findings of others using other isolation procedures (Fangmann et al., 1991; Takimoto et al., 1992). The entire isolated rat IEL population (shown in Fig.

MLNC a4 integrin (TA-2)

(TA-5.1)

Log Fluorescence

Intensity

Fig. 6. Expression of the adhesion molecules cy4 integrin and I.-selectin on the entire population of IEL and MLNC isolated from adult Lewis rats. Cells were stained with the mouse anti-rat monoclonal antibodies TA-2 and TA-5.1, respectively, followed by a FITC-conjugated rabbit anti-mouse IgG and analyzed on a Becton-Dickinson FACScan flow cytometer. The percent of IEL and MLNC expressing each cell surface molecule was calculated, using the markers shown on the histograms. in comparison with cells from the same sample stained with the negative isotype control antibody (dotted histogram). Histograms are representative of 3-4 experiments. The mean percentages ( f I standard deviation) of cells expressing each marker are summarized in the text.

J.A. Kear.rey A. W. Stadnyk/

45

Joumul of Immunologiccd Methods 194 (1996) 35-48

3c) consists of 88.6 f 1.3% leukocyte common antigen+ cells (n = 61, 74.8 f 5.3% CXBTCR’ T cells (n = 7). 4.7 * 1.6% B cells (n = 3). and 2.4 5 0.9% macrophages (n = 3). Representative histograms are shown in Fig. 4. The unique T cell repertoire consists of 69.8 f 2.7% CD8+ cells (n = 4) and 33.3 k 8.2% CD4+ cells (n = 7). A substantial population (27.3 &-6.4%; n = 3) of IEL co-express the CD4 and CD8 molecules. Therefore, 8.1 t- 0.8% of IEL are CD4+CD8and 42.9 f 3.9% are CD8+CD4(Fig. 5). CD45RC is normally detected in all CD8+ cells and 2/3 of CD4+ cells (Spickett et al., 1983). In contrast. only 10.6 f 2.8% of CD4+ IEL (3.6 & 1.O% of the total IEL population; II = 5) express CD45RC (Fig. 5). Only 20.2 f 3.7% (n = 5) of IEL are suggesting that at least half of the CD4-CD45RC+, CD8+CD4population of IEL must not express the CD45RC molecule. Two experiments with three color immunofluorescence for CD4, CD8, and CD45RC have confirmed that only 16% of IEL (21% of all CD8’ cells) are CD8+CD45RCf (not shown). All CD4+ cells (CD4+CD8+ and CD4+CD88) express the oB form of the T cell receptor but 8.5 k 1.4% of cells (n = 3) are CD8+CD4and do not express the oBTCR (Fig. 5). Presumably these cells express the yS form of the TCR. The novelty of IEL T cell subsets is highlighted by comparison with the MLNC (see below and Fig. 5). Interestingly, the expression of the adhesion molecules L-selectin and cxJ integrin

on rat IEL (Fig. 6) is variable despite consistent expression of the leukocyte common antigen, cxBTCR, and CD8. L-selectin is usually undetectable, but has been detected as high as 15.8% in one sample, at a low intensity. The oq integrin is found on 56.5 5 11.6% of IEL, with a range of 43% to 67%. The appearance of the histogram for oJ integrin expression on IEL (Fig. 6) suggests that subsets of IEL may express the (Ye integrin at different intensities. In contrast to IEL, MLNC (Fig. 4) are only 79.8 + 6.2% leukocyte common antigen+ cells (n = 6). including oBTCR+ T cells (64.2 f 7.9%; II = 7). B cells (19.9 * 4.2%: II = 3), and a small population of macrophages (1.8 k 1.6%; n = 3). MLNC reflect the characteristic T cell population of 16.9 5 1.1% CD8+ cells (n = 4) and 49.5 _t 6.4% CD4+ cells (n = 8). CD4+CD8+ cells are rare (3.5 + 0.6%), and CD4_CD8cells represent 35.3 & 8.3% of the MLNC (II = 3; Fig. 5). As expected, CD45RC is expressed on 64.6 + 4.9% (n = 5) of CD4+ cells (Fig. 5) an d vi.rt ua 11y all CD8+ cells (not shown!. Essentially all CD4+ and CD8+ cells express the oB form of the T cell receptor (Fig. 5). In addition, MLNC express both the (Ye integrin (61.5 k 4.4%; II = 4) and L-selectin (5 1.8 k 15.8%; n = 4) (Fig. 6). However, there appears to be a population of cells which express a4 at a low intensity, resulting in an overlap with the negative control histogram. The

Fig. 7. Cytokine mRNA expression by rat IEL and MLNC. Total RNA was isolated from IEL and MLNC and analyzed cytokine receptor transcripts by RT/PCR using transcript-specific 5’ and 3’ primers.

for cytokine

and

staining pattern of TA-5.1 on MLNC suggests that the L-selectin+ MLNC include subsets with high and low intensities of expression. 3.3. Cytokirle production

by freshly

isolated rat IEL

Cytokine mRNA expression and cytokine production by murine (Taguchi et al., 1991; Barrett et al.. 1992: Fujihashi et al., 1993a.b: Yamamoto et al.. 1993. 1994; Beagley et al., 1995) and human (Pluschke et al., 1994) IEL has been reported by others. We have examined rat IEL for specific cytokine mRNAs by RT/PCR and report that the panel of cytokines detected is similar to that described in the mouse and human. Constitutively high levels of IFN-y, IL-2, IL-1B. TGF-B, and TNF-o, and low levels of IL-lo. IL-IRA. IL-lR, IL-6R. and TGF-CY mRNAs were detected in IEL (Fig. 7). IL-6. which we have detected in high levels in freshly isolated rat epithelial cells (not shown), is undetectable in the IEL population by the sensitive RT/PCR technique. MLNC express mRNA for IL-2, IL-l (Y. IL-lB, IL1RA, IL- lR, IL-6, IL-6R, TGF-o, TGF-B,. and TNF-o. but not for IFN-7. Neither cell type expressed detectable mRNA for TGF-BMP, IL-4, or CINC (not shown).

4. Discussion The procedure described in this report has several advantages over other IEL isolation protocols. By minimizing the risk of contamination by sub-epithelial leukocytes, removing the epithelial layer from both the villus and crypt, efficiently separating enterocytes from lymphocytes. and avoiding the use of enzymes, this method allows for the isolation of IEL which are free of contaminants and representative of the in vivo population. In addition, this technique can be used to reproducibly isolate 5- 10 X 10h IEL with 90-95s purity and viability from the proximal small intestine of a single rat in approximately three to 4 h. Processing of multiple animals is convenient and only minimally lengthens the time of the isolation procedure. Using the reported method, removal of the epithelium is achieved by everting and distending the

intestine. followed by mechanical shearing of the epithelium. By not cutting the intestine into small fragments. a practice used in most IEL isolation protocols, the lamina propria is not exposed, and the risk of extracting sub-epithelial cells is minimized. Davies and Parrott (I98 1) report a technique which requires cutting the intestine into small fragments. Preservation of the basement membrane and the lamina propria is not confirmed by histology and although the resulting murine IEL population is reported to be 90% lymphocytes, only 65% of cells are T cells. Similarly. Mosley and Klein (1992) describe a protocol which involves chopping up murine intestinal tissue, and they gate on CD45+ cells (leukocytes) before analysis of antigenic marker expression on TEL. The original description of eversion and distension of the intestine (Mayrhofer and Whately. 1983) as an alternative to opening the intestine longitudinally and cutting the intestine into small pieces yielded a cell population which was 15% nonlymphoid cells. In addition, analysis of cell surface marker expression on isolated lymphocytes required setting upper and lower limits on the forward light scatter profile to eliminate viable epithelial cells. dead epithelial cells, and cellular debris. Histology of tissue samples after removal of the epithelium by the method we describe (Fig. 2) confirms that the epithelium is removed from the villi and crypts without disrupting the sub-epithelial layers of the intestine. In contrast to other studies. we have performed flow cytometric analysis on our entire population of isolated cells without setting gates on a lymphocyte population. The high expression of T cell markers in the IEL preparations, the ratios of T cell subsets characteristic of IEL. the large number of granulated lymphocytes. and the virtual absence of monocytes. macrophages. dendritic cells. or B cells in the IEL preparations confirm that minimal contamination of IEL with cells from the lamina propria or Peyer’s patches has occurred. It has been reported that enzymatic treatments may alter the functional capabilities of the isolated cells and may be detrimental to cell viability (7794% viable: Chiba et al., 1981). making the use of cells isolated by such methods unreliable during in vitro studies of effector cell functions (Chiba et al..

J.A. Krarsey, A. W. Stud&/

Journal qfImnunoiogica1

1981: Gibson et al., 198.5). The reported method uses mechanical, not enzymatic, disruption of the epithelial layer. Other popular techniques in the purification of IEL include the magnetic bead elimination of epithelial cells from the isolated lymphocyte population (Lundqvist et al., 1992). Separation of cells with magnetic beads is expensive and often inappropriate depending on the ultimate use of the isolated cells. The reliability and effectiveness of this protocol is questionable, as the post-separation population of IEL is still only 87 &- 14% leukocytes (Lundqvist et al., 1992). In a discussion of the problems of isolating and studying intestinal lymphocytes, Ebert and Roberts (1995) emphasize the importance of removing contaminating epithelial cells from IEL preparations. They state that one-step Ficoll density gradients used in many IEL purification protocols are effective in separating lymphocytes from more dense cells but not from less dense cells, such as epithelial cells. Alternatively, they recommend the use of a separating medium such as Percoll which is adjusted to various densities by dilution. so that a less dense layer removes epithelial cells and a more dense layer removes erythrocytes. The cell fractionation protocol described in this report uses a discontinuous Percoll gradient of 45% Percoll layered over 75% Percoll. As outlined by Ebert and Roberts (1995). this effectively removes both denser cells (erythrocytes) and less dense cells (epithelial cells) from the lymphocyte population. Our phenotypic observations of IEL and MLNC from adult Lewis rats agree with the findings of others in the rat (Fangmann et al., 1991; Takimoto et al.. 1992) and expand on them by characterizing the T cell repertoire by two and three color immunofluorescence. We have also examined L-selectin and 01~ integrin expression in the rat and find that the expression of these adhesion molecules is similar to what has been reported for the mouse (Chao et al., 1994; Ohtsuka et al., 1994; Tanaka et al., 1995). As previously reported for IEL from the human and mouse (Barrett et al., 1992; Fujihashi et al., 1993a,b; Yamamoto et al., 1993. 1994: Pluschke et al., 1994; Beagley et al., 1995), we find that the total rat IEL population constitutively produces mRNA for a wide range of cytokines. The diverse array of cell types

Methods 194 (1996) 35-48

41

and cytokines suggest that IEL could influence both the local immune cell and epithelial cell populations. In summary, the improved IEL isolation protocol described here is a reliable and simple method yielding IEL with high purity. As discussed, this technique minimizes the risk of contamination by sub-epithelial leukocytes, removes the epithelial layer from both the villus and crypt, efficiently separates enterocytes from lymphocytes, and avoids the use of enzymes. Use of this technique, which enables the isolation of IEL which are free of contaminants and representative of the in vivo population. would eliminate the problem of artifactual results generated by other extraction protocols.

Acknowledgements This study was supported by the Crohn’s and Colitis Foundation of Canada, and the Natural Sciences and Engineering Research Council of Canada. Dr. Stadnyk is the recipient of an IWK Children’s Hospital Research Investigatorship. The authors thank Dr. Linda Best for assistance with the flow cytometry.

References Barrett, T.A.. Gajewski. T.F.. Danielpour. D., Chang. E.B.. Beagley. K.W. and Bluestone, J.A. (1992) Differential function of intestinal intraepithelial lymphocyte subsets. J. Immunol. 149, 1124. Beagley. K.W., Fujihashi. K.. Lagoo, A.S.. Lagoo-Deenadaylan. S.. Black, C.A., Murray. A.M., Sharmanov. A.T., Yamamoto. M., McChee, J.R.. Elson, C.O. and Kiyono. H. (1995) Differences in intraepithelial lymphocyte T cell subsets isolated from murine small versus large intestine. J. Immunol. 154. 5611. Chao. C.-C., Sandor, M. and Dailey, M.O. (1994) Expression and regulation of adhesion molecules by y6 T cells from lymphoid tissues and intestinal epithelium. Eur. J. Immunol. 24, 3 180. Chiba, M.. Bartnik, W.. Remine, S.G., Thayer. W.R. and Shorter, R.G. (I 98 1) Human colonic intraepithelial and lamina proprial lymphocytes: cytotoxicity in vitro and the potential effects of the isolation method on their functional properties. Gut 22. 177. Chomczynski, P. and Sacchi. N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloreform extraction. Anal. Biochem. 162. 156. Davies, M.D.J. and Parrott. D.M.V. (1981) Preparation and purifi-

cation of lymphocytes from the epithelium and lamina propria of murine small intestine. Gut 22, 48 1. Ebert, E.C. and Roberts, AI. ( 19951 Pitfalls in the characterization of small intestinal lymphocytes. J. Immunol. Methods 178, 219. Eisenberg, S.P., Brewer. M.T., Verderber, E., Heimdal. P.. Brandhuber. B.J. and Thompson, R.C. (19911 Interleukin 1 receptor antagonist is a member of the interleukin 1 gene family: Evolution of a cytokine control mechanism. Proc. Natl. Acad. Sci. USA 88, 5232. Fangmann. J.. Schwinaer. R. and Wonigeit, K. (19911 Unusual phenotype of intestinal intraepithelial lymphocytes in the rat: predominance of T cell receptor c1 /B’/CD2cells and high expression of the RT6 alloantigen. Eur. J. Immunol. 21. 753. Fujihashi. K.. Yamamoto. M., McGhee, J.R., Beagley. K.W. and Kiyono. H. (1993a) Function of (YB TCRC intestinal intraepithelial lymphocytes: T, l- and T,2-type cytokine production by CD4+ CD8- and CD4’ CD8+ T cells for helper activity. Int. lmmunol. 5. 1473. Fujihashi, K.. Yamamoto, M., McGhee, J.R. and Kiyono, H. (1993bl oB T cell receptor-positive intraepithelial lymphocytes with CD4+. CD8 and CD4’. CD8+ phenotypes from orally immunized mice provide Th2-like function for B cell responses, J. Immunol. 15 1. 6681. Gibson, P.R., Hermanowicz. A.. Verhaar. H.J.J.. Ferguaon. D.J.P.. Bemal, A.L. and Jewell. D.P. (19851 Isolation of intestinal mononuclear cells: factors released which affect lymphocyte viability and function. Gut 26. 60. Halperin, S.A.. Issekutz, T.B. and Kasina. A. (1991) Modulation of Bordetellu prrtussis infection with monoclonal antibodies to pertussis toxin. J. Infect. Dis. 163, 355. Issekutz, T.B. and Wykretowicz, A. (19911 Effect of a new monoclonal antibody, TA-2. that inhibits lymphocyte adherence to cytokine stimulated endothelium in the rat. J. Immunol. 147, 109. Lowe. T.. Sharetkin. J.. Yang. S.Q. and Dieffenbach. C.W. t 1990) A computer program for selection of oligonucleotide primers for polymerase chain reactions. Nucleic Acids Res. 18. 1757. Lundqvist, C., Hammarstriim. M.-L.. Athlin. L. and Hammarstriim. S. (1992) Isolation of functionally active intraepithelial lymphocytes and enterocytes from human small and large intestine. J. Immunol. Methods 152, 253. Mayrhofer. G. and Whately. R.J. (19831 Granular intraepithelial lymphocytes of the rat small intestine. I. Isolation. presence in T lymphocyte-deficient rats and bone marrow origin. Int. Arch. Allergy Appl. Immunol. 7 1. 3 17.

Mosley. R.L. and Klein. J.R. (19921 A rapid method for isolating murine intestine intraepithelial lymphocytes with high yield and purity. J. Immunol. Methods 156. 19. Ohtsuka, K.. Hasegawa, K.. Sate. K., Arai. K.. Watanabe. H., Asakura, H. and Abo, T. (19941 A similar expression pattern of adhesion molecules between intermediate TCR cells in the liver and intraepithelial lymphocytes in the intestine. Microbiol. Immunol. 3X, 677. Pluschke. G., Taube. H.. Krawinkel. U.. Pfeffer. K.. Wagner, H.. Classen, M. and Deusch, K. (19941 Oligoclonality and skewed T cell receptor VB gene segment expression in in viva activated human intestinal intraepithelial T lymphocytes. Immunobiology 192. 77. Spickett. G.P.. Brandon. M.R.. Mason. D.W.. Williams. A.F. and Woollett. G.R. (1983) MRC OX-22 a monoclonal antibody that labels a new subset of T lymphocytes and reacts with the high molecular weight form of the leukocyte-common antigen. J. Exp. Med. 158. 795. Taguchi. T.. Aicher. W.K., Fujihashi. K., Yamamoto, M.. McGhee. J.R.. Bluestone. J.A. and Kiyono, H. (19911 Novel function for intestinal intraepithelial lymphocytes. Murine CD3’. yfi TCR+ T cells produce IFNy and IL-5. J. Immunol. 147. 3736. Takimoto. H.. Nakamura. T.. Takeuchi. M.. Sumi, Y.. Tanaka. T., Nomoto, K. and Yoshikai, Y. (19921 Age-associated increase intestinal intraepithelial lymphoin number of CD4+CD8* cytes in rats. Eur. J. Immunol. 22. 159. Tanaka. T.. Ohtsuka. Y.. Yagita. H.. Shiratori, Y., Omata, M. and Okumura. K. (19951 Involvement of cy, and oJ integrins in gut mucosal injury of graft-versus-host disease. Int. Immunol. 7. 1183. Yamamoto. M., Fujihashi. K.. Beagley. K.W.. McGhee. J.R. and Kiyono. H. (19931 Cytokine synthesis by intestinal intraepithelial lymphocytes: Both y / 6 T cell receptor-positive and cx /B T cell receptor-positive T cells in the G, phase of cell cycle produce IFNy and IL-5. J. Immunol. 150, 106. Yamamoto, M.. Fujihashi, K.. Amano, M.. McGhee, J.R.. Beagley. K.W. and Kiyono. H. (19941 Cytokine synthesis and apoptosis by intestinal intraepithelial lymphocytes: signaling of high density CUBT cell receptor+ and yS T cell receptorT cells via T cell receptor-CD3 complex results in interferon-y and interleukin-5 production. while low density T cells undergo DNA fragmentation. Eur. J. Immunol. 24, 1301.