Isolation and characterization of mesenchymal stem cells from the yolk sacs of bovine embryos

Theriogenology xxx (2015) 1–12

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Isolation and characterization of mesenchymal stem cells from the yolk sacs of bovine embryos C.A.F. Mançanares a, V.C. Oliveira a, L.J. Oliveira a, A.F. Carvalho b, R.V. Sampaio c, A.C.F. Mançanares c, A.F. Souza c, F. Perecin a, F.V. Meirelles a, M.A. Miglino c, C.E. Ambrósio a, * a

Department of Veterinary Medicine, Faculty of Animal Science and Food Engineering, University of São Paulo, Pirassununga, São Paulo, Brazil b Morphology Laboratory of Veterinary Medicine College, UNIFEOB, São João da Boa Vista, São Paulo, Brazil c Department of Surgery, Faculty of Veterinary Medicine and Animal Science, University of São Paulo, São Paulo, São Paulo, Brazil

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 January 2015 Received in revised form 25 May 2015 Accepted 28 May 2015

The yolk sac (YS) represents a promising source of stem cells for research because of the hematopoietic and mesenchymal cell niches that are present in this structure during the development of the embryo. In this study, we report on the isolation and characterization of YS tissue and mesenchymal stem cells (MSCs) derived from bovine YSs. Our results show that the YS is macroscopically located in the exocoelomic cavity in the ventral portion of the embryo and consists of a transparent membrane formed by a central sac-like portion and two ventrally elongated projections. Immunohistochemistry analyses were positive for OCT4, CD90, CD105, and CD44 markers in the YS of both gestational age groups. The MSCs of bovine YS were isolated using enzymatic digestion and were grown in vitro for at least 11 passages to verify their capacity to proliferate. These cells were also subjected to immunophenotypic characterization that revealed the presence of CD90, CD105, and CD79 and the absence of CD45, CD44, and CD79, which are positive and negative markers of MSCs, respectively. To prove their multipotency, the cells were induced to differentiate into three cell types, chondrocytes, osteoblasts, and adipocytes, which were stained with tissue-specific dyes (chondrogenic: Alcian Blue, osteogenic: Alizarin Red, and adipogenic: Oil Red O) to confirm differentiation. Gene expression analyses showed no differences in the patterns of gene expression between the groups or passages tested, with the exception of the expression of SOX2, which was slightly different in the G1P3 group compared to the other groups. Our results suggest that YS tissue from bovines can be used as a source of MSCs, which makes YS tissue–derived cells an interesting option for cell therapy and regenerative medicine. Ó 2015 Elsevier Inc. All rights reserved.

Keywords: Yolk sac Mesenchymal Stem cell Bovine Embryo

1. Introduction The bovine yolk sac (YS) begins its development within the first 20 days of gestation and regresses at

* Corresponding author. Tel.: þ55 (19) 35654113; fax: þ55 (19) 35611689. E-mail address: [email protected] (C.E. Ambrósio). 0093-691X/$ – see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2015.05.031

approximately 50 days of gestation. The YS is located in the exocoelomic cavity in the ventral portion of the embryo near the umbilical cord [1,2]. The YS is an extraembryonic membrane that has an important function in the initial survival of the embryo because it acts as a source of nutrition until the placenta is completely formed. Microscopically, the YSs of species, such as canines [3,4], bovines [2,5], bubalines [6], and goats [7], are extrafetal membranes that are morphologically

2

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

composed of three layers: the endoderm, an intermediate layer called the mesoderm, and a single layer called the mesothelium [8,9]. The YSs have important functions that include the production and transport of proteins that are necessary for the development of the embryo [10]; participate in the exchange of metabolites [11]; facilitate the maternal transfer of materials, such as vitamins [12], amino acids [13], and immunoglobulins [14]; participate in the formation of the first blood cells [15–18]; and are responsible for the production of germ cells, which are the precursor cells that form sperm and oocytes [16,19]. The YS is a promising source of stem cells because it contains hematopoietic [7,20,21] and mesenchymal cell niches [4] during the development of the embryo and fetus. The YS is a source of mesenchymal stem cells (MSCs) that are considered to be multipotent if they have the potential to differentiate into multiple cell lines. Mesenchymal stem cells have generated great expectations as a potential source of cells for the development of therapeutic strategies because of their intrinsic abilities to self-renew and differentiate [22]. The MSCs of YSs have been isolated from humans, and these cells have fibroblastoid morphologies, form colonies, and are immunopositive for pluripotency markers, such as OCT-4 and NANOG, and mesenchymal markers, such as CD105 (SH2), CD73 (SH3), CD29, CD44, CD166, and HLA-ABC. Moreover, these cells are negative for the hematopoietic and endothelial markers CD45, CD14, CD19, CD34, and CD31. Regarding their differentiation potential in mesodermal tissues, mesenchymal stem cells from the YS can be differentiated into osteoblasts, adipocytes, and chondrocytes [21,22]. Mesenchymal stem cells have been optimistically applied to regenerative medicine and tissue engineering. Some potential uses of MSCs include developing muscle cells, aiding liver regeneration, and forming cells in the central nervous system [23]. The study of this extrafetal membrane is crucial in preventing fetal death during the early stages of pregnancy [8]. Because the YS is a promising source of MSCs, the aim of this work was to isolate and characterize the mesenchymal cells of the bovine yolk sac (bYS-MSCs) and analyze them with respect to their expressions of specific cell surface markers with the aim of establishing an experimental model for cell therapies for the treatment of diseases.

Table 1 Estimated embryo ages of groups I and II. Groups Yolk sacs Crown–rump length (n) interval (cm)

Estimated embryonic age (days)

I II

20–34 35–50

3 3

0.3–1.4 1.5–3.1

USA), dehydrated in a series of ethanol solutions of increasing concentration (from 70%–100%), diaphonized in xylene, and embedded in Histosec embedding media. The materials were cut with a Leica RM2145 microtome into cross sections with thicknesses of 5 microns. The sections were placed on glass slides, and after drying (oven at 37  C), they were stained with hematoxylin and eosin [24]. For immunohistochemistry analyses, other samples were embedded in Tissue-Tek and frozen at 80  C. Subsequently, the blocks were cut with a Leica CM1950 cryostat into 5-micron slices and placed in previously silanized slides (3-aminopropyltriethoxysilane; Sigma) with two cuts per blade. Then, the sections were heated in citrate buffer (0.384 g of citric acid monohydrate, 2.352 g of sodium citrate tribasic dihydrate, 1-L distilled water, pH 6.0) for 15 minutes in a microwave oven. Blocking was performed by incubation in hydrogen peroxide solution at 3% in 1-M TrisHCl buffer, pH 7.5 (60.57-g TBS Tris in 500-mL ultrapure water) for 30 minutes. The sections were incubated with 10% goat serum and in Tris-buffered saline (TBS) for 30 minutes. Primary antibodies (OCT4, CD44, CD90, and CD105) were diluted to 0.2 mg/mL in TBS buffer containing 1% goat serum and incubated “overnight” in a humid chamber at 4  C. In parallel, cuts were incubated with the same concentration of irrelevant control antibody isotype (immunoglobulin G), and the sections were washed with TBS containing 1% goat serum. According to the manufacturer’s recommendation, the reaction was visualized by means of the multipurpose kit, Dako Advance HRP Link (cat. #K4069, Dako, USA). The reaction was revealed by precipitation of 3,30 -diaminobenzidine (DAB Peroxidase Substrate Kit, cat. #SK-4100). Finally, the sections were counterstained with hematoxylin, dehydrated, diaphanized, and blades mounted for analysis by light microscopy (Table 2).

2. Materials and methods 2.3. Transmission electron microscopy of the YSs 2.1. Macroscopic analysis of the YS The study protocol was approved by the research ethics committee (1.1656.74.3/2011) of the Faculty of Animal Science and Food Engineering, University of São Paulo, Brazil. The uteri were collected in a slaughterhouse and surgically examined. The embryos were analyzed and categorized into groups according to the crown rump (CR) measurements described in Table 1. 2.2. Histologic and immunohistochemistry analyses of the YS For histologic analysis, the YSs were postfixed in 4% paraformaldehyde in Dulbecco’s PBS (DPBS; Gibco Co.,

For the transmission electron microscopy (TEM) analysis, nine YS samples and six plates of the bYS-MSCs were fixed in 2.5% glutaraldehyde diluted in PBS (pH 7.4–0.1 M) for 24 hours. After fixation, the fragments and cells were washed in PBS, postfixed in osmium tetroxide (4% w/w solution in water; Polysciences, Inc., USA) for 1 hour, and finally washed in PBS. The fragments and cells were then dehydrated in increasing concentrations of ethanol (70%– 100%) using propylene oxide (EM Grade; Polysciences) as the final dehydration reagent. The samples were incubated for 12 to 16 hours in a 1:1 mixture of propylene oxide and Spurr’s resin (Spurr’s Kit; Electron Microscopy Sciences) and then incubated in 100% Spurr’s resin for an additional 4

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

3

Table 2 Primary and secondary antibodies used for the immunohistochemistry analyses of the bovine yolk sac mesenchymal stem cells. Antibody Dilution

Isotype

Catalog no.

Supplier

Specificity

Endoglin (CD105) 1:50 CD44 1:50 Thy-1 (CD90) 1:50 Oct4 1:50 Secondary antibody: Dako-advance HRP

IgG2a

sc-71042

Santa Cruz

Mouse

IgG2b

ab19622

AbCam

Horse, cow, cat, dog, human, pig

IgG

sc-6071

Santa Cruz

Human/mouse

IgG

ab18976

AbCam

Human, mouse, rat, cow, pig

K4069

Dako

Rabbit, rat

to 5 hours with constant agitation. The blocks were cut with an ultramicrotome (Ultracut R; Leica Microsystems). One-micrometer semithin sections were obtained and stained with a hot aqueous solution of 1% sodium borate in distilled water containing 0.25% toluidine blue and were subsequently subjected to TEM analyses (Morgagni 268D; FEI Company; Mega).

plate and maintained in incubators at 38.5  C. The culture medium was replaced every 2 days, with the exception of the first medium change, which was performed 24 hours after the initiation of the cell culture to remove the nonadherent cells, including the hematopoietic cells. When the cells reached 80% confluence, they were trypsinized (Tryple Express; Gibco BRL) and plated on new dishes.

2.4. Isolation and culture of the bYS-MSCs

2.5. Cell viability, colony-forming unit - fibroblast assay, and doubling time analysis of the bYS-MSCs

The YS tissue was washed in a solution of sterile PBS supplemented with 500 mg/mL of streptomycin (Gibco BRL, Grand Island, NY, USA) and 500 mg/mL of penicillin (Gibco BRL). Next, the tissue was minced with a sterile scalpel blade on a plastic dish and digested enzymatically with 0.5% collagenase IV (Sigma C2674) diluted in DMEM medium (Gibco BRL) with 100 mg/mL of streptomycin and 100 U/mL of penicillin for 1 hour at 38.5  C. The collagenase was inactivated with culture medium consisting of minimum essential, serum-free medium (alpha-MEM; Life Technologies) supplemented with a 10% defined FBS (Gibco), BME amino acid solution (50X, Sigma), MEM nonessential amino acids (100X; Sigma), B-mercaptoethanol solution (100X; Gibco), and 1% antibiotic solution (penicillin and streptomycin). The cells were plated at 3  104 cells per 25-cm2

To test the viabilities of the cells, the cells were separated into three groups at densities of 1  106 cells/cm2 and frozen. After one freeze–thaw round, the cells were stained with trypan blue (1:1; Sigma) to assess cell viability. The viable cells were counted using a hemocytometer and a Newbauer chamber. The cells were frozen for 24 hours at 80  C using Mr. Frosty (as directed by the manufacturer) and were subsequently transferred and stored in liquid nitrogen for 8 months. After freezing and thawing, the cells were counted with a hemocytometer using a Newbauer camera. After thawing, the cells were used for immunophenotyping and polymerase chain reaction (PCR) analysis. The doubling times of groups I and II were estimated with triplicate pools of cells. The pools were counted using

Table 3 Primary and secondary antibodies used for the immunophenotyping and immunofluorescence analyses of the bovine yolk sac mesenchymal stem cells. Antibody Dilution

Isotype

Catalog no.

Supplier

Specificity

Technique

Endoglin (CD105) 1:50 CD34 1:50 Thy-1 (CD90) 1:50 CD45 1:50 CD73 1:50 CD79A 1:50 CD44 1:50 Antimouse 1:300 Antirat 1:300 Antigoat 1:300

IgG2a

sc-71042

Santa Cruz

Mouse

Immunophenotyping, immnunofluorescence

IgG

sc-7045

Santa Cruz

Human/mouse

Immunophenotyping

IgG

sc-6071

Santa Cruz

Human/mouse

Immunophenotyping

IgG2a

sc-101839

Santa Cruz

Cow

Immunophenotyping

IgG

sc-14682

Santa Cruz

Human/mouse

Immunophenotyping

IgG1

sc-20064

Santa Cruz

Human

Immunophenotyping

IgG2b

ab19622

AbCam

Horse, cow, cat, dog, human, pig

Immunophenotyping, immnunofluorescence

IgG

FITC F0474

Dako

Goat

Immunophenotyping, immnunofluorescence

IgG

A21210

Invitrogen

Rabbit

Immunophenotyping, immnunofluorescence

IgG

A11075

Invitrogen

Rabbit

Immunophenotyping, immnunofluorescence

4

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

Table 4 Primer and probe sets used for the quantitative real-time polymerase chain reaction. Gene name

Accession

Primer

Sequence (50 –30 )

Bos taurus glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

NM_001034034

Bos taurus POU class 5 homeobox 1 (POU5F1)

NM_174580

Bos taurus Nanog homeobox (NANOG), mRNA

NM_001025344

Bos taurus SRY (sex determining region Y)-box 2 (SOX2), mRNA

NM_001105463

Forward Reverse Forward Reverse Forward Reverse Forward Reverse

GGCGTGAACCACGAGAAGTATAA CCCTCCACGATGCCAAAGT CAGGCCCGAAAGAGAAAGC CGGGCACTGCAGGAACA CCCTCGACACGGACACTGT GACTGTCCTGAATAAGCAGATCCA TGCGAGCGCTGCACAT TCATGAGCGTCTTGGTTTTCC

Abbreviation: mRNA, messenger RNA.

a hemocytometer. The cells (2  104) were plated on 35mm plates and maintained in incubators at 38.5  C. The cells were replated every 2 days at the same density. The doubling time was calculated using the formula Ct/Cd, where Ct represents the culture time between passage n and passage n þ 1 and Cd represents the cell doubling. Cell doubling was calculated using the formula: Cd ¼ ln(nf/ni)/ ln2, where nf represents the harvested cells and ni represents the seeded cells [25]. For the colony-forming unit - fibroblast (CFU-f) assays, 1  103 bYS-MSCs from groups I and II were plated in 90mm Petri dishes (Corning) using culture medium. Colony formation assays were performed over 15 days, and the culture medium was changed every 2 to 3 days. After 15 days, the growth medium was discarded and the adherent cells were fixed in 4% paraformaldehyde (Sigma) for 5 minutes at room temperature and stained for 30 minutes using crystal violet (Sigma) [4]. 2.6. Osteogenic, adipogenic, and chondrogenic differentiation assays All the differentiation assays were performed in triplicate at passage 3. To promote osteogenic differentiation, 3  104 cells were plated in six-well plates with StemXVivo Human/Mouse Osteogenic/Adipogenic base medium (CCM007) supplemented with a 1% (v:v) antibiotic solution (penicillin G, 10.00 U/mL, 25 mg/mL and streptomycin, 10.000 mg/mL). When approximately 60% confluence was reached, the medium was supplemented with StemXVivo Human Osteogenic Supplement (catalog no., CCM008) and changed every 2 days. Differentiation was analyzed at 24 days and after the cells were washed twice in PBS, fixed for 30 minutes in 4% paraformaldehyde, and stained with Alizarin Red (Merck). To analyze adipogenic differentiation, the cultures were incubated in StemXVivo Human/Mouse Osteogenic/Adipogenic base medium (CCM007) supplemented with a 1% (v:v) antibiotic solution (penicillin G, 10.00 U/mL, 25 mg/ mL and streptomycin, 10.000 mg/mL), and the medium was changed every 3 days. When 100% confluence was reached, the medium was supplemented with StemXVivo Adipogenic Supplement (CCM011) for 2 weeks. The cells were then stained with Oil Red O (Sigma) to detect intracellular lipid accumulation. Chondrogenic differentiation was examined with 5  105 cells in Falcon tubes with 15 mL of chondrogenic base medium (catalog number, CCM005; R&D Systems) and

penicillin–streptomycin (100:1). After 3 days, the tubes were centrifuged at 303  g (1.500 rpm) for 5 minutes, the base medium was removed, and the cell pellets were resuspended with complete chondrogenic base medium supplemented with chondrogenic supplement medium (catalog number, CCM006; 100:1; StemXVivo Human/ Mouse Chondrogenic Supplement; R&D Systems). The differentiation medium was subsequently changed every 3 days. After 21 days, the tubes were centrifuged and the chondrogenic pellets were frozen, sectioned, and stained with toluidine blue. All photomicrographic documentations of the cells were performed using an inverted Nikon MC 80 DX light microscope. 2.7. Immunophenotyping and immunofluorescence analysis For immunophenotyping, the bYS-MSCs were maintained in culture for five passages and subsequently subjected to flow cytometry analyses for an adhesion molecule (CD44), a hematopoietic and T cell marker (CD45), a lymphocyte differentiation marker (CD73) and a B-cell receptor (CD79), CD34, CD105, and CD90. A total of 1 105 cells were allocated into tubes for flow cytometry analyses for each marker. The cells were then washed with 1 mL of DPBS. The cells were incubated with primary antibodies (1:100) for 30 minutes at room temperature to analyze the expression of each cell population. After incubation, the cells were washed with 1 mL of DPBS buffer to remove excess antibody and subsequently incubated with secondary antibodies (1:300) for 30 minutes. The cells were washed with FACS buffer and fixed with a 4% buffered paraformaldehyde solution. The samples were analyzed using a flow cytometer (Attune; Applied Biosystems) equipped with two lasers (red and blue). The cell populations were estimated by evaluating the percentages of cells that expressed each of the markers relative to the total number of cells acquired. On basis of the immunofluorescence analyses, the cells were characterized by the presence of MSC-specific surface markers. The bYS-MSCs were plated on coverslips after five passages, and 2  105 cells were cultured for 2 days until the cell confluence reached at least 90%. The cells were then washed in PBS, fixed in 4% paraformaldehyde in PBS for 10 minutes at room temperature, and washed again in PBS. Next, cells were incubated in 1% BSA in PBS for 30 minutes at room temperature and overnight at 4  C with each of the antibodies (dilution: 1:100) in PBS. Cells that were incubated without primary antibodies served as negative controls for all

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

assays. The cells were then extensively washed in PBS and incubated with antibodies (1:300) for 1 hour at room temperature in the dark. The cell nuclei were stained with 10 mg/ mL of Hoechst 33342 in PBS for 8 minutes at room temperature. Finally, the cells were washed, mounted on microscope slides, and analyzed on a fluorescence microscope at  200 magnification (Nikon Eclipse TE 300; Nikon Instruments Inc., Tokyo, Japan). Negative controls were analyzed to account for secondary antibody background levels due to nonspecific cell staining. The primary and secondary antibodies used in the immunofluorescence and immunophenotyping experiments are detailed in Table 3. 2.8. Real-time polymerase chain reaction

5

remains connected to the primitive gut of the embryo in its central portion and is delimited by a unicellular endodermal layer. The YSs from the group I embryos macroscopically consisted of a transparent membrane composed of three regions formed by a central sac-like portion and two ventrally elongated projections (extremities) that extended following the allantois in a shape similar to the letter Y (Fig. 1A). The YSs from the group II embryos were in communication with the primitive gut (middle) through the yellow-colored vitelline duct. The central portion of the YS at this stage was less developed, and the extremities were shorter than those of the group I YSs (Fig. 1B). Because of the strong similarity between the cells cultured from groups I and II (25–44 days), the descriptions of the olderage groups were disregarded.

Total RNA was isolated from purified samples using a DNA/RNA Mini Kit (80204; Qiagen) according to the manufacturer’s instructions. Ribonucleic acid was quantified using UV spectrophotometry at 260 nm, and triplicates were used for each group. The cDNA High-Capacity Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) with random hexamers was used for complementary DNA synthesis, and random hexamers were used for the conversion of the total RNA into complementary DNA. Gene expression was assessed via quantitative PCR (StepOnePlus Real-Time PCR Systems; Life Technologies, Carlsbad, CA, USA). The reactions were performed using a commercial assay system (SYBR Green PCR Master Mix; Life Technologies, Carlsbad, CA, USA) with OCT4, NANOG, and SOX2 as the target genes of interest. The housekeeping gene GAPDH served as the control. The primer sequences are shown in Table 4. The reaction conditions used consisted of 40 cycles at an annealing temperature of 60  C. OCT4, NANOG, and SOX2 were quantified by normalizing the signals to the GAPDH signals using the 2DDCT method [26].

Microscopically, the YSs of the group I and II embryos were visible as structures that were divided into three layers: a single layer of endoderm that coated the vitelline cavity, a simple mesothelial layer that pointed toward the exocoelom, and an intermediate vascular mesenchymal layer. The endoderm layer was composed of endodermal cells that were supported by embryonic mesenchyme and mesothelium. These cells had circular or occasionally oval nuclei and evident nucleoli that formed small wrinkles that protruded into the light area of the YS, resulting in canalicular structures. A large number of blood vessels were present in the mesenchyme, and erythroblastic cells were present in these structures; thus, these structures were called blood or vascular islands in groups I (Fig. 1C) and II (Fig. 1D). In the immunohistochemical analysis, the two gestational age groups were both positive for OCT4, CD90, CD105, and CD44 (Fig. 2A–H).

2.9. Teratoma formation assay in nude mice

3.3. TEM analyses

The bYS-MSCs (P5) were administered by intramuscular and subcutaneous injections (1  104 cells/injection) into three immunodeficient (BALB/c-Nu) mice. Teratoma formation was evaluated every week beginning at 45 days after injection. The animals were killed, and transplanted tissues were collected for histopathology assays. Thick tissue sections were stained with hematoxylin and eosin.

In the TEM analyses of the YS tissues, large quantities of euchromatin (in the form of euchromatic nuclei) were noted, indicating that these cells exhibited high levels of protein synthesis because of the greater proportion of active DNA (euchromatin) compared to inactive DNA (heterochromatin). Mitochondria were also observed and were primarily located between the nucleus and the luminal extremities. The rough endoplasmic reticulum was distributed sparsely, and small vesicles were observed throughout the cytoplasmic region. Occasionally, intercellular spaces were observed between the epithelial cells of the endodermal YS and might have resulted from areas of fenestration of the endothelial lining (Fig. 1E, F). The TEM data were similar for the two gestational age groups.

2.10. Statistical analysis In each group, three embryos (yolk sacs) were used, and for each experiment, we used triplicates of each YS to calculate the averages of the values. For the PCR analysis, the results were analyzed using analyses of variance, and the means were compared with Duncan’s tests. The level of significance was taken as 5% (P < 0.05) for all experiments.

3.2. Histologic and immunohistochemistry analyses of the YSs

3.4. Isolation and culture of the bYS-MSCs 3. Results 3.1. Macroscopic analysis of the YS The YS is located in the exocoelomic cavity in the ventral portion of the embryo near the umbilical cord. The YS

After the mechanical and enzymatic digestion of the ventral YSs from the embryos after 20 to 34 (group I) or 35 to 50 (group II) days of gestation, the culture plates revealed populations of different cell types and the presence of vitelline tissue fragments (Fig. 3A, E). On the sixth day of

6

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

Fig. 1. Photograph of the left sides of bovine embryos. (A) Group I (Cr 0.7–1.4 cm), estimated gestational age between 24 and 26 days. (B) Group II (crown rump [Cr] 1.5–2.4 cm), estimated gestational age of 35 to 44 days. Bar ¼ 0.5 cm. The embryos are surrounded by amnion (A), and the ventral yolk sac (Vys) has a central sac-shaped portion (CYs) and two long extremities (E). Note the relationship between the primitive yolk sac and the intestine (Ip). Bar ¼ 0.5 cm. (C and D) Photomicrographs of the yolk sacs of embryos from groups I (C) and II (D). The yolk sac consists of three layers: endoderm (en), mesothelium (ms), and mesenchyme (Mq). In panel C, the blood islands (Bi) are located in the mesenchyme, lined by endothelial cells (arrow), and contain primitive blood cells, i.e., hemangioblasts (Hg); hematoxylin–eosin; Bar: 50 mm. In panel D, the canalicular structures (CL, arrow) are shown. (E and F): Transmission electron microscopy of yolk sac endodermal cells (E), a nucleus (N), and an irregularly formed apical region with microtubules (Mi). In panel F, numerous rough endoplasmic reticulum, mitochondria (Mt), nuclei (N), and vesicle (V). Bar: 5 mm.

culture, the cells formed polygonal colonies with fibroblast-like morphologies that adhered to the plastic culture surface (Fig. 3B, F), and after 10 days of culture, the cells covered the culture plate and were 90% confluent (Fig. 3C, G) under the same conditions as the primary culture. 3.5. Cell viability, CFU-f assay, and doubling time analysis of the bYS-MSCs The cell viability analysis revealed that the percentages of living cells in culture (100%) were similar, and the fresh and cryopreserved cells (Fig. 3D, H) exhibited the same morphologic features.

Regarding the CFU-f assay, the cells were maintained in culture for 15 days, and 1  103 cells were used. After this period, the group I plates had 40 colonies (Fig. 4A), and the group II the plates had 32 colonies (Fig. 4B). The numbers of cells varied across the colonies; some colonies had high cell densities with occasional overlaps between the cells, and other colonies had low cell densities. These cells had fibroblast-like morphologies, large nuclei, and sparse cytoplasms. The doubling time decreased in the passages P3 to P6, indicating a high rate of cellular proliferation; after this point, the rate of growth subsequently decreased (Fig. 4E).

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

7

Fig. 2. Immunohistochemistry analysis. Expressions of CD90, CD105, CD44, and OCT4 in the bovine yolk sacs. CD90 (A, B) exhibited broad cytoplasmic staining in the yolk sacs, whereas CD105 staining (C, D) resulted in strongly positive cells in the mesenchymal region. CD44 positive expression of yolk sac stem cells (E, F). OCT4 exhibited strong positive nuclear staining (G, H). Bar: 50 mm. En, endoderm; Mc, mesenchymal region; Ms, mesothelium.

3.6. Osteogenic, adipogenic, and chondrogenic differentiation assays The differentiation potentials of the MSCs were tested in vitro, and standard morphologic changes were observed in the cells depending on the differentiation protocol and the time of exposure. In the osteogenic differentiation medium (after 24 days of culture), the cells stopped growing and acquired polygonal morphologies with a sparse cytoplasm filling the cytoplasmic vacuoles. The majority of monolayer cultures

differentiated toward osteocytes, and the bone extracellular matrix deposition was visualized with the Alizarin Red staining (Fig. 5B, the corresponding control is shown in Fig. 5A). The adipogenic differentiation cells in culture on Day 16 exhibited birefringent granules of fat in their cytoplasm, and adipogenic differentiation was observed after approximately 20 days, as indicated by the accumulation of intracellular lipid vacuoles throughout the cytoplasm. The vacuoles stained positively for Oil Red (Fig. 5D) and were visible in the controls (Fig. 5C). The MSCs from the YSs were

8

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

Fig. 3. Cell culture. (A, B, C, and D) Bovine yolk sac mesenchymal stem cells (bYS-MSCs) from group I embryos; (E, F, G, and H) bYS-MSCs from group II embryos. The mesenchymal cells have fibroblastoid shapes. Panels A and E represent yolk sac cells (white arrow head) after mechanical and enzymatic maceration; panels B and F represent these forming colonies (arrow) after 6 days of cultivation; and panels C and G represent these cells after 20 days of culture. Note the confluence of the mesenchymal cells. Panels D and H show the cell viabilities. (D) Morphologies of the cells before thawing; (H) morphologies of cells after thawing. Bar: 5 mm.

grown in chondrogenic matrix that was rich in with toluidine blue for corresponding control is

medium for 24 days to form a proteoglycans that were stained better visualization (Fig. 5F, the shown in Fig. 5E).

3.7. Immunophenotyping and immunofluorescence To perform the characterization of the bYS-MSCs, immunophenotyping and immunofluorescence techniques were used. The immunophenotypic profiles of the revealed positivities for CD105 (11.63%), CD73 (10.70%), CD90 (22.29%), CD79 (0%), CD45 (0%), CD44 (1.72%), and CD34 (7.8%) (Fig. 6). Because the immunofluorescence technique was positive for CD105, CD90 and negative for the CD44, the cells exhibited characteristics similar to those of MSCs (Fig. 7). 3.8. Real-time polymerase chain reaction The present study aimed to compare the gene expressions of the pluripotency markers OCT4, NANOG, and SOX2 between groups I and II at two different passage numbers (P3 and P6). The passages were each separated into G1P3, G1P6, G2P3, and G2P6 groups. We identified the expressions of SOX2, OCT4, and NANOG in the bYS-MSCs in the studied passages. A comparison of the expressions of these genes revealed that there were no differences in the patterns of gene expression between the tested groups. The differences in expression between the different gestational age groups (I and II) were analyzed, and the expressions were observed to be constant, i.e., there were no differences in expression according to gestational age with the exception of a small difference in SOX2 in the G1P3 group compared to the other groups (Table 5).

Fig. 4. CFU-fs, colony forming units. (A, C) Group I, plate with 40 colonies. (B, D) Group II, plate with 32 colonies. (E) Doubling time of mesenchymal cells derived from the bovine yolk sacs (expressed as the number of days required for cell number doubling), note the high rate of cellular proliferation in the passage P3 to P6.

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

9

Fig. 5. Differentiation analyses. For each differentiation protocol, undifferentiated cells were maintained as controls (A, C, and E). The presence of bone extracellular matrix deposition is indicated by Alizarin Red staining marked by an arrow (B). Adipogenic differentiation after 20 days is indicated by the lipid droplets (inset figure with cell highlighted) stained with Oil Red (D). (F) The presence of acidic proteoglycans was observed after 1 week of chondrogenic differentiation via toluidine blue staining.

3.9. Teratoma formation in nude mice Forty-five days after the application of the cells, the animals were macroscopically examined and exhibited no teratoma formations in any of the examined regions or organs. Histopathologic analyses of the muscle, brain, lung, heart, liver, kidney, spleen, intestine, and lymph node fragments revealed no morphologic changes (Fig. 8). 4. Discussion The YS decreases in overall length over time, and in most cases, the YS disappears completely between Days

Fig. 6. Immunophenotyping analyses of cultured bovine yolk sac mesenchymal stem cells (bYS-MSCs). Positive expressions of CD73 (10.7%), CD44 (1.72%), CD105 (11.63%), CD90 (22.29%) and CD34 (7.8%) are shown, whereas 95% of the cells were negative for markers that are expressed by cells that have already differentiated (CD45 and CD79).

50 and 70. However, vestiges of the central part of this sac can still be observed during this time [2]. The YS is located in the ventral region of the embryo and is connected to the medium intestine by the vitelline duct [5,8]. The YS of the bovine embryo appears at 18 to 23 days of gestation as a trilaminate cylindrical disc consisting of trophoblast, endoderm, and mesoderm [4–6,19,27,28] and is enclosed by a unicellular endodermal layer [20]. The wall of the YS is composed of three layers: endoderm, mesoderm, and mesothelium [5,10,27–29]. This region is composed of mesenchymal cells and various blood islands that are surrounded by endothelial cells. The hypothesis that early embryonic hematopoiesis occurs in the region of the lumen of the YS blood islands and is surrounded by endothelial cells has been thoroughly discussed elsewhere [7,30,31]. In the course of embryonic development, the vascular islands group to form endothelial tubes [32]. The mesothelium, a single layer of endothelium below the mesenchymal region, has microvilli on its surface and secretory vesicles in the cytoplasmic regions, suggesting high levels of secretory activity by these cells [10,29]. In the immunophenotyping analyses, the cells were found to be immunopositive for mesenchymal stem cell markers (CD73, CD90, and CD105), and in combination with the immunofluorescence results, which were also positive for CD105, these findings agree with the descriptions in the YSs of rodents [33]; these reactions are generally characteristic of stem cells [34]. The cells were immunonegative for the CD79, CD44, and CD45 markers. CD45 and CD34 are hematopoietic stem cell markers. CD34 is a hematopoietic precursor cell marker, and the flow cytometry results were positive for CD34 in the YS cells, suggesting that the cells still had the potential to differentiate into hematopoietic lineages. A similar pattern based on CD117, which is also a hematopoietic precursor cell

10

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

Fig. 7. Immunofluorescence photomicrographs. Mesenchymal stem cells from groups I and II with estimated gestational ages of 20 to 45 days. (A and E) These cells exhibit strong positive staining for CD105 (endoglin). (B and F) These cells are negative for CD44. (C, G) Nuclear staining. (D, H) Merged images.

marker, has been reported for human ad rodent mesenchymal stem cells [33,35]. The immunohistochemistry analyses revealed that the YSs were positive for OCT4 and that the transcription factor OCT-4 POU (Pict-Oct-Unc) is related to the maintenance of the pluripotency of embryonic cells and is specifically located in the nucleus [36]. Samples of the YS progenitor mesenchymal cells from dogs [4] have been found to express OCT4 in the perinuclear region or the perinuclear and cytoplasmic regions, which is consistent with our results. OCT4 is also expressed in the

YS of the horse [37] and in other membranes, such as the amniotic membrane of humans [38]. This expression during the early stages of development indicates the maintenance of the pluripotency and self-renewal abilities of stem cells [39]. In the TEM analysis, mitochondria were observed and were primarily located between the nucleus and the luminal extremity. The rough endoplasmic reticulum was distributed sparsely, and small vesicles were observed throughout cytoplasmic region. Occasionally, the small vesicles were observed between the endodermal epithelial

Fig. 8. (A) Photograph of a mouse. (B) The sites of the injections of the mesenchymal stem cells of the yolk sac (arrow). (C) Muscles and organs of the chest and abdominal region (D). Histopathologic analyses of the liver (E and F), skin (G), muscle (H), kidney (I and J), brain (K, L, M and N), and lung (O and P).

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12 Table 5 The mean  standard deviations (SDs) for the 2DDCT values for the OCT4, NANOG, and SOX2 genes. Groups OCT4 G1P3 G1P6 G2P3 G2P6

0.544 0.144 1.510 1.024

NANOG    

0.800172 0.593395 0.359203 1.107238

1.2538 0.3372 0.0063 0.0442

SOX2    

0.11293 0.465618 0.368517 1.407634

1.1094 0.0036 0.0021 0.0072

   

0.418404 0.512237 0.131299 0.188339

cells of the YS, and these observations were possibly attributable to the fenestration areas of the endothelial covering. Our findings are in agreement with the findings from bovine YSs [5]. The bYS-MSCs were adherent to plastic and exhibited fibroblast morphologies, and these findings are similar to those based on amniotic membranes of cats [40], MSCs of canine YSs [4], and MSCs of swine YSs [41]. In this study, bYS-MSCs were cultivated in minimum essential medium, serum-free medium (alpha-MEM medium; Life Technologies), and the cells were cultivated for 11 passages. These cell populations of groups I and II exhibited similar characteristics. Morphologically, these cells exhibited fine cytoplasmic membranes and scarce cytoplasmic prolongations that varied in size and widely varied in nuclear–cytoplasmic proportion, as has been reported for bone marrow MSCs from humans [42]. The cell culture passages and medium changes were very important to reduce the volume of nonadherent cells, including hematopoietic cells, because these cells alter the culture medium of mesenchymal stem cells [43,44]. Mesenchymal stem cells are particularly relevant for therapy because of the simplicity of their isolation. The primary cultures of mesenchymal cells isolated from the YSs within 20 days were similar between the groups I and II. These cells were morphologically similar to other mesenchymal cells, including cells isolated from the same material from other species, such as dogs [4] and sheep [7], and cells isolated from other tissues, such as bone marrow [45] and umbilical cords [25], from the same species; these findings support the origin of mesenchymal stem cells. Stem cells are precursor cells that have the capacities for both self-renewal and differentiation to generate varied cell lines [3]. The pluripotency of our bYS-MSCs was confirmed by the ability of these cells to differentiate into osteocytes, chondrocytes, and adipocytes similar to the cells from the YSs of canines [4] and cat amniotic membranes [40]. Another technique is the examination of the ability of cells to form colonies similar to fibroblasts (CFU-F); this ability has been used to quantify the number of MSCs present in various tissues, although a direct relation between the number of CFU-Fs and MSCs is not clearly established, likely because of the large heterogeneities in terms of morphology, size, and differentiation potential that have been observed between species and between different culture conditions [46]. The strong tendency toward the formation of colonies with fibroblastoid morphologies observed in the present study corroborates studies of stem cells from the YSs of dogs [4] and sheep [7] and the stem cell fat of buffaloes and bovines [47].

11

Mesenchymal stem cells cannot be detected on the basis of a single protein expression marker, and consecutive single-parameter measurements for the determination of the expression patterns of various stem cell markers may suffer from artifacts because of heterogeneous cell populations [47]. The genes OCT4, NANOG, and SOX2 are important during embryonic development and the maintenance of cell pluripotency [48]; these genes were analyzed by real-time PCR and exhibited constant expressions in the YS cells of the bovine embryos across all embryonic ages. When bYS-MSCs were injected, immunodeficient (BALB/c-nu) tumors were not generated, indicating that these cells can be used for transplantation without the risk of teratoma. Treatments that have been applied to animals involving MSCs, which can mature into a wide variety of cell types, including bone and cartilage, have been shown to have anti-inflammatory and other beneficial effects [49]. Mesenchymal stem cells are ideal candidates for cell regeneration therapy because of their easy isolation, low risk of neoplasia induction, and potential for transplantation into the same or different animal species [47]. Cells derived from fetal tissue are strong candidates for veterinary regenerative medicine because they exhibit high capacities for cellular differentiation [3]. The best period for gestational isolation and culture of bYS-MSCs is between 20 and 45 days. Fetal membranes have recently been found to be abundant, ethically acceptable and easy to obtain sources of stem cells that cause minimal problems and maintain immunogenicity. Considering the importance of embryo cryopreservation, we believe that the study of these precursor cells and animal experimentation can aid in the development of future forms of cell therapy and possibly in vitro organogenesis. Acknowledgments The authors would like to thank the graduate students Juliano Rodrigues Sangalli, Rodrigo Nunes Barreto, and Lindsay Paskoski for their collaboration and technical assistance. The study was financially supported by the São Paulo Research Foundation (FAPESP; grant number: 2010/ 50395-3). References [1] Matsumoto FS, Oliveira VC, Mançanares CA, Ambrósio CE, Miglino MA. Characterization of yolk sac proteins of Bos indicus cattle embryos. Genet Mol Res 2012;4:3942–54. [2] Assis Neto AC, Oliveira FD, Constantino MVP, Miglino M. Morphology and involution of the yolk sac during early gestation bovine (Bos indicus). Act Sci Vet 2012;40:1–10. [3] Ambrósio CE, Wenceslau CV, Nogueira JL, Abreu DK, Rodrigues AF, Lessa TB, et al. Fetal membranes stem cells application in pets. Act Sci Vet 2011;55:97–101. [4] Wenceslau CV, Miglino MA, Martins DS, Ambrosio CE, Lizier NF, Pignatari GC, et al. Mesenchymal progenitor cells from canine fetal tissues: yolk sac, liver, and bone marrow. Tissue Eng Part A 2011;17: 2165–76. [5] Mançanares CA, Leiser R, Favaron PO, Carvalho AF, Oliveira VC, Santos JM, et al. A morphological analysis of the transition between the embryonic primitive intestine and yolk sac in bovine embryos and fetuses. Microsc Res Tech 2013;76:756–66.

12

C.A.F. Mançanares et al. / Theriogenology xxx (2015) 1–12

[6] Morini AC. Desenvolvimento embrionário em búfalos (Bubalus bubalis, Linnaeus, 1758). Tese de doutorado do. São Paulo, Brazil: Departamento de Cirurgia. Faculdade de Medicina Veterinária e Zootecnia. Universidade de São Paulo; 2009. p. 179. [7] Pessolato AGT, Martins DS, Galdos-Riveros A, Fontes AM, Ambrósio CE, Rici REG, et al. Microscopic aspects of the yolk sac hematopoiesis from ovine embryos. In: Méndez-Vilas A, editor. Current microscopy contributions to advances in science and technology. Badajoz, Spain: Formatex Research Center; 2002. p. 610–6. [8] Oliveira VC, Mançanares CA, Oliveira LJ, Gonçalves NJ, Miglino MA, Perecin F, et al. Characterization of putative haematopoietic cells from bovine yolk sac. J Tissue Eng Regen Med. http://dx.doi.org/10. 1002/term.2016; 2015 [Epub ahead of print]. [9] Garcia SML, Neto EJ, Fernandez CG. Embriologia. Porto Alegre: Artes Medicas Sul; 1991. [10] Pereda J. Significado morfofuncional del saco vitelino durante el periodo embrionario humano: revisión del problema e impacto en Clínica. Contribuciones Científicas y Tecnológicas Area Ciencias Medicas 2001;128:24. [11] Docherty SM, Iles RK, Wathen N, Chard T. The temporary anatomical structures prominent in the first trimester may be fulfilling exchange functions assigned to the placenta in the second and third. Hum Reprod 1996;11:1157–61. [12] Deren JJ, Padykula HA, Wilson TH. Development of structure and function in the mammalian yolk sac. The development of amino acid transport by rabbit yolk sac. Dev Biol 1966;13:370–84. [13] Lloyd JB, Willians KE, Moore AT, Beck F. Selective uptake and intracellular digestion of protein by rat yolk sac. In: Hemmings WA, editor. Maternofoetal transmission of immunoglobulins: the proceedings of a symposium on transmission of immunoglobulins from mother to young. Cambridge: Cambridge University Press; 1976. p. 169–76. [14] Brambell FWR. The passive immunity of the young mammal. Biol Rev 1958;33:488–531. [15] Tiedemann K. The amniotic, allantoic and yolk sac epithelia of the cat: SEM and TEM studies. Anat Embryol (Berl) 1979;158:75–94. [16] Björkman N. Placentation. In: Eurell JA, Frappier BL, editors. Dellmann’s textbook of veterinary histology. 1st edn. Wiley; 1958. p. 351–69. [17] Moore K, Persaud TVN. Placenta e membranas fetais, In: K. Moore (Ed), Embriologia Clínica. 6th edn. Guanabara, Rio de Janeiro, 2000, 123160 [18] Samokhvalov IM. Deconvoluting the ontogeny of hematopoietic stem cells. Cell Mol Life Sci 2014;71:957–78. [19] Wrobel KH, Suss F. Identification and temporospatial distribution of bovine primordial germ cells prior to gonadal sexual differentiation. Anat Embryol (Berl) 1998;197:451–67. [20] Palis J, Yoder MC. Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp Hematol 2001;29:927–36. [21] Wang XY, Lan Y, He WY, Zhang L, Yao HY, Hou CM, et al. Identification of mesenchymal stem cells in aorta-gonad-mesonephros and yolk sac of human embryos. Blood 2008;111:2436–43. [22] Bydlowski SP, Debes AA, Maselli LMF, Janz FL. Características biológicas das células-tronco mesenquimais. Rev Bras Hematol Hemoter 2009;31:25–35. [23] Minguell JJ, Conget P, Erices A. Biology and clinical utilization of mesenchymal progenitor cells. Braz J Med Biol Res 2000;33:881–7. [24] Tolosa EMC, Rodrigues CJ, Behmer OA, Freitas Neto AG. Manual de Técnicas para histologia normal e patológica. 2nd edn. Editora Manole, 2003, 239 [25] Raoufi MF, Tajik P, Dehghan MM, Eini F, Barin A. Isolation and differentiation of mesenchymal stem cells from bovine umbilical cord blood. Reprod Domest Anim 2011;46:95–9. [26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCT method. Methods 2001;25:402–8. [27] Assis Neto AC, Pereira FT, Santos TC, Ambrosio CE, Leiser R, Miglino MA. Morpho-physical recording of bovine conceptus (Bos indicus) and placenta from days 20 to 70 of pregnancy. Reprod Domest Anim 2010;45:760–72.

[28] Rüsse I, Sinowatz F, Richter L, Lehmann M, Schallenberger E. Die Entwicklung des Dottersackes beim Wiederkäuer (Schaf und Rind). Anat Histol Embryol 1992;21:324–47. [29] Galdos-Riveros AC, Rezende LC, Pessolato AGT, Miglino MA. A relação biológica entre o saco vitelino e o embrião. Enciclopédia Biosfera 2010;6:1–7. [30] Young PE, Baumhueter S, Lasky LA. The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development. Blood 1995;85:96–105. [31] Godin I, Cumano A. The hare and the tortoise: an embryonic haematopoietic race. Nat Rev Immunol 2002;2:593–604. [32] Sadler TW, Langman J. Langman embriología médica: con orientación clínica. Tenth edición. Madrid, Spain: Editorial Médica Panamericana; 2007. [33] Favaron PO, Mess A, Will SE, Majorka PC, Oliveira M, Miglino MA. Yolk sac mesenchymal progenitor cells from New World Mice (Necromys lasiurus) with multipotent differential potential. PLoS One 2014;9:e95575. [34] Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8:315–7. [35] Xiao-Dong N, Wei-Hua Y, Mei-Ling Z, Xiao-Yinz Z, Wei-hua Y, Ziping Z, et al. Osteogenic and neurogenic differenciation of human yolk sac mesenchymal stem cells. Chin J Pathophysiol 2005;21:636–41. [36] Vejlsted M, Offenberg H, Maddox-Hyttel P. Identification of primordial germ cells in porcine embryos from the primitive streak stage. Reprod Fertil Dev 2006;18:181–2. [37] Francioli ALR. Medicina Veterinária Regenerativa: multipotencialidade das células da membrana amniótica e do saco vitelino no modelo equino (Equus caballus, Linnaeus 1758). Tese de doutorado do. São Paulo, Brazil: Departamento de Cirurgia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo; 2012. p. 191. [38] Miki T, Lehmann T, Cai H, Stolz DB, Strom SC. Stem cells characteristics of amniotic membrane epithelial cells. Stem Cells 2005;23: 1549–59. [39] Pesce M, Scholer HR. Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells 2001;19:271–8. [40] Vidani AS, Souza AF, Sampaio RV, Bressan FF, Pierri NC, Martins DS, et al. Cat amniotic membrane multipotent cells are nontumorigenic and are safe for use in cell transplantation. Stem Cells Cloning 2014;7:71–8. [41] Bertassoli BM. Obtenção Cultivo e expansão de células-tronco do saco vitelino de suínos domésticos (Sus srofa). Dissertação de Mestrado do. Departamento de Cirurgia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo; 2012. p. 76. [42] Tagami M, Ichinose S, Yamagata K, Fujino H, Shoji S, Hiraoka M, et al. Genetic and ultrastructural demonstration of strong reversibility in human mesenchymal stem cell. Cell Tissue Res 2003;312:31–40. [43] Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, et al. International Society for Cellular. Clarification of the nomenclature for MSC: the International Society for Cellular Therapy position statement. Cytotherapy 2005;7:393–5. [44] Keating A. Mesenchymal stromal cells. Curr Opin Hematol 2006;13: 419–25. [45] Bosnakovski D, Mizuno M, Kim G, Takagi S, Okumura M, Fujinaga T. Chondrogenic differentiation of bovine bone marrow mesenchymal stem cells (MSCs) in different hydrogels: influence of collagen type II extracellular matrix on MSC chondrogenesis. Biotechnol Bioeng 2006;93:1152–63. [46] Beyer Nardi N, da Silva Meirelles LS. Mesenchymal stem cells: isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006;174:249–82. [47] Nery AA, Nascimento IC, Glaser T, Bassaneze V, Krieger JE, Ulrich H. Human mesenchymal stem cells: from immunophenotyping by flow cytometry to clinical applications. Cytometry A 2013;83:48–61. [48] Carlin R, Davis D, Weiss M, Schultz B, Troyer D. Expression of early transcription factors Oct-4, Sox-2 and Nanog by porcine umbilical cord (PUC) matrix cells. Reprod Biol Endocrinol 2006;4:8. [49] Cyranoski D. Stem cells boom in vet clinics. Nature 2013;496:148–9.