Isolation and characterization of subgroup J Avian Leukosis virus associated with hemangioma in commercial Hy-Line chickens

Isolation and characterization of subgroup J Avian Leukosis virus associated with hemangioma in commercial Hy-Line chickens Fanfeng Meng,∗,†,‡,1 Qiuchen Li,∗,†,‡,1 Yubiao Zhang,∗,†,‡ Zhizhong Cui,∗,†,‡ Shuang Chang,∗,†,‡,2 and Peng Zhao∗,†,‡,2 ∗

College of Veterinary Medicine, Shandong Agricultural University, Tai’an, Shandong, China; † Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Tai’an, Shandong, China; and ‡ Shandong Provincial Engineering Technology Research Center of Animal Disease Control and Prevention, Tai’an, Shandong, China sequences in a phylogenetic-tree, which suggested that there were several genetic differences between these groups. Homology analysis of the env, pol, and gag genes of the six isolates showed that the env gene was more variable, especially the gp85 protein, which shared only 88.2–91.9% identity with the reference strains. Sequence comparisons of the gp85 protein indicated that 19 sites were different from those in the NX0101 and HPRS-103 strains inducing myeloid leukosis; among our strains, five mutations were identical to those in the viruses causing hemangioma. Four other distinctive mutations were detected in our six isolates. This study reminds us that the surveillance of viral eradication should be conducted continuously on a farm where ALVs were eradicated. To prevent the prevalence of ALVs, more attention should be paid to daily monitoring.

ABSTRACT There was an outbreak of hemangioma associated with avian leukosis virus subgroup J (ALVJ) between 2006 and 2010 in China in commercial layer chickens. Recently, severe hemangiomas broke out in Hy-Line layer chickens on a poultry farm in 2017 where ALV was eradicated earlier. Six isolates of ALVJ, named SDAU1701–SDAU1706, were characterized by virus isolation and sequence analysis of the complete proviral genomes. Avian leukosis virus subgroup J was identified by an immunofluorescence assay with monoclonal antibody JE9, whereas Marek’s disease virus or reticuloendotheliosis virus was not detected. Sequence analysis of the complete proviral genome revealed that there was 96.0–99.6% identity between each other and had a homology of 94.6–96.0% when compared with the reference strain. The six isolates formed one distinct lineage separate from the reference

Key words: Avian leukosis virus subgroup J, hemangioma, commercial Hy-Line chicken, characterization 2018 Poultry Science 0:1–8 http://dx.doi.org/10.3382/ps/pey121

INTRODUCTION

and caused enormous economic losses to the poultry industry. ALV-J was first detected in broiler chickens in 1999 in China (Cui et al., 2003); then, it was discovered in egg-type chickens, “three yellow” chickens, and other local breeds (Xu et al., 2004; Sun and Cui, 2007; Li et al., 2013). Compared to other ALVs, ALV-J primarily causes myeloid leukemia (Payne et al., 1992; Lai et al., 2011). From 2007 to 2010, hemangioma was the most hazardous neoplastic disease associated with ALV-J, which caused a massive pandemic and became a major avian health concern. During the period of the 11th and 12th Five-Year Plan, ALV infection was one of the diseases listed in the manual “National animal disease prevention and control for the medium and long term planning.” After continuous eradication, ALV has rarely happened in laying hens and broiler chickens. Moreover, ALV-J-related tumor cases became very rare in recent years. In this study, chickens with hemangioma were found to be infected with ALV-J by pathological anatomy, histological examination, molecular biological

Avian leukosis virus (ALV) is an oncogenic retrovirus causing neoplastic diseases, such as lymphocytoma, myeloid leukosis, and hemangioma, as well as immunosuppression (Fadly and Smith, 1999). The discoveries of Rous sarcoma virus, reverse transcriptase, and the Src oncogene were awarded Nobel Prizes in medicine and physiology in 1966, 1975, and 1989, respectively (Weiss and Vogt, 2011). The ALVs infecting chickens could be divided into seven subgroups, including A, B, C, D, E, J, and K (Payne and Nair, 2012; Li et al., 2016). Subgroup J avian leukosis virus (ALV-J) was first isolated and identified in 1988 in the United Kingdom (Payne et al., 1991); it has spread worldwide  C 2018 Poultry Science Association Inc. Received September 20, 2017. Accepted May 15, 2018. 1 These authors contributed equally to this work. 2 Corresponding authors: [email protected] (CS); zhaopeng@ sdau.edu.cn (ZP)

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

2

MENG ET AL.

Table 1. Primers used to amplify the proviral genomic DNA. No. 1 2 3 4 5

Name

Sequence (5 –3 )

Position corresponding to HPRS-103

Expected size (bp)

ALV-F ALV-R gag-F gag-R pol-F pol-R env-F env-R 3 UTR-F 5 UTR-R

GATGAGGCGAGCCCTCTCTTTG TGTGGTGGGAGGTAAAATGGCGT CACCACATTGGTGTGCACCTGGGT GAAGGGGCCACTGGTCAATCCACA GAGATTGTCTGCAGGGCCTAGGGCT TGGCAGCAAGGGTGTCTTCTCCG GAGGTGACTAAGAAAGATGAGGCGA CATCTCCCCCTCCCTATGCGAAAGC GGCTTCGGTTGTACGCGGATAGGA CTTCCAACGACCCTCTGAGTGCTCG

5,277–5,298 7,741–7,763 239–262 2,782–2,805 2,666–2,690 5,381–5,403 5,262–5,286 7,496–7,520 7,321–7,344 511–535

2,487

assays, and genome analysis on a Hy-Line farm where ALV was previously eradicated. Our results will be helpful for the control and prevention of ALV infections in China and serves as a warning that the monitoring of ALV is necessary after eradication.

MATERIALS AND METHODS Case History Chickens with symptoms of hemangioma were found among 180-day-old Hy-Line brown chickens on a commercial farm in Shandong Province, China. All the sick chickens had blood blisters in the feet and liver accompanied with hepatosplenomegaly, which resulted in ∼10% mortality and a lower laying rate.

Virus Isolation Blood samples were collected aseptically from the infected Hy-Line brown layer chickens with suspected hemangioma, and all blood samples were centrifuged at 2,000 revolutions per minute for 2 min at 4◦ C to obtain plasma for virus isolation. Then, single-layer DF-1 cells were infected with 80 μL adtevak when the cells grew to 70–80% density and incubated at 37◦ C with 5% CO2 for 9 days for each passage. Uninfected DF-1 cells served as negative control. The details of this procedure were previously reported (Li et al., 2013). The ALV group-specific antigen p27 in the culture supernatant was detected by an enzyme-linked immunosorbent assay (Avian Leukosis Virus Antigen Test Kit; IDEXX, USA).

Histopathological Examination The sick chickens were randomly chosen for necropsy, which showed the symptoms of hemangioma. Fresh liver tissues were collected and fixed in 10% buffered neutral formalin. The fixed tissues were dehydrated and embedded in paraffin. Paraffin-embedded slices (4 μm thick) were stained with hematoxylin and eosin (H&E) for histopathological examination as described elsewhere (Cheng et al., 2010).

2,567 2,738 2,259 606

Indirect Immunofluorescence Assay The infected cells were washed with PBS and fixed with a cold acetone–alcohol mixture (3:2) for 5 min, and then allowed to air-dry. Then, the cells were incubated with a mouse anti-ALV-J monoclonal antibody JE9 (Qin et al., 2001) at 37◦ C for 60 min, and then, incubated with goat anti-mouse IgG antibody conjugated with fluorescein isothiocyanate (Sigma, California, USA) at 37◦ C for another 60 min. Finally, the cells were observed under a fluorescence microscope.

Primers A pair of universal primers (ALV-F/R) was designed and synthesized to detect exogenous ALVs (Table 1). Two pairs of primers were used to detect Marek’s disease virus (Ding et al., 2007) and reticuloendotheliosis virus (Ji et al., 2001) according to the previously published reports. After that, four pairs of primers were designed based on the conserved regions among different subgroups of ALVs to amplify the full-length proviral genome of ALV-J (Table 1).

Genomic-DNA Extraction and PCR Amplification The DNA samples were extracted from the DF-1 cells infected with ALV-J by means of a DNA Extraction Kit (TAKARA, Dalian, China). Then, PCR amplification was conducted with different primers using provirus DNA samples as templates. The amplification of the gene was set up in a 50-μL reaction mixture containing 1 μL DNA, 5 μL 10× Taq buffer, 4 μL dNTPs (100 μmol/L), 1 μL each primer (2.5 pmoL/μL), and 38 μL double-distilled H2 O. The conditions for PCR with primers ALV-F/R were as follows: 95◦ C for 5 min; followed by 31 cycles of 95◦ C for 50 s, 55◦ C for 40 s, and 72◦ C for 140 s; with a final elongation step of 10 min at 72◦ C. The PCR product was analyzed by electrophoresis in 0.8% agarose in Tris-acetate-EDTA buffer. The gel-purified PCR products were cloned into the pMD18T vector (TAKARA, Dalian, China) and transfected into DH5α Escherichia coli competent cells. Positive clones were confirmed by the bacterial PCR and subjected to Sanger sequencing (BGI, Shenzhen, China).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

3

HEMANGIOMA REOCCURED IN THE LAYER HENS Table 2. The ALV-J reference strains used in this study. Strains

Year

Country

Host

Tumor type

Length (bp)

Genbank No.

NHH GD1109 HLJ09MDJ-1 SCDY1 JL09JL3-1 SD09DP03 JS09GY3 NX0101 HPRS-103 SDAU1701 SDAU1702 SDAU1703 SDAU1704 SDAU1705 SDAU1706

2007 2011 2009 2009 2009 2009 2009 1999 1988 2017 2017 2017 2017 2017 2017

China China China China China China China China USA China China China China China China

Commercial layer Commercial layer Hy-Line layer Grandparent breed Commercial layer Commercial layer Commercial layer Meat-type chicken Meat-type chicken Hy-Line layer Hy-Line layer Hy-Line layer Hy-Line layer Hy-Line layer Hy-Line layer

He He He He He He He and ML ML ML He He He He He He

7,607 7,653 7,670 7,489 7,670 7,633 7,663 7,688 7,841 7,630 7,610 7,630 7,612 7,629 7,629

HM235668 JX254901 JN624878 HQ425636 JN624878 JN624880 GU982308 DQ115805 Z46390 KY980657 KY980658 KY980659 KY980660 KY980661 KY980662

Sequence Analysis Sequence alignments were assembled with other ALV-J referential sequences retrieved from the National Center for Biotechnology Information database. The editing of nucleotide sequence was carried out by the Clustal Method in the MegAlign program of the DNAStar software package, ver. 7.01 (DNAStar Inc., Madison, WI). Phylogenetic analysis was based on the neighborjoining method with 500 bootstrap replicates by MEGA ver. 5.1 (Tamura et al., 2007). The GenBank accession numbers of the strains used in this study are listed in Table 2.

Ethics Statement The study protocol and all animal experiments were approved by the Shandong Agricultural University Institutional Animal Care and Use Committee.

RESULTS Clinical Features and Histopathology The sick chickens showed symptoms of hemangioma during the autopsy, such as hepatomegaly with dark red blood blisters, toe joint swelling with blood bags, splenomegaly, and ovarian dysplasia (Figures 1A–1C). Histopathological examination revealed a large number hyperplasia of eosinophils and overabundance of red blood cells (Figures 1D and 1E), which are the pathognomonic signs of hemangioma.

Isolation and Identification of the Virus Based on the clinical features, six plasma samples from the sick chickens were collected for virus isolation in DF-1 cells. No microscopically visible cytopathic effects were detected in the infected DF-1 cells. After three serial cell passages, the culture supernatants were tested for the p27 antigen by a commercial enzymelinked immunosorbent assay kit, which were positive.

The infected cells were detected by immunofluorescence assay using ALV-J-specific monoclonal antibody JE9; the results found many positive cells with cytoplasmic staining, while the nucleus without staining (Figures 2A and 2B). Furthermore, genomic RNA was extracted from samples positive for the p27 antigen and was amplified by RT-PCR with the ALV-specific universal primers, and only ALV could be amplified; no PCR products were obtained with primers specific for Marek’s disease virus and reticuloendotheliosis virus (Figure 2C). Sequence analysis revealed that the viruses from the six sick chickens carried highly homologous sequences to those of the ALV-J reference sequences. Therefore, the six viruses were isolated and identified as ALV-J and named SDAU1701–SDAU1706.

Sequence Analysis of the Proviral Genomes of Isolates SDAU1701–SDAU1706 The proviral genomes were amplified and had a full length of 7610–7630 nt (Table 2). The gp85 protein of the six isolates shared at least 87.7% amino acid sequence identity with the referential ALV-J strains retrieved from National Center for Biotechnology Information and showed ∼40% identity to the referential strains of ALV-A/B. Comparisons of the major structural genes with the ALV-J referential strains revealed that the LTR region and gag and pol genes of the six isolates were well conserved, sharing 89.2–97.7% nucleotide identity and 94.6–98.6% amino acid identity. Nonetheless, the env gene was found to be much more variable: the isolates shared only 90.2–93.0% nucleotide sequence identity and 88.2–91.9% amino acid sequence identity on the gp85 protein with one another (Table 3). Furthermore, the amino acid sequences of gp85 from the six strains were compared with nine referential strains, where 19 amino acid positions were found to be different from the sequences of NX0101 and HPRS-103 strains, which can induce myeloid leukosis. Among these amino acid sites, the mutations at 21st, 47th, 143rd, 206th, and 239th positions were identical to those strains inducing hemangioma, especially

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

4

MENG ET AL.

(A)

(B)

(C)

(D)

Figure 1. Lesions and histopathology analysis caused by ALV-J in Hy-Line chicken flocks.

in SDAU1702, SDAU1703, SDAU1704, and SDAU1705 (Figure 3).

Phylogenetic Relations Between Strains SDAU1701–SDAU1706 and other ALV-J strains The results of phylogenetic analysis of env, gp85, gp37, and LTR sequences of strains SDAU1701– SDAU1706 and 9 ALV-J referential strains indicated that the six newly isolated strains formed a new cluster, which was closely related to the isolates causing hemangioma and far from NX0101 and HPRS-103 that can induce a myeloid tumor (Figure 4).

Recombination Analysis The recombination events in the complete proviral genomes were analyzed by RDP4, and several potential recombination events in ENV gene were detected, including two events in SDAU1701, and one in SDAU1702, which were supported by Bootscan (Figures 5A–5C) and ten other methods. All these events can be divided into three groups, named SDAU09C2 (ALV-B) and RSV-D (ALV-D), RSA-A (ALV-A) and EV-3 (ALV-E), SDAU1703 (ALV-J) and

HN0001 (ALV-J) (Figure 5D). The above results suggest that the isolates are recombinant isolates.

DISCUSSION RNA viruses have high mutational rates because of the lack of correction mechanism, so a viral population named quasispecies was formed (Bai et al., 1995; Smith et al., 1999; Silva et al., 2000). In China, there are many kinds of chickens infected with different serotypes of ALV, including A, B, J, and K (Payne and Nair, 2012; Li et al., 2016). Among them, ALV-J causes severe damages to the poultry industry (Xu et al., 2004; Sun and Cui, 2007; Pan et al., 2012; Li et al., 2013). ALV-J was first isolated in 1988 from white-meat-type chickens with myelocytomatosis and mainly causes myeloid leukosis in meat-type chickens (Venugopal et al., 2000). Then, hemangioma caused by ALV-J was first found in layer hens in 2006 in China (Xin et al., 2006). Since ALV was listed in the manual “National animal disease prevention and control for the medium and long term planning”, ALV has rarely occurred in layer hens and meattype chickens, and no reports of hemangioma were published in the last three years. Why did hemangioma crop up again recently? Liu reported that two novel ALVs isolated from layer hens that cause hemangioma and myelocytomas may be the product of recombination

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

5

HEMANGIOMA REOCCURED IN THE LAYER HENS

(A)

(B)

- M1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6M (C)

ALV

MDV

REV

Figure 2. Immunofluorescence assay and PCR detection of DF-1 cells infected with plasmas from sick chickens. (A) DF-1 cells infected with plasmas inoculated with ALV-J-specific antibody JE9, 100×; (B) negative control, 100×. (3) Electrophoretogram of PCR product with specific primer for ALV, MDV, and REV.

Table 3. The similarity of nucleotide sequences and amino acid sequences between SDAU1701 and other reference strains. Nucleotide sequences (%)

Amino acid sequences (%)

ALV-J strains

LTR

gag

pol

env

gag

pol

env

gp85

gp37

SDAU1702 SDAU1703 SDAU1704 SDAU1705 SDAU1706 SD09DP03 HLJ09MDJ-1 JL093-1 JS09GY3 NHH GD1109 SCDY1 NX0101 HPRS-103

99.1 96.0 98.8 99.1 100 94.1 89.2 89.2 90.4 91.1 89.8 93.3 93.2 94.1

98.7 94.6 99.0 99.4 100.0 95.0 95.0 95.2 94.7 96.3 94.5 96.2 94.2 97.0

97.7 99.5 99.3 98.3 99.7 96.8 96.8 96.9 96.8 96.3 97.3 97.7 97.0 97.0

95.8 98.9 96.6 98.3 99.8 93.5 93.5 94.0 93.1 93.5 94.2 93.5 92.6 93.4

98.4 95.4 98.7 99.0 100.0 96.9 96.9 96.4 97.3 98.4 96.9 97.9 94.6 97.9

98.1 99.3 99.3 98.4 99.5 98.2 98.2 97.9 98.5 97.4 98.4 98.6 97.1 98.5

94.2 98.4 95.4 97.4 99.8 90.7 90.7 93.0 92.1 91.5 93.0 91.6 90.2 91.2

92.2 97.7 92.5 97.7 99.7 88.2 88.2 91.5 89.6 90.2 91.9 90.9 88.6 90.9

99.0 99.0 100.0 99.5 100.0 92.9 92.9 95.4 94.9 91.8 93.9 91.8 92.3 90.8

between ALV-J and endogenous ALV-E previously (Liu et al., 2011). Therefore, mutations and recombination events in strain ALV-J may be the major reason for the extended tissue tropism. In this study, hemangioma appeared again in layer hens, and six strains of ALV-J were isolated and evaluated regarding similarities, phylogenetic relations, and amino acid substitutions. Analysis of the complete proviral genome sequence suggested that gag, pol,

and gp37 of SDAU1701–SDAU1706 were relatively conserved as compared with nine referential strains as previously reported, but LTR and gp85 showed substantial variation, which may be associated with the viral replication capacity and pathogenicity (Barnard et al., 2006). All the newly isolated strains have deviated from the original strain and form an independent clade in the phylogenetic trees of the env, gp85, gp37 proteins and LTR sequences. Therefore, the amino acid sequences

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

6

MENG ET AL. Strain Name SDAU1701 SDAU1702 SDAU1703 SDAU1704 SDAU1705 SDAU1706 SD09DP03 HLJ09MDJ-1 JL093-1 JS09JY3 GD1109 NHH SCDY1 HPRS-103 NX0101

21 Q Q Q Q Q Q R R Q Q Q R Q R R

47 L P S P P L L L L L L L L L L

61 T T T T T T N N Q Q Q N N D D

76 A T T T T A A A T T T A A A A

106 A T A T A A T T T T T T T T T

117 H H H H H H R R G G R G R R H

143 E E E E E E E E T T E A A A A

147 S S S S S S G G G G G S S S K

189 Q R Q R Q Q G G K K G N R R E

Position 192 206 Q A F G Q A F A Q A Q A Q G Q G L G L G S A F G L G L G F G

208 P S P S P P R R S S S S S S S

212 E E E E E E K K Q Q K E G K D

222 T G T G T T G G G G G G G G G

238 R G R G R R G G G G G G G G G

239 N E N E N N K K K K K N N E G

271 R R R R R R S S S S S R S R R

302 S G S G S S G G G G G G G G G

304 R R R R R R H H H R H R R H R

Figure 3. Nucleic acid sequence alignments of the ALV gp85 region.

Figure 4. Phylogenetic relationship of the six isolates to referential ALV-J strains, based on the env gene (A), gp85 gene (B), gp37gene (C), and LTR (D).

were compared, and we found amino acid substitutions that are similar to those strains causing hemangioma, such as the 21st, 47th, 143rd, 206th, and 239th positions; however, there are four distinctive mutations, namely, D/N/Q61T, T106A, G222T, and G238R. Of note, strains SDAU1701–SDAU1706 shared different mutations in LTR sequences with those referen-

tial strains and have six distinctive mutations—T74A, A75G, G94A, G181A, G191A, and T195C—giving rise to changes in regulatory elements. These data suggest that these mutations may be responsible for the altered oncogenicity in terms of hemangioma. In the present study, recombination analysis revealed that there was recombination in the ENV gene with the major and

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

HEMANGIOMA REOCCURED IN THE LAYER HENS

7

Figure 5. Bootscan analysis of the potential recombinant and major and minor parent sequences in the ENV gene of the isolates (A, B, C, D). The Bootscan was based on the pairwise distance model with a window size of 200, step size of 50, and 1,000 bootstrap replicates generated by the RDP4 program.

minor parent from different subgroups, which may be the key reason causing the occurrence of hemangioma. Although the genome sequence showed high nucleotide sequence and amino acid identity to other Chinese ALV-J isolates from hemangioma cases, the newly isolated ALV-J SDAU1701–SDAU1706 from Hy-Line chickens has evolved into a novel phylogenetic clade distincting from the previously reported strains causing hemangioma. This finding indicates that ALV-J has a tendency to resurface in layer chickens in China. At the same time, our findings serve as a warning that the eradication of ALVs is not disposable: subsequent continuous monitoring is necessary. Therefore, more attention and effort should be devoted to the eradication of ALVs.

Research and Development Program of China (No. 2016YFD0501606) and the Shandong “Double Tops” Program (grant number: SYL2017YSTD11).

REFERENCES

Bai, J., L. N. Payne, and M. A. Skinner. 1995. HPRS-103 (exogenous avian leukosis virus, subgroup J) has an env gene related to those of endogenous elements EAV-0 and E51 and an E element found previously only in sarcoma viruses. J. Virol. 69:779–784. Barnard, R. J., D. Elleder, and J. A. Young. 2006. Avian sarcoma and leukosis virus-receptor interactions: from classical genetics to novel insights into virus–cell membrane fusion. Virology. 344:25– 29. Cheng, Z., J. Liu, Z. Cui, and L. Zhang. 2010. Tumors associated with avian leukosis virus subgroup J in layer hens during 2007 to 2009 in China. J. Vet. Med. Sci. 72:1027–1033. Cui, Z., Y. Du, Z. Zhang, and R. F. Silva. 2003. Comparison of Chinese field strains of avian leukosis subgroup J viruses with ACKNOWLEDGMENTS prototype strain HPRS-103 and United States strains. Avian Dis. 47:1321–1330. This study was supported by the National SciDing, J. B., S. J. Jiang, H. F. Zhu, and Z. Z. Cui. 2007. Establishence Foundation (No. 31402226) the National Key ment and employment of PCR technique for distinguish Marek’s Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018

8

MENG ET AL.

disease virus vaccine strain CVI988 from other MDV strains. Chin. J. Vet. Sci. 27:39–42. Fadly, A. M., and E. J. Smith 1999. Isolation and some characteristics of an isolate associated with myeloid leukosis in meat-type chickens in the United States. Avian Dis. 43:391–400. Ji, R. L., Y. L. Liu, A. J. Qin, J. B. Ding, W. J. Jin, W. M. Zhao, Z. Z. Cui, S. H. Duan, H. P. Gao, and F. W. Han. 2001. Coinfection detection of the chicken infectious anemia virus and reticuloendotheliosis virus in the immunodepression flock. Chin. J. Vet. Drug. 35:1–3. Lai, H., H. Zhang, Z. Ning, R. Chen, W. Zhang, A. Qing, C. Xin, K. Yu, W. Cao, and M. Liao. 2011. Isolation and characterization of emerging subgroup J avian leukosis virus associated with hemangioma in egg-type chickens. Vet. Microbiol. 151:275–283. Li, X., W. Lin, S. Chang, P. Zhao, X. Zhang, Y. Liu, W. Chen, B. Li, D. Shu, H. Zhang, F. Chen, and Q. Xie. 2016. Isolation, identification and evolution analysis of a novel subgroup of avian leukosis virus isolated from a local Chinese yellow broiler in South China. Arch Virol. 161:2717–2725. Li, Y., X. Liu, H. Liu, C. Xu, Y. Liao, X. Wu, W. Cao, and M. Liao. 2013. Isolation, identification, and phylogenetic analysis of two avian leukosis virus subgroup J strains associated with hemangioma and myeloid leukosis. Vet. Microbiol. 166:356–364. Liu, C., S. Zheng, Y. Wang, L. Jing, H. Gao, Y. Gao, X. Qi, L. Qin, W. Pan, and X. Wang. 2011. Detection and molecular characterization of recombinant avian leukosis viruses in commercial egg-type chickens in China. Avian Pathol. 40:269–275. Pan, W., Y. Gao, L. Qin, W. Ni, Z. Liu, B. Yun, Y. Wang, X. Qi, H. Gao, and X. Wang. 2012. Genetic diversity and phylogenetic analysis of glycoprotein gp85 of ALV-J isolates from Mainland China between 1999 and 2010: coexistence of two extremely different subgroups in layers. Vet. Microbiol. 156:205–212. Payne, L. N., S. R. Brown, N. Bumstead, K. Howes, J. A. Frazier, and M. E. Thouless. 1991. A novel subgroup of exogenous avian leukosis virus in chickens. J. Gen. Virol. 72:801–807.

Payne, L. N., A. M. Gillespie, and K. Howes. 1992. Myeloid leukaemogenicity and transmission of the HPRS-103 strain of avian leukosis virus. Leukemia. 6:1167–1176. Payne, L. N., and V. Nair. 2012. The long view: 40 years of Avian leukosis research. Avian Pathol. 41:11–19. Qin, A, L. F. Lee, A. Fadly, H. Hunt, and Z. Cui. 2001. Development and characterization of monoclonal antibodies to subgroup J avian leukosis virus. Avian Dis. 45:938–945. Silva, R. F., A. M. Fadly, and H. D. Hunt. 2000. Hypervariability in the envelope genes of subgroup J avian leukosis viruses obtained from different farms in the U.S. Virology. 272:106–111. Smith, L. M., A. A. Toye, K. Howes, N. Bumstead, L. N. Payne, and K. Venugopal. 1999. Novel endogenous retroviral sequences in the chicken genome closely related to HPRS-103 (subgroup J) avian leukosis virus. J. Gen. Virol. 80:261–268. Sun, S., and Z. Cui. 2007. Epidemiological and pathological studies of subgroup J avian leukosis virus infections in Chinese local yellow chickens. Avian Pathol. 36:221–226. Tamura, K., J. Dudley, M. Nei, and S. Kumar, 2007. MEGA4: molecular evolutionary genetics analysis (mega) software version 4.0. Mol. Biol. Evol. 24:1596–1599. Venugopal, K., K. Howes, D. M. Flannery, and L. N. Payne. 2000. Isolation of acutely transforming subgroup J avian leukosis viruses that induce erythroblastosis and myelocytomatosis. Avian Pathol. 29:497–503. Weiss, R. A., and P. K. Vogt. 2011. 100 years of Rous sarcoma virus. J Exp Med. 208:2351–2355. Xin, C. A., W. S. Cao, K. J. Luo, G. H. Zhang, T. Ren, C. G. Xu, and M. Liao. 2006. Preliminary diagnosis report of the hemangioma suspected of avian leukosis virus infection in commercial layer chicken. Poult. Hus. Dis. Control. 11:2. Xu, B., W. Dong, C. Yu, Z. He, Y. Lv, Y. Sun, X. Feng, N. Li, L. F. Lee, and M. Li. 2004. Occurrence of avian leukosis virus subgroup J in commercial layer flocks in China. Avian Pathol. 33: 13–17.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey121/4999708 by university of winnipeg user on 23 May 2018