- Email: [email protected]
Isolation and characterization of microsatellite loci for the analysis of genetic diversity in Whitmania pigra
Biochemical Systematics and Ecology 51 (2013) 207–214
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Isolation and characterization of microsatellite loci for the analysis of genetic diversity in Whitmania pigra Fei Liu a, b, c, Hong-Zhuan Shi a, Qiao-Sheng Guo a, *, Tian Wang c a
Institute of Chinese Medicinal Materials, Nanjing Agricultural University, Nanjing 210095, PR China School of Chemical and Biological Engineering, Yancheng Institute of Technology, Yancheng 224051, PR China c Department of Animal Nutrition and Feed Sciences, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 July 2013 Accepted 24 August 2013 Available online 1 October 2013
The objective of this study was to isolate microsatellite loci to analyze the genetic diversity of Whitmania pigra. Four new microsatellite markers of W. pigra were developed from an enriched library and ten from a modified SAMPL assay. A total of 127 alleles were detected, with an average of 9.1 alleles per locus. The expected heterozygosity (He) of each microsatellite locus varied from 0.451 to 0.857, with an average of 0.688. The polymorphism information content (PIC) of each microsatellite locus ranged from 0.361 to 0.838, with an average of 0.640. Analysis of molecular variance showed that the main variation component existed within the populations (81.64%) rather than among the populations (18.36%). Phylogenetic tree for 15 populations of Hirudo using the NJ method by MEGA 5.1 software were divided into two major clusters. These microsatellite markers will contribute to research on the individual identification, genetic diversity, population structure, genome mapping and conservation biology of Hirudo. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Isolation Microsatellite Whitmania pigra Genetic diversity
1. Introduction Hirudo, including the Whitmania pigra Whitman, Hirudo nipponica Whitman and Whitmania acranulata Whitman species, have commonly been used as anticoagulants for thousands of years in traditional Chinese medicine. In clinical practice, these species have been used to promote blood circulation and stasis relief (2010 edition Part I). These species have also been widely used as anticoagulant medicines in Europe and the United States. However, with the rapid development of socio-economics and the deterioration of the environment, the yield of wild Hirudo production has dwindled over the years. The pharmacology, physiology and breeding of Whitmania pigra (Jin and Zhang, 2002; Shi et al., 2009, 2012; Guo et al., 2006; Liu et al., 2010), Hirudo nipponica (Nikonov et al., 1999), Hirudinaria manillensis (Zhang et al., 2008) and Hirudo medicinalis (Kasparek et al., 2000) have been studied extensively for decades, but information on the genetic diversity of the Hirudo species is limited. In particular, very little research has been performed on the genetic diversity of W. pigra (Liu et al., 2011) and other medicinal leeches (genus Hirudo), including Hirudo verbena, H. medicinalis, and Hirudo orientalis (Trontelj and Utevsky, 2012). To understand the genetic diversity of these organisms, it is necessary to employ more powerful DNA markers. PCR-based approaches are in demand because of their simplicity, as well as their requirements for only small quantities of sample DNA. Microsatellites, also known as simple sequence repeats (SSRs), are small arrays of tandemly arranged bases (one to six) spread throughout the genome. Microsatellites are of great use in molecular genetic studies, such as genetic diversity,
* Corresponding author. Tel./fax: þ86 25 84395980. E-mail addresses: [email protected], [email protected], [email protected] (Q.-S. Guo). 0305-1978/$ – see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.bse.2013.08.030
208
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
genetic mapping and marker-assisted selection, due to their high levels of polymorphisms and co-dominance (Hauswaldt and Glenn, 2003; Guyomar et al., 2006; Pettay and Lajeunesse, 2009). Microsatellites are regarded as one of the most effective markers to examine the genetic diversity within populations and the divergence between populations. These markers have shown promise in the study of the genetic structures of the Hippoglossus genus (Jackson et al., 2003), as well as the Dendrobium loddigesii Rolfe (Cai et al., 2012), Pseudosciaena polyactis species (Chen and Cheng, 2013) and Mytilus coruscus (Shen et al., 2013). Microsatellites have also been used to examine the genetic variations within species (Castro et al., 2003; Watanabe et al., 2004; Kumagai et al., 2004). There are a number of ways to locate microsatellites. First, microsatellite enrichment can be performed by hybridizing microsatellite-containing fragments with biotin-labeled probes; these probes can then be captured by magnetic beads coated with streptavidin or fixed to a nitrate filter (Edwards et al., 1996). After removing the non-hybridized DNA, the bound portion can be eluted and is highly enriched for microsatellites (Butcher et al., 2000). A second approach, selectively amplified microsatellite polymorphic loci (SAMPL), employs PCR primers that target compound microsatellites in combination with primers specific for the adapter sequences attached to DNA restriction fragments (Witsenboer et al., 1997). The SAMPL technique allows the complexity of a multi-locus microsatellite fingerprint to be tailored and is therefore the preferred method for analyzing large genomes. There have been a few attempts to isolate and characterize microsatellites from W. pigra for the genetic analysis of this species. The use of microsatellites to analyze the Hirudo genome has not yet been reported. At present, no study has been published on the development of microsatellites, and few markers have been used to examine the genetic diversity and structure of W. pigra populations. The objectives of this study were to isolate and identify microsatellites in the W. pigra genome and to detect polymorphisms using these novel microsatellites in a collection of W. pigra and H. nipponica genotypes. 2. Materials and methods 2.1. Animal materials and DNA extraction The animal materials used for the development of the microsatellites were acquired from Tongxiang (TXW) in Table 1. The animal materials used to analyze the genetic diversity in this investigation were obtained from 15 populations, which represented almost all of the natural distribution areas of the Hirudo genus in China, including W. pigra and H. nipponica (Table 1). From these populations, a total of 225 individuals were included in this study. Fresh abdominal muscle was collected from each animal and was immediately dried with silica gel. All samples were stored at 70 C until processing. Total genomic DNA was extracted using a protocol established by Sambrook and Russell (2001). The quality and quantity of the DNA were determined using 1.2% agarose gels. The DNA was then resuspended in 200 mL TE buffer, and the DNA concentration was quantified by spectrophotometry.
2.2. Microsatellite development 2.2.1. Development of microsatellite-enriched partial genomic insert libraries The (AC)n-enriched library was constructed using a variation of the microsatellite enrichment method described by Hamilton et al. (1999).
Table 1 W. pigra and H. nipponica populations used in this study. Population code
Individual code
Sample size
Location
Scientific Name
Longitude (E)
Latitude (N)
Naa
Hob
Hec
SY HS JH TXW DF TXC JR SQ GL GZ DL NJC MAS LY LA
1–15 16–30 31–45 46–60 61–75 76–90 91–105 106–120 121–135 136–150 151–165 166–180 181–195 196–210 211–225
15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
Sheyang, Jiangsu Province Hengshui, Hebei Province Jianhu, Jiangsu Province Tongxiang wild, Zhejiang Province Dafeng, Jiangsu Province Tongxiang cultivated, Zhejiang Province Jvrong, Jiangsu Province Suqian, Jiangsu Province Guilin, Guangxi Province Guangzhou, Guangdong Province Dali,Yunnan Province Nanjing cultivated, Jiangsu Province Maanshan, Anhui Province Liyang, Jiangsu Province Le’an, Jiangxi Province
Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Hirudo nipponica Hirudo nipponica Hirudo nipponica Whitmania pigra Hirudo nipponica Whitmania pigra Whitmania pigra
120.18 115.35 119.47 120.23 120.24 120.33 119.12 118.12 109.56 113.13 100.16 118.50 118.50 119.22 115.46
33.49 37.33 33.27 30.38 33.12 30.35 31.52 33.27 25.47 23.06 25.37 32.02 32.02 31.23 27.16
3.25 2.65 3.55 3.51 4.58 2.87 3.97 3.16 4.69 4.36 4.68 3.50 4.50 3.56 3.95
0.426 0.219 0.473 0.369 0.333 0.369 0.265 0.275 0.387 0.445 0.219 0.477 0.386 0.309 0.261
0.634 0.485 0.578 0.626 0.639 0.634 0.553 0.479 0.625 0.669 0.484 0.557 0.655 0.618 0.525
a b c
Na, mean number of alleles per loci. Ho, mean observed heterozygosity. He, mean expected heterozygosity.
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
209
Genomic DNA was digested with the restriction enzymes Fba I and Mbo I at 37 C overnight and the digestion was incubated at 65 C for 10 min in a water bath to inactive the enzymes. Fba I- and Mbo I-specific adapters were prepared by incubating equimolar amounts of two synthetic oligomers, oligo A (50 -TCCATTCGGCATCGCAGACA-30 ) and oligo B (50 CTAGTGTCTGCGATGCCGAATGG-30 ), at 94 C for 5 min, 60 C for 10 min and room temperature for 15 min. The digested DNA was ligated to the Fba I- and Mbo I-specific adapters by incubation with T4 DNA ligase at 4 C overnight. Polymerase chain reaction (PCR) was carried out to test the success of the ligation of the adapters to the digested DNA. The reaction was performed in a total volume of 100 mL; this reaction contained 10 mL 10 Ex Taq Buffer (Takara Biotech Co., Ltd, Dalian, China), 8 mL 2.5 mM dNTP mixture, 8 mL 0.01 mM Oligo A, 6 mL 25 mM MgCl2, 0.5 mL 5 U mL1 TaKaRa Ex Taq, and 4 mL adapter-ligated DNA. After an initial incubation at 72 C for 1 min and a denaturation step at 94 C for 4 min, 35 cycles of 94 C for 1 min, 60 C for 45 s, and 72 C for 1 min were performed, followed by a final 4 min extension at 72 C. To construct the (AC)n-enriched library, 1 mg streptavidin-coated magnetic beads (Promega Biotech Co., Ltd) was incubated with 200 pmol 30 -biotinylated (AC)15 probe in buffer (1 M NaCl, 5 mM Tris–HCl, pH 7.5, 0.5 mM EDTA) at room temperature for 30 min; the mixture was gently agitated every 10 min. To increase the quantity of the enriched DNA fragments, PCR was then carried out in a 25 mL reaction containing 2.5 mL 10 Ex Taq Buffer, 2 mL 2.5 mM dNTP mixture, 1.5 mL 25 mM MgCl2, 1 mL 0.01 mM Oligo A, 1 mL (AC)n-containing magnetic beads, and 0.5 mL 5 U mL1 TaKaRa Ex Taq. The PCR products were amplified using the following program: 94 C for 4 min, 35 cycles of 94 C for 1 min, 62 C for 1 min, and 72 C for 1 min, followed by a final extension at 72 C for 4 min. The PCR products between 150 and 1000 bp were recovered and cloned into the pGEMÒ-T Easy Vector System (Promega Biotech Co., Ltd), according to the manufacturer’s instructions. The ligation mixture was transformed into competent JM109 cells, and these cells were then plated on LB-ampicillin plates supplemented with IPTG/X-Gal to construct the (AC)n-enriched library. Individual white colonies were picked from the plates and inoculated into 96-well plates containing 100 mL LB/ampicillin in each well to construct the (AC)n-enriched working library. These plates were incubated at 37 C for 2–3 h and were then stored at 4 C until their use. A portion of the bacterial culture (20 mL) was incubated at 99 C for 5 min to lyse the bacteria and to destroy any DNases that were present. PCR was performed using the lysed bacterial culture as a template. Colony PCR was performed in 10 mL reactions containing 1 mL 10 Ex Taq Buffer, 0.8 mL 2.5 mM dNTP mixture, 0.6 mL 25 mM MgCl2, 0.4 mL 0.01 mM (AC)10 primer (50 -ACACACACACACACACACAC-30 ), 0.4 mL 0.01 mM SP6 primer, 1 mL bacterial template and 0.2 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed using the following program: 94 C for 4 min, 35 cycles of 94 C for 45 s, 53 C for 50 s, and 72 C for 1 min, followed by a final extension at 72 C for 4 min and a final incubation at 10 C for 4 min. Products from the colony PCR that ranged from 250 to 500 bp, were sequenced using the SP6-rev primer (50 -ATTTAGGTGACACTATAG-30 ), and fragments that ranged from 500 to 1000 bp were sequenced using the T7-fwd primer (50 -TAATACGACTCACTATAGGG-30 ) [Invitrogen Biotech (Shanghai) Co., China]. 2.2.2. Modified SAMPL assay The SAMPL assay was performed as described by Witsenboer et al. (1997) and Hayden and Sharp (2001). The Fba I- and Mbo I-specific adapters were prepared by incubating equimolar amounts of two synthetic oligomers in a 100 mL reaction containing 10 mL 0.1 mM AP1 oligo,10 mL 0.1 mM AP3 oligo and 10 mL 10 PCR Buffer; the reaction was incubated at 94 C for 4 min, 55 C for 2 min, and room temperature for 15 min. AP1 (50 -GTAATACGACTCACTATAGGGCA CGCGTGGTCGACGGCCCGGGCTGGTA-30 ), AP2 (50 -ACTATAGGGCACGCGTGGTC-30 ) and AP3 (50 -CTAGTACCAGCCC–NH2–30 ). Amplification of the AP1 – AP3 restriction fragments was performed in a 100 mL reaction containing 8 mL each 2.5 mM dNTP mixture, 10 mL 10 Ex Taq Buffer, 6 mL 25 mM MgCl2, 8 mL each of the AP1 and the AP3 suppressor primers (0.01 mM), 4 mL adapter-ligated DNA and 0.5 mL 5 U mL1 TaKaRa Ex Taq. PCR amplification was performed with an initial incubation at 72 C for 1 min and a denaturation step at 94 C for 4 min, followed by 35 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, and a final extension at 72 C for 4 min. Preamplification PCR was performed in a 50 mL reaction containing 4 mL each 2.5 mM dNTP mixture, 5 mL 10 Ex Taq Buffer, 3 mL 25 mM MgCl2, 4 mL 0.01 mM AP2 oligo, 2 mL each of the AP1 and the AP3 adapter primers (0.01 mM) with selective nucleotides (JB-AC: RRDKDKDACACACACACAC or JB-AG: MMBYBYBAGAGAGAGAGAG or the mixture of JB-AC and JB-AG, 2 mL of the diluted pool of amplified AP1-AP3 fragments and 0.4 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed with an initial incubation at 72 C for 1 min, followed by a denaturation step at 94 C for 4 min; this was followed by incubation at 56 C for 45 s, 72 C for 1 min, and five cycles of 94 C for 1 min, 65 C for 45 s, and 72 C for 1 min. The PCR continued for 30 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, with a final extension step at 72 C for 4 min and a final incubation at 10 C for 4 min. The 250–1000 bp PCR products were recovered as mentioned previously and were cloned into the pGEMÒ-T Easy Vector System (Promega Biotech Co., Ltd). A 10 mL reaction containing 1 mL 10 Ex Taq Buffer, 0.8 mL 2.5 mM dNTP mixture, 0.6 mL 25 mM MgCl2, 0.4 mL selective nucleotide 0.01 mM oligo (JB-AC or JB-AG), 0.4 mL 0.01 mM SP6 primer, 1 mL bacterial template and 0.2 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed with an initial incubation at 72 C for 1 min, followed by a denaturation step at 94 C for 5 min; this was followed by incubation at 56 C for 45 s, 72 C for 1 min, and five cycles of 94 C for 1 min, 65 C for 45 s, and 72 C for 1 min. The PCR continued for 30 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, with a final extension step at 72 C for 4 min and a final incubation at 10 C for 4 min. The other steps were the same as for the generation of the microsatellite-enriched partial genomic insert libraries.
210
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
2.3. Microsatellite identification and primer design To avoid vector sequence contamination, the vector sequence was removed by the VecScreen software (http://www.ncbi. nlm.nih.gov/VecScreen/VecScreen.html). Microsatellite detection was performed by the SSRIT program (http://www. gramene.org/gramene/searches/ssrtool). Only sequences containing at least 4 di-, tri-, tetra-, or penta-nucleotide repeats were selected. To identify duplicate sequences, comparisons were made using the Stand-alone BLAST program (2.2.12). The microsatellite sequences were submitted and registered to GenBank using the Sequin 7.0 program (http://www.ncbi.nlm.nih. gov/Sequin/). Primers were designed using the online Primer Premier 5.0 (http://www.Bio-soft.net) software using the following parameters: (1) a minimum of 6 dinucleotide or trinucleotide repeats, (2) a primer length of 18–24 nt with an optimal length of 20 nt, (3) a PCR product size of 90–200 bp with an optimal length of 100 bp, (4) an optimal annealing temperature between 45 and 60 C and (5) a G þ C content from 45% to 60% with 55% considered to be optimal. Primers were synthesized by Invitrogen Corp. Shanghai, China. 2.4. Amplification PCR conditions, gel electrophoresis and data analysis PCR was performed to identify polymorphic microsatellite markers, a 10 mL reaction containing 1 mL of 10 PCR Buffer, MgCl2 1.50 mM, dNTPs 0.05 mM, 0.1 mM each of forward and reverse primers, Taq DNA polymerase 0.5 U (Takara Biotech Co., Ltd, Dalian, China) and template DNA approximately 10 ng. The amplifications were performed using a thermocycler PTC 200Ô Programmable Thermal Controller (Bio-Rad, USA) for one cycle of 4 min at 94 C; 35 cycles of 1 min at 94 C, 1 min of annealing at primer specific annealing temperature, 45 s of elongation at 72 C, and a final extension at 4 min at 72 C. The PCR products were determined using 1.2% agarose gel electrophoresis. To estimate polymorphism information content (PIC) (Weir, 1996) and the number of alleles (A) were calculated using CERVUS version 3.0.3 (Kalinowski et al., 2007). Microsatellite variation, observed heterozygosity (Ho) and expected heterozygosity (He) (or gene diversity) were calculated for each microsatellite loci using Arlequin ver 3.11 (Excoffier et al., 2005). Tests for deviations from Hardy–Weinberg Equilibrium (HWE) and linkage disequilibrium (LD) were performed using Popgene version 3.2 (Yeh et al. 1999). To examine the genetic relationship of 15 populations, cluster analysis for the populations was using NJ method by Molecular Evolutionary Genetics Analysis (MEGA) software 5.1 (Tamura et al., 2011). An analysis of molecular variance (AMOVA, Michalakis and Excoffier, 1996) was used to detect the population differentiation and was calculated using the software package Arlequin ver 3.11 (Excoffier et al., 2005) with 1000 permutations and sum of squared size differences as molecular distance. 3. Results 3.1. Identification of microsatellites and primer design 3.1.1. Microsatellite-enriched partial libraries Twenty colonies were screened for inserts using the (AC)10 primer, and 12 positive colonies were sequenced. Half of the sequences that had microsatellites with more than six repeat motifs and were of an appropriate length were suitable for designing primer pairs. Of the 6 unique microsatellite repeats, only 4 were amenable to primer design. Primers could not be designed for the remaining sequences due to the lack of sufficient base pairs that met the primer design criteria or due to the biased base compositions in the flanking nucleotide sequences. Four sets of primer pairs were synthesized and checked for all the samples. PCR amplification repeatedly produced amplicons in the expected size range. All 4 of the microsatellite primer pairs generated reproducible polymorphic banding patterns (Table 2). 3.1.2. Modified SAMPL assay Thirty colonies were screened for positive inserts using the SP6 or T7 primers, and 25 positive colonies were sequenced. Approximately 60% of the sequences that had microsatellites with more than six repeat motifs and were of an appropriate length were suitable for designing primer pairs. Of the 15 unique microsatellite repeats, 11 were amenable to primer design. Eleven sets of primer pairs were synthesized and checked for all the samples. PCR amplification repeatedly produced amplicons in the expected size range. Of the 11 microsatellite primers, 10 primer sets generated reproducible polymorphic banding patterns (Table 2). Only one primer pair showed no amplification, a single band or no pronounced stutters and was excluded from further study. 3.2. Microsatellite polymorphisms in W. pigra A total of 127 alleles were detected across the 14 microsatellite loci in the 225 W. pigra samples assessed (Table 2). The number of alleles per locus ranged from 4 to 18, with an average of 9.1 alleles per locus. The expected heterozygosity (He) ranged from 0.451 to 0.857, with a mean of 0.688, and the observed heterozygosity (Ho) ranged from 0 to 0.714, with a mean of 0.348. The polymorphism information content (PIC) varied from 0.361 to 0.838, with a mean of 0.640; with the exception of a1 (PIC ¼ 0.361) and C5 (PIC ¼ 0.368), all the markers were highly informative (PIC > 0.50) and useful in genetic diversity studies. Two loci (a6, C1) deviated significantly from the other loci and the Hardy–Weinberg Equilibrium (HWE) (P < 0.05)
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
211
Table 2 Characteristics of the 15 polymorphic microsatellites markers developed for W. pigra. Marker
Primer
(A) Microsatellite-enriched partial library HZ15-1 F: GACACTAGGTCCATTCGG R: GTGTCTGCGATGCCGAAT HZ15-2 F: CCGCGGGAATTCGATTGT R: ATGCCGAATGGAGTGTCTGC HZ15-3 F: AGACACTAGGTCCATTCGG R: GTGTCTGCGATGCCGAAT HZ25 F: TTCGGCATCGCAGACACT R: TGCCGAATGGATGTCTGC (B) Modified SAMPL assay a1 F: RRDKDKDACACACACACAC R: GATCGATGAGAAGTCAAATG A6 F: RRDKDKDACACACACACAC R: TTGTGATGGCTGGTAAAT a6f F: RRDKDKDACACACACACAC R: TTTGGGGAGACGTTTTGC b1 F: MMBYBYBAGAGAGAGAGAG R: TTCCATTCCCTCCCAGAG b9 F: MMBYBYBAGAGAGAGAGAG R: GGTTAAGGCTGCGCTTCT C1f F: RRDKDKDACACACACACAC R: GTCGTTGTGATGGCTGGT C2-1 F: RRDKDKDACACACACACAC R: TTAGTGGATGAACGACCG C2-2 F: CATCGAATGACGAGATGGA R: GTTCGCGATGAATTTCAGTC C5 F: RRDKDKDACACACACACAC R: CGATAATCGACGGAGAAG C8 F: RRDKDKDACACACACACAC R: TGGATGGAGCGGTCAGAG Mean a b c d e f
Taa ( C)
Repeat motif
Allele size range
55
(TG)6
217–235
60
(TG)6
54
Ab
Hec
Hod
PICe
Accession numbers
9
0.793
0.218
0.735
EU547735
242–261
12
0.856
0.709
0.826
EU547736
(TG)6
230–245
8
0.821
0.519
0.789
EU547737
57
(TG)6
256–279
9
0.819
0.252
0.783
EU547738
49.7
(AC)6
164–173
4
0.451
0.000
0.361
EU547724
48.4
(TG)6
336–349
9
0.654
0.621
0.599
EU547725
56.4
(TG)9
171–182
6
0.611
0.165
0.521
EU547726
54.9
(GA)9
267–281
18
0.739
0.714
0.725
EU547727
55.5
(CT)6
279–301
9
0.625
0.165
0.613
EU547728
53.6
(AC)9
300–316
5
0.643
0.125
0.566
EU547729
51.6
(AC)6
216–236
5
0.627
0.235
0.594
EU547730
55.1
(ATC)7
337–341
16
0.683
0.169
0.637
EU547731
50.8
(AC)6
155–168
4
0.455
0.265
0.368
EU547732
56.7
(AC)6
244–264
13
0.857
0.708
0.838
EU547734
0.688
0.348
0.640
9.1
Ta, annealing temperature. A, number of alleles. He, expected heterozygosity. Ho, observed heterozygosity. PIC, polymorphism information content. Loci with significant deviations from the HWE.
(Table 2). No combinations of the pairwise allelic associations showed significant linkage disequilibrium (LD) values (P < 0.05). 3.3. Genetic diversity analysis The mean number of alleles across the loci, as well as the mean observed and expected heterozygosities within the 15 populations of W. pigra and H. nipponica are shown in Table 1. The highest He (0.669) was observed in the Guangzhou population, and the second highest (0.655) was observed in the Ma’anshan population. The lowest He (0.479) existed in the Suqian population. When compared among and within the 15 populations of W. pigra and H. nipponica, the AMOVA analysis showed that the main variation (81.64%) was contributed from within the population, whereas the rest of the variation (18.36%) existed among the populations (Table 3). The genetic analysis also revealed that the 15 populations formed two major groups: W. pigra and H. nipponica clustered with each other, and these results were consistent with the results found using the NJ method by MEGA 5.1 software (Fig. 1). 3.4. Characteristics of the microsatellite markers Two motif classes, di- and tri-nucleotides, were identified in this study (Table 4). Dinucleotide motifs were the most frequently found (13), and only one trinucleotide motif was detected. The three types of repeats that were observed did not include transposons or retrotransposons. No mono-, tetra- or penta-nucleotide motifs were detected. The frequencies of each repeat motif of the dinucleotide and trinucleotide repeats are shown in Table 5. 4. Discussion From the results of the two development methods, the SAMPL assay was more efficient than the enriched partial library. The key to the SAMPL method was the removal of the sequences that did not contain microsatellite sequences to avoid
212
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
Table 3 AMOVA analysis of the genetic variances within and among the populations of W. pigra and H. nipponica. Source of variation
d.f.
Sum of squares
Variation components
Total variation
Source of variation
Among populations Within populations Total
14 210 224
12.183 57.289 69.471
0.00918 0.49085 0.50003
18.36% 81.64% 100%
Among populations Within populations Total
contaminating signals. Because of how the SAMPL method worked, some microsatellite fragment loss could occur, and to avoid this, the method had to be modified so that the original sequences were not formed when the two strands annealed. To improve the SAMPL method, the short-chain 30 end was ammoniated so the juncture could not be extended during the PCR reaction. The adapter primers were designed to overlap, and the long chain did not complementarily bind to the homologous region within the short chain. Consequently, the SAMPL amplification reaction could only start from the 50 -anchored microsatellite primers, thereby ensuring that the amplified fragment contained the target microsatellite sequence. Evidently, this modification improved the SAMPL method for the development of microsatellite markers; there was no longer a need for the suppression PCR and select PCR steps (Hayden and Sharp, 2001; Lian et al., 2006), which greatly improved the coverage of the microsatellite markers. Therefore, it was convenient, economical and efficient that only one amplification could result in the retrieval of a large number of microsatellite fragments, which could then be used to clone, sequence and improve the separation efficiency of the microsatellites. In short, the SAMPL microsatellites were generated in a two-step process. First, adapter molecules of known sequence were ligated to doubly digested DNA restriction fragments; a subset of these fragments was then amplified using primers homologous to the adapter sequences. Next, subsets of the amplified DNA fragments containing microsatellites were selectively amplified and then visualized following separation on sequencing gels. The complexity of the SAMPL fingerprints could be tailored at the affinity capture step by the streptavidin-coated magnetic beads, and modifications could be made to remove a population of restriction fragments or to include additional ‘selective’ nucleotides on the 30 ends of the adapter primers that extend into the DNA fragments. The goal of obtaining large amounts of microsatellite markers is to be able to separate specific microsatellite sequences that correspond to certain phenotypes. Li and Zheng (2004) reported that the SAMPL method could increase the identification of a microsatellite-positive clone to 93%. In the present study, a modified SAMPL method was used to obtain 30 sequences, and 25 microsatellite-positive sequences were found; the rate of identification was 83.33%, which was lower than the theoretical
Fig. 1. Phylogenetic tree for 15 population of W. pigra and H. nipponia based on microsatellites using NJ method by MEGA 5.1 software.
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
213
Table 4 Summary of the different motif types per motif class observed in the W. pigra microsatellites. Repeat types
Number of motif type
SSR number
Proportion of all SSRs
Mononucleotide Dinucleotide Trinucleotide Tetranucleotide Pentanucleotide Other Total
– 2 1 – – – 3
0 13 1 0 0 0 14
0 92.86% 7.14% 0 0 0 100%
Table 5 Dinucleotide and trinucleotide motifs found in the genomic DNA of W. pigra. Repeat types
Repeat motif
Number
Proportion
Dinucleotide
AC/TG AG/TC ATC
11 2 1
78.6% 14.3% 7.1%
Trinucleotide
value of 100%. In addition, the microsatellite loci isolated in this study were not obtained by amplification protocols, which rely on designed primers and primer pairs to amplify the connected fragments. Primer pairs can be designed to obtain the corresponding site on the other side of the sequence, and the design of the second primers could allow for these microsatellite markers to be available for analysis (Lian et al., 2001, 2002, 2003, 2006). This program represents an improvement on the original scheme. In this paper, the number of alleles per locus ranged from 4 to 18, with a mean of 9.1, and the mean PIC value was 0.640. These results showed that all the markers were appropriate to use in analyzing the genetic diversity of this species. In this study, the estimated gene diversity ranged from 0.451 to 0.857, with an average value 0.688. Gene diversity (or expected heterozygosity) that ranges from 0.3 to 0.8 is useful for measuring genetic variation (Takezaki and Nei, 1999). There have been no reports on the analysis of the genetic diversity among and within populations of W. pigra. Therefore, it was also shown that the genetic diversity of the 15 Hirudo populations investigated was not relatively high, according to the detection of the microsatellite markers; the genetic diversity analysis also showed that the level of genetic structure among these populations was not high in animal. Understanding the genetic diversity of W. pigra can assist in developing strategies to conserve the diversity within this species. Microsatellite markers can be used to differentiate populations of W. pigra, and in this study, 14 novel microsatellite markers were identified that could be used to detect polymorphic patterns among all the samples. While there have been no reports of microsatellite markers in W. pigra, the polymorphic microsatellite markers in our analysis contained both dinucleotide and trinucleotide motifs. A higher mutation rate in the loci displaying short repeat motifs could account for the high rate of polymorphism (Vigouroux et al., 2002; Konishi et al., 2006). However, the number of nucleotides in the motifs that were repeated did not appear to be related to the number of polymorphisms found at that locus (Kendall, 1970). Acknowledgments This study was financially supported by the National ‘Eleventh Five-Year Plan’ Science and Technology Pillar Programme from the Ministry of Science and Technology (2006BAI06A15-9). References Butcher, P.A., Decroocq, S., Gray, Y., Moran, G.F., 2000. Development, inheritance and cross-species amplification of microsatellite markers from Acacia mangium. Theor. Appl. Genet. 101, 1282–1290. Cai, X.Y., Feng, Z.Y., Hou, B.W., Xing, W.R., Ding, X.Y., 2012. Development of microsatellite markers for genetic diversity analysis of Dendrobium loddigesii Rolfe, an endangered orchid in China. Biochem. Syst. Ecol. 43, 42–47. Castro, J., Bouza, C., Sanchez, L., Cal, R.M., Piferrer, F., Martinez, P., 2003. Gynogenesis assessment using microsatellite genetic markers in turbot (Scophthalmus maximus). Mar. Biotechnol. (NY) 5, 584–592. Chen, W.M., Cheng, Q.Q., 2013. Development of thirty-five novel polymorphic microsatellite markers in Pseudosciaena polyactis (Perciformes:Sciaenidae) and cross-species amplification in closely related species, Pseudosciaena crocea. Biochem. Syst. Ecol. 47, 111–115. Chinese Pharmacopoeia Editorial Committee, 2010. The Pharmacopoeia of the People’s Republic of China, vol. I. Chemical Industry Press, Beijing, p. 77. Edwards, K.J., Barker, J.H.A., Daly, A., Jones, C., Karp, A., 1996. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 20, 758–760. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. 1, 47–50. Guo, Q.S., Liu, F., Shi, H.Z., 2006. Residues analysis of pesticides and heavymetals in Whitmania pigra and its breeding base. Chin. J. Chin. Mat. Med. 31, 1763–1765. Guyomar, R.S., Mauger, K., Tabet-Canale, S., Martieau, C., Genet, F.K., Quillet, E., 2006. A type I and II microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) with presumptive coverage of all chromosome arms. BMC Genom. 7, 302–314.
214
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
Hamilton, M.B., Pincus, E.L., Di-Fiore, A., Fleischer, R.C., 1999. Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27 (3), 500–502, 504–507. Hauswaldt, J.S., Glenn, T.C., 2003. Microsatellite DNA loci from the Diamondback terrapin (Malaclemys terrapin). Mol. Ecol. Notes 3, 174–176. Hayden, M.J., Sharp, P.J., 2001. Targeted development of informative microsatellite (SSR) markers. Nucleic. Acids. Res. 29 (8), e44. Jackson, T.R., Martin-Robichaud, D.J., Reith, M.E., 2003. Application of DNA markers to the management of Atlantic halibut (Hippoglossus hippoglossus) broodstock. Aquaculture 220, 245–259. Jin, W.J., Zhang, R.J., 2002. Pressure sensation by an anterior pagoda neuron population distributed in multiple ganglia in the leech, Whitmania pigra. J. Comp. Physiol. A. 188, 165–171. Kalinowski, S.T., Taper, M.L., Marshall, T.C., 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 16, 1099–1106. Kasparek, M., Demirsoy, A., Akbulut, A., Akbulut, N., Çali-kan, M., Durmu, Y., 2000. Distribution and status of the medicinal leech (Hirudo medicinalis L.) in Turkey. Hydrobiologia 441, 37–44. Kendall, M.D., 1970. Rank Correlation Methods, third ed. London. Konishi, T., Iwata, H., Yashiro, K., Tsumura, Y., Ohsawa, R., Yasui, Y., Ohnishi, O., 2006. Development and characterization of microsatellite markers for common buckwheat. Breed. Sci. 56, 277–285. Kumagai, K., Barinova, A.A., Nakajima, M., Taniguchi, N., 2004. Genetic diversity between Japanese and Chinese threeline grunt (Parapristipoma trilineatum) examined by microsatellite DNA markers. Mar. Biotechnol. (NY) 6, 221–228. Li, M.F., Zheng, X.Q., 2004. Research Progress of methods of SSR primers development. Hereditas 26 (5), 769–776. Lian, C.L., Abdul-Wadud, M., Geng, Q.F., Shimatani, K., Hogetsu, T., 2006. An improved technique for isolating codominant compound microsatellite markers. J. Plant. Res. 119, 415–417. Lian, C.L., Hogetsu, T., 2002. Development of microsatellite markers in black locust (Robinia pseudoacacia) using a dual-suppression-PCR technique. Mol. Ecol. Notes 2, 211–213. Lian, C.L., Hogetsu, T., Matsushita, N., Guerin-Laguettu, A., Suzuki, K., Yamada, A., 2003. Development of microsatellite markers from an ectomycorrhizal fungus, Tricholoma matsutake, by an ISSR-suppression-PCR method. Mycorrhiza 13, 27–31. Lian, C.L., Zhou, Z.H., Hogetsu, T., 2001. A simple method for developing microsatellite markers using amplified fragments of Inter-simple sequence repeat (ISSR). J. Plant. Res. 114, 381–385. Liu, F., Guo, Q.S., Shi, H.Z., Wang, T., Lu, S.S., 2010. Comparation study on quality of different population of wild and breeding Whitmania pigra. Chin. J. Chin. Mat. Med. 35, 1280–1283. Liu, F., Shi, H.Z., Guo, Q.S., Wang, T., Lu, S.S., 2011. Analysis of genetic differentiation and phylogenetic relationship between Whitmania pigra and Hirudo nipponica based on ITS sequence. Chin. J. Chin. Mat. Med. 36, 414–419. Michalakis, Y., Excoffier, L., 1996. A generic estimation of population subdivision using distances between alleles with special reference for microsatellite loci. Genetics 142, 1061–1064. Nikonov, G.I., Titova, E.A., Seleznev, K.G., 1999. Biological activity of pharmacological properties of the anticoagulant complex (hirudin, plasma kallikrein inhibitor, prostaglandin) from the leech Hirudo medicinalis. Biull. Eksp. Biol. Med. 128, 673–676. Pettay, D.T., Lajeunesse, T.C., 2009. Microsatellite loci for assessing genetic diversity, dispersal and clonality of coral symbionts in ‘stress-tolerant’ clade D Symbiodinium. Mol. Ecol. Resour. 9, 1022–1025. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, New York, pp. 21–66. Shen, Y.B., Bai, Z.Y., Guo, S.Z., Li, J.L., 2013. Polymorphic microsatellite loci for population genetics of the hard shelled mussel, Mytilus coruscus. Conserv. Genet. Resour. 5, 121–123. Shi, H.Z., Guo, Q.S., Lu, S.S., Li, H., 2009. Qualities of Whitmania pigra in different-month-age and best harvest time. Chin. J. Chin. Mat. Med. 34 (23), 3060– 3063. Shi, H.Z., Guo, Q.S., Zhu, Z.B., Hu, T.T., Zhang, S.W., 2012. Effects of temperature and pH on digestive enzymes activities in Whitmania pigra. Chin. J. Chin. Mat. Med. 37 (17), 2538–2541. Takezaki, N., Nei, M., 1999. Genetic distances and reconstruction of phylogenetic trees from microsatellite DNA. Genetics 144, 389–399. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Trontelj, P., Utevsky, S.Y., 2012. Phylogeny and phylogeography of medicinal leeches (genus Hirudo): fast dispersal and shallow genetic structure. Mol. Phylogenet. Evol. 63, 475–485. Vigouroux, Y., Jaqueth, J.S., Matsuoka, Y., Smith, O.S., Beavis, W.D., Smith, J.S.C., Doebley, J., 2002. Rate and pattern of mutation at microsatellite loci in maize. Mol. Biol. Evol. 19, 1251–1260. Watanabe, T., Fujita, H., Yamasaki, K., Seki, S., Taniguchi, N., 2004. Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis). Mar. Biotechnol. (NY) 6, 327–334. Weir, B.S., 1996. Genetic Data Analysis II: Methods for Discrete Population Genetic Data. Sinauer, Sunderland. Witsenboer, H., Vogel, J., Michelmore, R.W., 1997. Identification, genetic localisation and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.). Genome 40, 923–936. Yeh, F.C., Yang, R.C., Boyle, T.B.J., Ye, Z.H., Mao, J.X., 1999. POPGENE 3.2: the User-friendly Shareware for Population Genetic Analysis, 3.2 ed. University of Alberta, Edmonton, Canada. Zhang, B., Lin, Q., Lin, J.D., Chu, X.L., Lu, J.Y., 2008. Effects of broodstock density and diet on reproduction and juvenile culture of the leech, Hirudinaria manillensis Lesson, 1842. Aquaculture 276, 198–204.
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Isolation and characterization of microsatellite loci for the analysis of genetic diversity in Whitmania pigra Fei Liu a, b, c, Hong-Zhuan Shi a, Qiao-Sheng Guo a, *, Tian Wang c a
Institute of Chinese Medicinal Materials, Nanjing Agricultural University, Nanjing 210095, PR China School of Chemical and Biological Engineering, Yancheng Institute of Technology, Yancheng 224051, PR China c Department of Animal Nutrition and Feed Sciences, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 July 2013 Accepted 24 August 2013 Available online 1 October 2013
The objective of this study was to isolate microsatellite loci to analyze the genetic diversity of Whitmania pigra. Four new microsatellite markers of W. pigra were developed from an enriched library and ten from a modified SAMPL assay. A total of 127 alleles were detected, with an average of 9.1 alleles per locus. The expected heterozygosity (He) of each microsatellite locus varied from 0.451 to 0.857, with an average of 0.688. The polymorphism information content (PIC) of each microsatellite locus ranged from 0.361 to 0.838, with an average of 0.640. Analysis of molecular variance showed that the main variation component existed within the populations (81.64%) rather than among the populations (18.36%). Phylogenetic tree for 15 populations of Hirudo using the NJ method by MEGA 5.1 software were divided into two major clusters. These microsatellite markers will contribute to research on the individual identification, genetic diversity, population structure, genome mapping and conservation biology of Hirudo. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Isolation Microsatellite Whitmania pigra Genetic diversity
1. Introduction Hirudo, including the Whitmania pigra Whitman, Hirudo nipponica Whitman and Whitmania acranulata Whitman species, have commonly been used as anticoagulants for thousands of years in traditional Chinese medicine. In clinical practice, these species have been used to promote blood circulation and stasis relief (2010 edition Part I). These species have also been widely used as anticoagulant medicines in Europe and the United States. However, with the rapid development of socio-economics and the deterioration of the environment, the yield of wild Hirudo production has dwindled over the years. The pharmacology, physiology and breeding of Whitmania pigra (Jin and Zhang, 2002; Shi et al., 2009, 2012; Guo et al., 2006; Liu et al., 2010), Hirudo nipponica (Nikonov et al., 1999), Hirudinaria manillensis (Zhang et al., 2008) and Hirudo medicinalis (Kasparek et al., 2000) have been studied extensively for decades, but information on the genetic diversity of the Hirudo species is limited. In particular, very little research has been performed on the genetic diversity of W. pigra (Liu et al., 2011) and other medicinal leeches (genus Hirudo), including Hirudo verbena, H. medicinalis, and Hirudo orientalis (Trontelj and Utevsky, 2012). To understand the genetic diversity of these organisms, it is necessary to employ more powerful DNA markers. PCR-based approaches are in demand because of their simplicity, as well as their requirements for only small quantities of sample DNA. Microsatellites, also known as simple sequence repeats (SSRs), are small arrays of tandemly arranged bases (one to six) spread throughout the genome. Microsatellites are of great use in molecular genetic studies, such as genetic diversity,
* Corresponding author. Tel./fax: þ86 25 84395980. E-mail addresses: [email protected], [email protected], [email protected] (Q.-S. Guo). 0305-1978/$ – see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.bse.2013.08.030
208
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
genetic mapping and marker-assisted selection, due to their high levels of polymorphisms and co-dominance (Hauswaldt and Glenn, 2003; Guyomar et al., 2006; Pettay and Lajeunesse, 2009). Microsatellites are regarded as one of the most effective markers to examine the genetic diversity within populations and the divergence between populations. These markers have shown promise in the study of the genetic structures of the Hippoglossus genus (Jackson et al., 2003), as well as the Dendrobium loddigesii Rolfe (Cai et al., 2012), Pseudosciaena polyactis species (Chen and Cheng, 2013) and Mytilus coruscus (Shen et al., 2013). Microsatellites have also been used to examine the genetic variations within species (Castro et al., 2003; Watanabe et al., 2004; Kumagai et al., 2004). There are a number of ways to locate microsatellites. First, microsatellite enrichment can be performed by hybridizing microsatellite-containing fragments with biotin-labeled probes; these probes can then be captured by magnetic beads coated with streptavidin or fixed to a nitrate filter (Edwards et al., 1996). After removing the non-hybridized DNA, the bound portion can be eluted and is highly enriched for microsatellites (Butcher et al., 2000). A second approach, selectively amplified microsatellite polymorphic loci (SAMPL), employs PCR primers that target compound microsatellites in combination with primers specific for the adapter sequences attached to DNA restriction fragments (Witsenboer et al., 1997). The SAMPL technique allows the complexity of a multi-locus microsatellite fingerprint to be tailored and is therefore the preferred method for analyzing large genomes. There have been a few attempts to isolate and characterize microsatellites from W. pigra for the genetic analysis of this species. The use of microsatellites to analyze the Hirudo genome has not yet been reported. At present, no study has been published on the development of microsatellites, and few markers have been used to examine the genetic diversity and structure of W. pigra populations. The objectives of this study were to isolate and identify microsatellites in the W. pigra genome and to detect polymorphisms using these novel microsatellites in a collection of W. pigra and H. nipponica genotypes. 2. Materials and methods 2.1. Animal materials and DNA extraction The animal materials used for the development of the microsatellites were acquired from Tongxiang (TXW) in Table 1. The animal materials used to analyze the genetic diversity in this investigation were obtained from 15 populations, which represented almost all of the natural distribution areas of the Hirudo genus in China, including W. pigra and H. nipponica (Table 1). From these populations, a total of 225 individuals were included in this study. Fresh abdominal muscle was collected from each animal and was immediately dried with silica gel. All samples were stored at 70 C until processing. Total genomic DNA was extracted using a protocol established by Sambrook and Russell (2001). The quality and quantity of the DNA were determined using 1.2% agarose gels. The DNA was then resuspended in 200 mL TE buffer, and the DNA concentration was quantified by spectrophotometry.
2.2. Microsatellite development 2.2.1. Development of microsatellite-enriched partial genomic insert libraries The (AC)n-enriched library was constructed using a variation of the microsatellite enrichment method described by Hamilton et al. (1999).
Table 1 W. pigra and H. nipponica populations used in this study. Population code
Individual code
Sample size
Location
Scientific Name
Longitude (E)
Latitude (N)
Naa
Hob
Hec
SY HS JH TXW DF TXC JR SQ GL GZ DL NJC MAS LY LA
1–15 16–30 31–45 46–60 61–75 76–90 91–105 106–120 121–135 136–150 151–165 166–180 181–195 196–210 211–225
15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
Sheyang, Jiangsu Province Hengshui, Hebei Province Jianhu, Jiangsu Province Tongxiang wild, Zhejiang Province Dafeng, Jiangsu Province Tongxiang cultivated, Zhejiang Province Jvrong, Jiangsu Province Suqian, Jiangsu Province Guilin, Guangxi Province Guangzhou, Guangdong Province Dali,Yunnan Province Nanjing cultivated, Jiangsu Province Maanshan, Anhui Province Liyang, Jiangsu Province Le’an, Jiangxi Province
Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Whitmania pigra Hirudo nipponica Hirudo nipponica Hirudo nipponica Whitmania pigra Hirudo nipponica Whitmania pigra Whitmania pigra
120.18 115.35 119.47 120.23 120.24 120.33 119.12 118.12 109.56 113.13 100.16 118.50 118.50 119.22 115.46
33.49 37.33 33.27 30.38 33.12 30.35 31.52 33.27 25.47 23.06 25.37 32.02 32.02 31.23 27.16
3.25 2.65 3.55 3.51 4.58 2.87 3.97 3.16 4.69 4.36 4.68 3.50 4.50 3.56 3.95
0.426 0.219 0.473 0.369 0.333 0.369 0.265 0.275 0.387 0.445 0.219 0.477 0.386 0.309 0.261
0.634 0.485 0.578 0.626 0.639 0.634 0.553 0.479 0.625 0.669 0.484 0.557 0.655 0.618 0.525
a b c
Na, mean number of alleles per loci. Ho, mean observed heterozygosity. He, mean expected heterozygosity.
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
209
Genomic DNA was digested with the restriction enzymes Fba I and Mbo I at 37 C overnight and the digestion was incubated at 65 C for 10 min in a water bath to inactive the enzymes. Fba I- and Mbo I-specific adapters were prepared by incubating equimolar amounts of two synthetic oligomers, oligo A (50 -TCCATTCGGCATCGCAGACA-30 ) and oligo B (50 CTAGTGTCTGCGATGCCGAATGG-30 ), at 94 C for 5 min, 60 C for 10 min and room temperature for 15 min. The digested DNA was ligated to the Fba I- and Mbo I-specific adapters by incubation with T4 DNA ligase at 4 C overnight. Polymerase chain reaction (PCR) was carried out to test the success of the ligation of the adapters to the digested DNA. The reaction was performed in a total volume of 100 mL; this reaction contained 10 mL 10 Ex Taq Buffer (Takara Biotech Co., Ltd, Dalian, China), 8 mL 2.5 mM dNTP mixture, 8 mL 0.01 mM Oligo A, 6 mL 25 mM MgCl2, 0.5 mL 5 U mL1 TaKaRa Ex Taq, and 4 mL adapter-ligated DNA. After an initial incubation at 72 C for 1 min and a denaturation step at 94 C for 4 min, 35 cycles of 94 C for 1 min, 60 C for 45 s, and 72 C for 1 min were performed, followed by a final 4 min extension at 72 C. To construct the (AC)n-enriched library, 1 mg streptavidin-coated magnetic beads (Promega Biotech Co., Ltd) was incubated with 200 pmol 30 -biotinylated (AC)15 probe in buffer (1 M NaCl, 5 mM Tris–HCl, pH 7.5, 0.5 mM EDTA) at room temperature for 30 min; the mixture was gently agitated every 10 min. To increase the quantity of the enriched DNA fragments, PCR was then carried out in a 25 mL reaction containing 2.5 mL 10 Ex Taq Buffer, 2 mL 2.5 mM dNTP mixture, 1.5 mL 25 mM MgCl2, 1 mL 0.01 mM Oligo A, 1 mL (AC)n-containing magnetic beads, and 0.5 mL 5 U mL1 TaKaRa Ex Taq. The PCR products were amplified using the following program: 94 C for 4 min, 35 cycles of 94 C for 1 min, 62 C for 1 min, and 72 C for 1 min, followed by a final extension at 72 C for 4 min. The PCR products between 150 and 1000 bp were recovered and cloned into the pGEMÒ-T Easy Vector System (Promega Biotech Co., Ltd), according to the manufacturer’s instructions. The ligation mixture was transformed into competent JM109 cells, and these cells were then plated on LB-ampicillin plates supplemented with IPTG/X-Gal to construct the (AC)n-enriched library. Individual white colonies were picked from the plates and inoculated into 96-well plates containing 100 mL LB/ampicillin in each well to construct the (AC)n-enriched working library. These plates were incubated at 37 C for 2–3 h and were then stored at 4 C until their use. A portion of the bacterial culture (20 mL) was incubated at 99 C for 5 min to lyse the bacteria and to destroy any DNases that were present. PCR was performed using the lysed bacterial culture as a template. Colony PCR was performed in 10 mL reactions containing 1 mL 10 Ex Taq Buffer, 0.8 mL 2.5 mM dNTP mixture, 0.6 mL 25 mM MgCl2, 0.4 mL 0.01 mM (AC)10 primer (50 -ACACACACACACACACACAC-30 ), 0.4 mL 0.01 mM SP6 primer, 1 mL bacterial template and 0.2 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed using the following program: 94 C for 4 min, 35 cycles of 94 C for 45 s, 53 C for 50 s, and 72 C for 1 min, followed by a final extension at 72 C for 4 min and a final incubation at 10 C for 4 min. Products from the colony PCR that ranged from 250 to 500 bp, were sequenced using the SP6-rev primer (50 -ATTTAGGTGACACTATAG-30 ), and fragments that ranged from 500 to 1000 bp were sequenced using the T7-fwd primer (50 -TAATACGACTCACTATAGGG-30 ) [Invitrogen Biotech (Shanghai) Co., China]. 2.2.2. Modified SAMPL assay The SAMPL assay was performed as described by Witsenboer et al. (1997) and Hayden and Sharp (2001). The Fba I- and Mbo I-specific adapters were prepared by incubating equimolar amounts of two synthetic oligomers in a 100 mL reaction containing 10 mL 0.1 mM AP1 oligo,10 mL 0.1 mM AP3 oligo and 10 mL 10 PCR Buffer; the reaction was incubated at 94 C for 4 min, 55 C for 2 min, and room temperature for 15 min. AP1 (50 -GTAATACGACTCACTATAGGGCA CGCGTGGTCGACGGCCCGGGCTGGTA-30 ), AP2 (50 -ACTATAGGGCACGCGTGGTC-30 ) and AP3 (50 -CTAGTACCAGCCC–NH2–30 ). Amplification of the AP1 – AP3 restriction fragments was performed in a 100 mL reaction containing 8 mL each 2.5 mM dNTP mixture, 10 mL 10 Ex Taq Buffer, 6 mL 25 mM MgCl2, 8 mL each of the AP1 and the AP3 suppressor primers (0.01 mM), 4 mL adapter-ligated DNA and 0.5 mL 5 U mL1 TaKaRa Ex Taq. PCR amplification was performed with an initial incubation at 72 C for 1 min and a denaturation step at 94 C for 4 min, followed by 35 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, and a final extension at 72 C for 4 min. Preamplification PCR was performed in a 50 mL reaction containing 4 mL each 2.5 mM dNTP mixture, 5 mL 10 Ex Taq Buffer, 3 mL 25 mM MgCl2, 4 mL 0.01 mM AP2 oligo, 2 mL each of the AP1 and the AP3 adapter primers (0.01 mM) with selective nucleotides (JB-AC: RRDKDKDACACACACACAC or JB-AG: MMBYBYBAGAGAGAGAGAG or the mixture of JB-AC and JB-AG, 2 mL of the diluted pool of amplified AP1-AP3 fragments and 0.4 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed with an initial incubation at 72 C for 1 min, followed by a denaturation step at 94 C for 4 min; this was followed by incubation at 56 C for 45 s, 72 C for 1 min, and five cycles of 94 C for 1 min, 65 C for 45 s, and 72 C for 1 min. The PCR continued for 30 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, with a final extension step at 72 C for 4 min and a final incubation at 10 C for 4 min. The 250–1000 bp PCR products were recovered as mentioned previously and were cloned into the pGEMÒ-T Easy Vector System (Promega Biotech Co., Ltd). A 10 mL reaction containing 1 mL 10 Ex Taq Buffer, 0.8 mL 2.5 mM dNTP mixture, 0.6 mL 25 mM MgCl2, 0.4 mL selective nucleotide 0.01 mM oligo (JB-AC or JB-AG), 0.4 mL 0.01 mM SP6 primer, 1 mL bacterial template and 0.2 mL 5 U mL1 TaKaRa Ex Taq. PCR was performed with an initial incubation at 72 C for 1 min, followed by a denaturation step at 94 C for 5 min; this was followed by incubation at 56 C for 45 s, 72 C for 1 min, and five cycles of 94 C for 1 min, 65 C for 45 s, and 72 C for 1 min. The PCR continued for 30 cycles of 94 C for 1 min, 56 C for 45 s, and 72 C for 1 min, with a final extension step at 72 C for 4 min and a final incubation at 10 C for 4 min. The other steps were the same as for the generation of the microsatellite-enriched partial genomic insert libraries.
210
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
2.3. Microsatellite identification and primer design To avoid vector sequence contamination, the vector sequence was removed by the VecScreen software (http://www.ncbi. nlm.nih.gov/VecScreen/VecScreen.html). Microsatellite detection was performed by the SSRIT program (http://www. gramene.org/gramene/searches/ssrtool). Only sequences containing at least 4 di-, tri-, tetra-, or penta-nucleotide repeats were selected. To identify duplicate sequences, comparisons were made using the Stand-alone BLAST program (2.2.12). The microsatellite sequences were submitted and registered to GenBank using the Sequin 7.0 program (http://www.ncbi.nlm.nih. gov/Sequin/). Primers were designed using the online Primer Premier 5.0 (http://www.Bio-soft.net) software using the following parameters: (1) a minimum of 6 dinucleotide or trinucleotide repeats, (2) a primer length of 18–24 nt with an optimal length of 20 nt, (3) a PCR product size of 90–200 bp with an optimal length of 100 bp, (4) an optimal annealing temperature between 45 and 60 C and (5) a G þ C content from 45% to 60% with 55% considered to be optimal. Primers were synthesized by Invitrogen Corp. Shanghai, China. 2.4. Amplification PCR conditions, gel electrophoresis and data analysis PCR was performed to identify polymorphic microsatellite markers, a 10 mL reaction containing 1 mL of 10 PCR Buffer, MgCl2 1.50 mM, dNTPs 0.05 mM, 0.1 mM each of forward and reverse primers, Taq DNA polymerase 0.5 U (Takara Biotech Co., Ltd, Dalian, China) and template DNA approximately 10 ng. The amplifications were performed using a thermocycler PTC 200Ô Programmable Thermal Controller (Bio-Rad, USA) for one cycle of 4 min at 94 C; 35 cycles of 1 min at 94 C, 1 min of annealing at primer specific annealing temperature, 45 s of elongation at 72 C, and a final extension at 4 min at 72 C. The PCR products were determined using 1.2% agarose gel electrophoresis. To estimate polymorphism information content (PIC) (Weir, 1996) and the number of alleles (A) were calculated using CERVUS version 3.0.3 (Kalinowski et al., 2007). Microsatellite variation, observed heterozygosity (Ho) and expected heterozygosity (He) (or gene diversity) were calculated for each microsatellite loci using Arlequin ver 3.11 (Excoffier et al., 2005). Tests for deviations from Hardy–Weinberg Equilibrium (HWE) and linkage disequilibrium (LD) were performed using Popgene version 3.2 (Yeh et al. 1999). To examine the genetic relationship of 15 populations, cluster analysis for the populations was using NJ method by Molecular Evolutionary Genetics Analysis (MEGA) software 5.1 (Tamura et al., 2011). An analysis of molecular variance (AMOVA, Michalakis and Excoffier, 1996) was used to detect the population differentiation and was calculated using the software package Arlequin ver 3.11 (Excoffier et al., 2005) with 1000 permutations and sum of squared size differences as molecular distance. 3. Results 3.1. Identification of microsatellites and primer design 3.1.1. Microsatellite-enriched partial libraries Twenty colonies were screened for inserts using the (AC)10 primer, and 12 positive colonies were sequenced. Half of the sequences that had microsatellites with more than six repeat motifs and were of an appropriate length were suitable for designing primer pairs. Of the 6 unique microsatellite repeats, only 4 were amenable to primer design. Primers could not be designed for the remaining sequences due to the lack of sufficient base pairs that met the primer design criteria or due to the biased base compositions in the flanking nucleotide sequences. Four sets of primer pairs were synthesized and checked for all the samples. PCR amplification repeatedly produced amplicons in the expected size range. All 4 of the microsatellite primer pairs generated reproducible polymorphic banding patterns (Table 2). 3.1.2. Modified SAMPL assay Thirty colonies were screened for positive inserts using the SP6 or T7 primers, and 25 positive colonies were sequenced. Approximately 60% of the sequences that had microsatellites with more than six repeat motifs and were of an appropriate length were suitable for designing primer pairs. Of the 15 unique microsatellite repeats, 11 were amenable to primer design. Eleven sets of primer pairs were synthesized and checked for all the samples. PCR amplification repeatedly produced amplicons in the expected size range. Of the 11 microsatellite primers, 10 primer sets generated reproducible polymorphic banding patterns (Table 2). Only one primer pair showed no amplification, a single band or no pronounced stutters and was excluded from further study. 3.2. Microsatellite polymorphisms in W. pigra A total of 127 alleles were detected across the 14 microsatellite loci in the 225 W. pigra samples assessed (Table 2). The number of alleles per locus ranged from 4 to 18, with an average of 9.1 alleles per locus. The expected heterozygosity (He) ranged from 0.451 to 0.857, with a mean of 0.688, and the observed heterozygosity (Ho) ranged from 0 to 0.714, with a mean of 0.348. The polymorphism information content (PIC) varied from 0.361 to 0.838, with a mean of 0.640; with the exception of a1 (PIC ¼ 0.361) and C5 (PIC ¼ 0.368), all the markers were highly informative (PIC > 0.50) and useful in genetic diversity studies. Two loci (a6, C1) deviated significantly from the other loci and the Hardy–Weinberg Equilibrium (HWE) (P < 0.05)
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
211
Table 2 Characteristics of the 15 polymorphic microsatellites markers developed for W. pigra. Marker
Primer
(A) Microsatellite-enriched partial library HZ15-1 F: GACACTAGGTCCATTCGG R: GTGTCTGCGATGCCGAAT HZ15-2 F: CCGCGGGAATTCGATTGT R: ATGCCGAATGGAGTGTCTGC HZ15-3 F: AGACACTAGGTCCATTCGG R: GTGTCTGCGATGCCGAAT HZ25 F: TTCGGCATCGCAGACACT R: TGCCGAATGGATGTCTGC (B) Modified SAMPL assay a1 F: RRDKDKDACACACACACAC R: GATCGATGAGAAGTCAAATG A6 F: RRDKDKDACACACACACAC R: TTGTGATGGCTGGTAAAT a6f F: RRDKDKDACACACACACAC R: TTTGGGGAGACGTTTTGC b1 F: MMBYBYBAGAGAGAGAGAG R: TTCCATTCCCTCCCAGAG b9 F: MMBYBYBAGAGAGAGAGAG R: GGTTAAGGCTGCGCTTCT C1f F: RRDKDKDACACACACACAC R: GTCGTTGTGATGGCTGGT C2-1 F: RRDKDKDACACACACACAC R: TTAGTGGATGAACGACCG C2-2 F: CATCGAATGACGAGATGGA R: GTTCGCGATGAATTTCAGTC C5 F: RRDKDKDACACACACACAC R: CGATAATCGACGGAGAAG C8 F: RRDKDKDACACACACACAC R: TGGATGGAGCGGTCAGAG Mean a b c d e f
Taa ( C)
Repeat motif
Allele size range
55
(TG)6
217–235
60
(TG)6
54
Ab
Hec
Hod
PICe
Accession numbers
9
0.793
0.218
0.735
EU547735
242–261
12
0.856
0.709
0.826
EU547736
(TG)6
230–245
8
0.821
0.519
0.789
EU547737
57
(TG)6
256–279
9
0.819
0.252
0.783
EU547738
49.7
(AC)6
164–173
4
0.451
0.000
0.361
EU547724
48.4
(TG)6
336–349
9
0.654
0.621
0.599
EU547725
56.4
(TG)9
171–182
6
0.611
0.165
0.521
EU547726
54.9
(GA)9
267–281
18
0.739
0.714
0.725
EU547727
55.5
(CT)6
279–301
9
0.625
0.165
0.613
EU547728
53.6
(AC)9
300–316
5
0.643
0.125
0.566
EU547729
51.6
(AC)6
216–236
5
0.627
0.235
0.594
EU547730
55.1
(ATC)7
337–341
16
0.683
0.169
0.637
EU547731
50.8
(AC)6
155–168
4
0.455
0.265
0.368
EU547732
56.7
(AC)6
244–264
13
0.857
0.708
0.838
EU547734
0.688
0.348
0.640
9.1
Ta, annealing temperature. A, number of alleles. He, expected heterozygosity. Ho, observed heterozygosity. PIC, polymorphism information content. Loci with significant deviations from the HWE.
(Table 2). No combinations of the pairwise allelic associations showed significant linkage disequilibrium (LD) values (P < 0.05). 3.3. Genetic diversity analysis The mean number of alleles across the loci, as well as the mean observed and expected heterozygosities within the 15 populations of W. pigra and H. nipponica are shown in Table 1. The highest He (0.669) was observed in the Guangzhou population, and the second highest (0.655) was observed in the Ma’anshan population. The lowest He (0.479) existed in the Suqian population. When compared among and within the 15 populations of W. pigra and H. nipponica, the AMOVA analysis showed that the main variation (81.64%) was contributed from within the population, whereas the rest of the variation (18.36%) existed among the populations (Table 3). The genetic analysis also revealed that the 15 populations formed two major groups: W. pigra and H. nipponica clustered with each other, and these results were consistent with the results found using the NJ method by MEGA 5.1 software (Fig. 1). 3.4. Characteristics of the microsatellite markers Two motif classes, di- and tri-nucleotides, were identified in this study (Table 4). Dinucleotide motifs were the most frequently found (13), and only one trinucleotide motif was detected. The three types of repeats that were observed did not include transposons or retrotransposons. No mono-, tetra- or penta-nucleotide motifs were detected. The frequencies of each repeat motif of the dinucleotide and trinucleotide repeats are shown in Table 5. 4. Discussion From the results of the two development methods, the SAMPL assay was more efficient than the enriched partial library. The key to the SAMPL method was the removal of the sequences that did not contain microsatellite sequences to avoid
212
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
Table 3 AMOVA analysis of the genetic variances within and among the populations of W. pigra and H. nipponica. Source of variation
d.f.
Sum of squares
Variation components
Total variation
Source of variation
Among populations Within populations Total
14 210 224
12.183 57.289 69.471
0.00918 0.49085 0.50003
18.36% 81.64% 100%
Among populations Within populations Total
contaminating signals. Because of how the SAMPL method worked, some microsatellite fragment loss could occur, and to avoid this, the method had to be modified so that the original sequences were not formed when the two strands annealed. To improve the SAMPL method, the short-chain 30 end was ammoniated so the juncture could not be extended during the PCR reaction. The adapter primers were designed to overlap, and the long chain did not complementarily bind to the homologous region within the short chain. Consequently, the SAMPL amplification reaction could only start from the 50 -anchored microsatellite primers, thereby ensuring that the amplified fragment contained the target microsatellite sequence. Evidently, this modification improved the SAMPL method for the development of microsatellite markers; there was no longer a need for the suppression PCR and select PCR steps (Hayden and Sharp, 2001; Lian et al., 2006), which greatly improved the coverage of the microsatellite markers. Therefore, it was convenient, economical and efficient that only one amplification could result in the retrieval of a large number of microsatellite fragments, which could then be used to clone, sequence and improve the separation efficiency of the microsatellites. In short, the SAMPL microsatellites were generated in a two-step process. First, adapter molecules of known sequence were ligated to doubly digested DNA restriction fragments; a subset of these fragments was then amplified using primers homologous to the adapter sequences. Next, subsets of the amplified DNA fragments containing microsatellites were selectively amplified and then visualized following separation on sequencing gels. The complexity of the SAMPL fingerprints could be tailored at the affinity capture step by the streptavidin-coated magnetic beads, and modifications could be made to remove a population of restriction fragments or to include additional ‘selective’ nucleotides on the 30 ends of the adapter primers that extend into the DNA fragments. The goal of obtaining large amounts of microsatellite markers is to be able to separate specific microsatellite sequences that correspond to certain phenotypes. Li and Zheng (2004) reported that the SAMPL method could increase the identification of a microsatellite-positive clone to 93%. In the present study, a modified SAMPL method was used to obtain 30 sequences, and 25 microsatellite-positive sequences were found; the rate of identification was 83.33%, which was lower than the theoretical
Fig. 1. Phylogenetic tree for 15 population of W. pigra and H. nipponia based on microsatellites using NJ method by MEGA 5.1 software.
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
213
Table 4 Summary of the different motif types per motif class observed in the W. pigra microsatellites. Repeat types
Number of motif type
SSR number
Proportion of all SSRs
Mononucleotide Dinucleotide Trinucleotide Tetranucleotide Pentanucleotide Other Total
– 2 1 – – – 3
0 13 1 0 0 0 14
0 92.86% 7.14% 0 0 0 100%
Table 5 Dinucleotide and trinucleotide motifs found in the genomic DNA of W. pigra. Repeat types
Repeat motif
Number
Proportion
Dinucleotide
AC/TG AG/TC ATC
11 2 1
78.6% 14.3% 7.1%
Trinucleotide
value of 100%. In addition, the microsatellite loci isolated in this study were not obtained by amplification protocols, which rely on designed primers and primer pairs to amplify the connected fragments. Primer pairs can be designed to obtain the corresponding site on the other side of the sequence, and the design of the second primers could allow for these microsatellite markers to be available for analysis (Lian et al., 2001, 2002, 2003, 2006). This program represents an improvement on the original scheme. In this paper, the number of alleles per locus ranged from 4 to 18, with a mean of 9.1, and the mean PIC value was 0.640. These results showed that all the markers were appropriate to use in analyzing the genetic diversity of this species. In this study, the estimated gene diversity ranged from 0.451 to 0.857, with an average value 0.688. Gene diversity (or expected heterozygosity) that ranges from 0.3 to 0.8 is useful for measuring genetic variation (Takezaki and Nei, 1999). There have been no reports on the analysis of the genetic diversity among and within populations of W. pigra. Therefore, it was also shown that the genetic diversity of the 15 Hirudo populations investigated was not relatively high, according to the detection of the microsatellite markers; the genetic diversity analysis also showed that the level of genetic structure among these populations was not high in animal. Understanding the genetic diversity of W. pigra can assist in developing strategies to conserve the diversity within this species. Microsatellite markers can be used to differentiate populations of W. pigra, and in this study, 14 novel microsatellite markers were identified that could be used to detect polymorphic patterns among all the samples. While there have been no reports of microsatellite markers in W. pigra, the polymorphic microsatellite markers in our analysis contained both dinucleotide and trinucleotide motifs. A higher mutation rate in the loci displaying short repeat motifs could account for the high rate of polymorphism (Vigouroux et al., 2002; Konishi et al., 2006). However, the number of nucleotides in the motifs that were repeated did not appear to be related to the number of polymorphisms found at that locus (Kendall, 1970). Acknowledgments This study was financially supported by the National ‘Eleventh Five-Year Plan’ Science and Technology Pillar Programme from the Ministry of Science and Technology (2006BAI06A15-9). References Butcher, P.A., Decroocq, S., Gray, Y., Moran, G.F., 2000. Development, inheritance and cross-species amplification of microsatellite markers from Acacia mangium. Theor. Appl. Genet. 101, 1282–1290. Cai, X.Y., Feng, Z.Y., Hou, B.W., Xing, W.R., Ding, X.Y., 2012. Development of microsatellite markers for genetic diversity analysis of Dendrobium loddigesii Rolfe, an endangered orchid in China. Biochem. Syst. Ecol. 43, 42–47. Castro, J., Bouza, C., Sanchez, L., Cal, R.M., Piferrer, F., Martinez, P., 2003. Gynogenesis assessment using microsatellite genetic markers in turbot (Scophthalmus maximus). Mar. Biotechnol. (NY) 5, 584–592. Chen, W.M., Cheng, Q.Q., 2013. Development of thirty-five novel polymorphic microsatellite markers in Pseudosciaena polyactis (Perciformes:Sciaenidae) and cross-species amplification in closely related species, Pseudosciaena crocea. Biochem. Syst. Ecol. 47, 111–115. Chinese Pharmacopoeia Editorial Committee, 2010. The Pharmacopoeia of the People’s Republic of China, vol. I. Chemical Industry Press, Beijing, p. 77. Edwards, K.J., Barker, J.H.A., Daly, A., Jones, C., Karp, A., 1996. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 20, 758–760. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. 1, 47–50. Guo, Q.S., Liu, F., Shi, H.Z., 2006. Residues analysis of pesticides and heavymetals in Whitmania pigra and its breeding base. Chin. J. Chin. Mat. Med. 31, 1763–1765. Guyomar, R.S., Mauger, K., Tabet-Canale, S., Martieau, C., Genet, F.K., Quillet, E., 2006. A type I and II microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) with presumptive coverage of all chromosome arms. BMC Genom. 7, 302–314.
214
F. Liu et al. / Biochemical Systematics and Ecology 51 (2013) 207–214
Hamilton, M.B., Pincus, E.L., Di-Fiore, A., Fleischer, R.C., 1999. Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27 (3), 500–502, 504–507. Hauswaldt, J.S., Glenn, T.C., 2003. Microsatellite DNA loci from the Diamondback terrapin (Malaclemys terrapin). Mol. Ecol. Notes 3, 174–176. Hayden, M.J., Sharp, P.J., 2001. Targeted development of informative microsatellite (SSR) markers. Nucleic. Acids. Res. 29 (8), e44. Jackson, T.R., Martin-Robichaud, D.J., Reith, M.E., 2003. Application of DNA markers to the management of Atlantic halibut (Hippoglossus hippoglossus) broodstock. Aquaculture 220, 245–259. Jin, W.J., Zhang, R.J., 2002. Pressure sensation by an anterior pagoda neuron population distributed in multiple ganglia in the leech, Whitmania pigra. J. Comp. Physiol. A. 188, 165–171. Kalinowski, S.T., Taper, M.L., Marshall, T.C., 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 16, 1099–1106. Kasparek, M., Demirsoy, A., Akbulut, A., Akbulut, N., Çali-kan, M., Durmu, Y., 2000. Distribution and status of the medicinal leech (Hirudo medicinalis L.) in Turkey. Hydrobiologia 441, 37–44. Kendall, M.D., 1970. Rank Correlation Methods, third ed. London. Konishi, T., Iwata, H., Yashiro, K., Tsumura, Y., Ohsawa, R., Yasui, Y., Ohnishi, O., 2006. Development and characterization of microsatellite markers for common buckwheat. Breed. Sci. 56, 277–285. Kumagai, K., Barinova, A.A., Nakajima, M., Taniguchi, N., 2004. Genetic diversity between Japanese and Chinese threeline grunt (Parapristipoma trilineatum) examined by microsatellite DNA markers. Mar. Biotechnol. (NY) 6, 221–228. Li, M.F., Zheng, X.Q., 2004. Research Progress of methods of SSR primers development. Hereditas 26 (5), 769–776. Lian, C.L., Abdul-Wadud, M., Geng, Q.F., Shimatani, K., Hogetsu, T., 2006. An improved technique for isolating codominant compound microsatellite markers. J. Plant. Res. 119, 415–417. Lian, C.L., Hogetsu, T., 2002. Development of microsatellite markers in black locust (Robinia pseudoacacia) using a dual-suppression-PCR technique. Mol. Ecol. Notes 2, 211–213. Lian, C.L., Hogetsu, T., Matsushita, N., Guerin-Laguettu, A., Suzuki, K., Yamada, A., 2003. Development of microsatellite markers from an ectomycorrhizal fungus, Tricholoma matsutake, by an ISSR-suppression-PCR method. Mycorrhiza 13, 27–31. Lian, C.L., Zhou, Z.H., Hogetsu, T., 2001. A simple method for developing microsatellite markers using amplified fragments of Inter-simple sequence repeat (ISSR). J. Plant. Res. 114, 381–385. Liu, F., Guo, Q.S., Shi, H.Z., Wang, T., Lu, S.S., 2010. Comparation study on quality of different population of wild and breeding Whitmania pigra. Chin. J. Chin. Mat. Med. 35, 1280–1283. Liu, F., Shi, H.Z., Guo, Q.S., Wang, T., Lu, S.S., 2011. Analysis of genetic differentiation and phylogenetic relationship between Whitmania pigra and Hirudo nipponica based on ITS sequence. Chin. J. Chin. Mat. Med. 36, 414–419. Michalakis, Y., Excoffier, L., 1996. A generic estimation of population subdivision using distances between alleles with special reference for microsatellite loci. Genetics 142, 1061–1064. Nikonov, G.I., Titova, E.A., Seleznev, K.G., 1999. Biological activity of pharmacological properties of the anticoagulant complex (hirudin, plasma kallikrein inhibitor, prostaglandin) from the leech Hirudo medicinalis. Biull. Eksp. Biol. Med. 128, 673–676. Pettay, D.T., Lajeunesse, T.C., 2009. Microsatellite loci for assessing genetic diversity, dispersal and clonality of coral symbionts in ‘stress-tolerant’ clade D Symbiodinium. Mol. Ecol. Resour. 9, 1022–1025. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, New York, pp. 21–66. Shen, Y.B., Bai, Z.Y., Guo, S.Z., Li, J.L., 2013. Polymorphic microsatellite loci for population genetics of the hard shelled mussel, Mytilus coruscus. Conserv. Genet. Resour. 5, 121–123. Shi, H.Z., Guo, Q.S., Lu, S.S., Li, H., 2009. Qualities of Whitmania pigra in different-month-age and best harvest time. Chin. J. Chin. Mat. Med. 34 (23), 3060– 3063. Shi, H.Z., Guo, Q.S., Zhu, Z.B., Hu, T.T., Zhang, S.W., 2012. Effects of temperature and pH on digestive enzymes activities in Whitmania pigra. Chin. J. Chin. Mat. Med. 37 (17), 2538–2541. Takezaki, N., Nei, M., 1999. Genetic distances and reconstruction of phylogenetic trees from microsatellite DNA. Genetics 144, 389–399. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Trontelj, P., Utevsky, S.Y., 2012. Phylogeny and phylogeography of medicinal leeches (genus Hirudo): fast dispersal and shallow genetic structure. Mol. Phylogenet. Evol. 63, 475–485. Vigouroux, Y., Jaqueth, J.S., Matsuoka, Y., Smith, O.S., Beavis, W.D., Smith, J.S.C., Doebley, J., 2002. Rate and pattern of mutation at microsatellite loci in maize. Mol. Biol. Evol. 19, 1251–1260. Watanabe, T., Fujita, H., Yamasaki, K., Seki, S., Taniguchi, N., 2004. Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis). Mar. Biotechnol. (NY) 6, 327–334. Weir, B.S., 1996. Genetic Data Analysis II: Methods for Discrete Population Genetic Data. Sinauer, Sunderland. Witsenboer, H., Vogel, J., Michelmore, R.W., 1997. Identification, genetic localisation and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.). Genome 40, 923–936. Yeh, F.C., Yang, R.C., Boyle, T.B.J., Ye, Z.H., Mao, J.X., 1999. POPGENE 3.2: the User-friendly Shareware for Population Genetic Analysis, 3.2 ed. University of Alberta, Edmonton, Canada. Zhang, B., Lin, Q., Lin, J.D., Chu, X.L., Lu, J.Y., 2008. Effects of broodstock density and diet on reproduction and juvenile culture of the leech, Hirudinaria manillensis Lesson, 1842. Aquaculture 276, 198–204.