Isolation and characterization of the rat glutamine synthetase-encoding gene

Oene, 87 (1990) 225-232

225

Elsevier GENE 03418

Isolation and characterization of the rat glutamine synthetase-encoding gene (Recombinant DNA; exon; intron; mRNA sequence; phage cloning vectors; liver)

L. van de Zande', W.T. Labruy~re', A.C. Amberg b, R.H. Wilson c, A.J.W. van den Bogaert', A.T. Das °, D.A.J. van Oorsehot', C. Frijters', R. Charles', A.F.M. Moorman" and W.H. Lamers" ° Department of Anatomy and Embryology, Section of Molecular Anatomy, University of Amsterdam (The Netherlands): b DeparUnem of Biochemistry, University of Oroningen, Oroningen (The Netherlands) Tel. 31.50634215 and c Department of Genetics, Uniwrsily of Glasgow, Glasgow (U.K.) Tel. 44 413398855 Received by Dr. H. van Ormondt: 27 June 1989 Revised: 20 September 1989 Accepted: 27 September 1989

SUMMARY

From a rat genomic library in phage ~Charon4A, a complete giutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a short poly(A) tract were identified. The sequences of the entire mRNA and of the exon-intron transitions were determined. The smaller mRNA is identical to the 5' 1375 nt of the long mRNA and contains the entire protein-coding region. The position ofthe transcription start point was mapped. Within the first 118 bp of promoter sequence, a (T)ATAA-box, a CCAAT-box and an SPl-binding site were identified.

INTRODUCTION

Glutamine synthetase (GS; EC 6.3.1.2) catalyses the synthesis of giutamine trom glutamate and ammonia at the expense of hydrolysis of ATP to ADP. It is present in relatively high concentrations in muscle, kidney tubules and brain astrocytes. In adult rat liver the enzyme is present at a very high concentration (approx. 0.1 raM; De Groot et al., 1987) in a layer one to two cells thick surrounding the Correspondence to: Dr. W.H. Lamers, Department of Anatomy and Embryology, University of Amsterdam, Meibergdreef 15, ll05AZ Amsterdam (The Netherlands) Tel. 3120 5669111; Fax 3120 5664440. Abbreviations: aa, amino acid(s); cDNA, DNA complementary to mRNA; cRNA, RNA complementary to mRNA; d, deoxyribo; dd, dideoxyribo; GS, glutamine syntbetase; G$, gene encoding GS; kb, kilobases; nt, nucleotide(s); ORF, open reading frame; PEG, polyethylene glycol; Pipes, 1,4-piperazine-diethanesulfunic acid; SDS, sodium dodecyi sulfate; SSC, 0.15 M NaCi/0.015 M Na3"citrate pH 7.6; tsp, transcription start point(s). 0378-1! 19/90/$03.50 © 1990ElsevierSciencePublishersB.V.(BiomedicalDivision)

central vein (Gebhardt and Mecke, 1983; Gaasbeek Janzen et al., 1987). In situ hybridization demonstrated the same distribution for the GS mRNA as for the GS protein (Moorman et '~., 1988). In adult mouse and hamster liver a comparable confinement of GS protein and mRNA to the pericentral compartment was observed (Bennett et al., 1987; Kuo et al., 1988; Smith and Campbell, 1988). The distribution of GS in adult rat-liver parenchyma is complementary to that of urea-synthesizing enzymes (Gaasbeek Janzen et al., 1987). This complementary distribution is very important for an efficient NH3 detoxification and for pH homeostasis (Atkinson and Bourke, 1987). Furthermore, the uon-overlapping distribution is highly suggestive of a reciprocal regulation of the expression of both sets of genes. We have also studied carbamoylphosphate synthetase, the first and flux-determining enzyme of the cycle (De Groot et al., 1986; 1987). Glucocorticosteroids and, to a lesser extent, thyroid hormones were found to stimulate the expression of both genes, whereas at high concentrations, the polypepfide hormones

226 glucagon and growth hormone had reciprocal effects. More interestingly though, the set of genes offers an excellent opportunity to study topographical aspects of the regulation ofgene expression. From extensive studies on the relationship between the rate and the pattern of expression of both genes, the hypothesis emerged that early in development (rat: perinatally) regional differences in gene expression are most likely due to regional differences in the concentration of modulatory factors (e.g., hormones), but that later in

development, such regional differences are defmed, in addition, by topographical factors, i.e., the position of the cell within the liver lobule (Lamers et al., 1987). Therefore, it is most likely that those hormonal factors that determine the rate of expression of both genes under normal conditions, are not responsible for the pattern of expression of both genes. As a first step in the study of the molecular mechanisms that are responsible for regulation, we set out to isolate and

CACAGCCGAGAp`UGC~GAGUAGGGCGGAGUGUUUG&GCAGCACACCCAUUUCCUCUCCGCUCUUCGU~CU~U~C~GUC~CC~UC~U~U~ 100 CUGCCGGCCACCGCUCUGAACACCUUCC~CCAUGGCCACCUCAGCAAGUUCCCACUUGAA~~U~G~GAUGU&~UG~eCUGCCC~

200

G&GAAG&UCCAACUCAUGUAUAUCUGGGUUGAUGGUACCGGGGAAGGGCUACGCUGCAAGP`CCCGUACUCUGGA~GUG&eeC~GUGUGU&G~GAGU 300 UACCCG&GUGGAACUUUGAUGGUUCUAGU&CGUUUCAGUCUGAAGGCUCCAACAGCG&CAUGUACCUCCAUC~UGUGGCCAUGUUUCGAGACeC~C~

400

C`qGAGACCCCAACAAGCUGGUGUUCUGCGAAGUAUUCAAGUAU/~qCCGGAAGCCCGC&GAGACCAACCUGA~GCUGU~G~U&U~U~&~UG 500 GUGAGC~s.GCCAGCACCCCUGGUUUGGAAUGGAACAGGAGUAUACUCUCAUGGGAACAGACGGCCACCCUUUCGGCU~C~U~CC~&C 600 CCCAAGGACCCUAUUACUGCGGUGUC~GGAGCUG&CAAGGCUUAUGGCCGAGAUAUCGUGGAGGCUCACUACCGGGCCUGCUUGU&UGCUGG~U~GAU 700 CACAGGGAC/s.AAUGCCGAGGUU&UGCCUGCCC/s.GUGGGA~`UUCCAG1qUAGG~`CCCUGCGAAGGGp`UCCGCAU~AGAU~UCUCU~UAGeC~ 800 AUCUU(~CRUCGGGUAUGCG/~GACUUUGGGGUG/~UAGC~CCUUUGACCCC~GCCCp`UUCC`qGGGARCUGG~U~~CUGC~C~~A

•

900

GCACCAAGGCCAUGCG~AGGp`GA~UGGUCUGAGGUGC~UUG/~GGAGGCC~UUGAUA/~UGAG~G&~C~GUAC~UC~UGCCUA~ACCC 1000 CAAGGGGG~CCUGGACA~CGC~CGCCGUCU~CUGGAUUCCACGAAACCUCCAACAUCA~CG&CUUUUCCGCU~CG~GC~CCG~GCGC~GU&UC1100 CGC~UU(~CCCGG~UU~UCGG~CAGG~GAp`~AAGGGUUA(~UUUG/~AGAC(~GU(~GG~UUCUG~UUGCGACCC~U&UGC~UG&~G~C&U~U¢~ 1200 GC~¢GUGU(~UCCUOA~G~CUGGCGACGAGCC(~UUC~/q~U~¢~G~q~CUj~AGCGGACUCG~CC&GUGAUCUUG&G~CUUCCU&G~CCC~e 1300 O

U~r.J~(~UGUUCeCU(~UCCC~CUGGUCCCC`q~UGUAA~UCAAAAGG&UGGAAU~UCAAGGU¢UUUUU~UUe~UUG~GUUA~UU~UG¢c~&~1400 GGUr.~GK`qU&GAG~GGUC~GUt~(~UUAAU~U~U~C~ACCCAA~CC~CUUC~UUUeCU&GeUAGC~C&GUGGGG~eG~&G~U~G~GU~ 1500 ~A¢~G~UUcAUCU~AG~G~/~UGr~qUGU~UGUA~U&G~UGUe~r.~qAU~GG~UGU~UUGU~UG&G~&~UGGUUUUU~¢~

1600

~GG&UA`~UUG/q~AGGGr.~GeCCA~e&GeUU&G&UU~qACAUUUUeUeUGUr.~AGU&G&GAGeUG~AU~UU¢~UG~e~GC~CU&~G~GUe 1700 UGGU(~&GG&GUU~&GGUUGGU~UCUUGGCUUC~UU&GCUU&~G~&GUU~UQCC~UG~~GUU~C~UG&~U~eU&e

1800

UGU/~AGG/~G~Jh~q/~GUUUCUUGGUCCUCC~UUU&UAACUCA~GC~GAGUAGUAUUUUU&UA~U~UG~~~G~&UAU&U&U~ 1900 GUGUGUGGAUAUAUAUGUCUUUUCU/~UUG&GA~`¢CAUCCUAUUCCCUGGGUGCCF.~GUUUGAGUGAGG&G~UGUAGMGUG&~eU~UUGA2000 GGU~GGGGUGGGGAUGCAGU&CUGGGAAAGUUGGUUAU(~UUGGGGGUUC~`G~UUCAUU&(~U&C~A~~UGe~UG~&G~GAUGUU 2100 GG&CAGGUAGCCAGUGGG~UGCCACUGCUUGCCGCCAeUGU~CC~UGGG~UUAG~~A~UGU&UAe~U~U~~&G~&G~GUAUG&

2200

GUUGG~UGGUCAACUUGAACAUUGUUACAGGCGGGUGGGUGUUAGUGGGGGGUUAUUUUUUGGUGGGAeUAGC`qUGUCAeUAAAG~C~GAUAU2300 AUU~AAUUUUUUAAAGCAN~CA~`GUUUAG&UUUUAAUCAp`GUU~GU&GGGUUU~UAAeUUUAC~GA~G~UG~G~UG&~Ce~C~ 2400 GGCUCUUAGGGGAA~UG&GGACAGGCCUGG&GUUAAUAC`q~UUGUCAUU~UGUGU~CUAGUGU~UCUU~È~G&~GUC~C~~G~

2500

AAGCCG&UAGAGUCUUGUUUU&UUUUUCUUUUAUAAUA/~CACA~C~CA¢~UCCAU~CCAGCUUGUUGCCUUG~G~U~&UG~GUG~~2600 GCAGGCCAGCUGUGGUUUUUUU~U~UUGCCACGAUG&eUCUAp`UU&eCAUGUAUAGU&UG~G~&GAU~~UGU~G&~GU~eUGAGA 2700 GCAGAGt.'qJUGUAAAUCAACCUAACGUUUAUAAGAUUUCCUCUGACUUGUUUCUUUGUGGUU~CUC m

Fig. 1. Nucleotide sequenceof rat-liver GS toP, As. A ,~ZAP(Stratagene) Wistar rat eDNA library (Das et al., 1989) was used to isolate full-length G$ eDNA clones. Double-strandedDNA was sequencedwith the dideoxycllaln-terminat]ionmethod.The 3' end of'eDNA clone pGS4 was sequenced via a collectionof'subclonescontainingprogressive unidirectionaldeletions, which were generatedby exonucleaseIII treatment(Henikoff, 1984). The 5' end of'the sequenceis taken fromprevious results (Van de Zande et al., 1988). Underlinedare the start and stop codons. Poly(A)-additionsites of' the 1.4-kbmRNA (nt 1375) and the 2.8-kb mRNA (nt 2787) are indicated by asterisks.

227

characterize the rat GS gene. A partial sequence of the rat liver GS mRNA was abeady determined (Van de Zande et al., 1988). MATERIALS AND METHODS

Unless stated otherwise, standard procedures were followed (Maniatis et al., 1982; Ausubel et al., 1988). RESULTS AND DISCUSSION

(a) GS eDNAs From a ,~ZAP Wistar rat liver cDNA library (Das et al., 1989), several cDNAs complementary to GS mRNA were isolated. Those clones that were complementary to a large part of the 5' end of the GS mRNA either did or did not contain a large stretch complementary to the 3'-nontranslated region of the GS mRNA. Sequence analysis of the largest inserts of the two groups of cDNAs revealed short poly(A) stretches (7-8 nt) at the 3' end of these clones. Further analysis indicated that these clones (pGS4 and pGS5) were derived from the long (2.8-kb) and short (l.4-kb) species of GS mRNA, respectively (De Groot et al., 1987). As far as determined, the 5' sequences of pGS4 and pGS5 are identical. The entire 3' end of clone pGS4 was sequenced starting at the BstEII site (nt 1500). Clone pGS4 starts at nt 23 of the mRNA and ends at nt 2787, whereas clone pGS5 starts at nt 27 and ends at nt 1375. The entire sequence of the GS mRNAs is shown in Fig. 1. A long ORF of 1122 nt is present in both the short and long mRNA (cDNA) and starts at ATG (nt 132) and encodes a protein of 42 kDa, consisting of 373 aa. Thus, the short and long messengers have untranslated terminal regions of 122 nt and 1534 nt, respectively. For the mouse (Kuo et ai., 1988) and the Chinese hamster (Hayward et al., 1986), GS mRNAs of 1.4 kb and 2.8 kb have also been reported. The function of the long trailer sequence is not clear. There is no additional ORF in this sequence. The rat GS mRNA sequences are highly similar to those of Chinese hamster (Hayward et al., 1986), human (Gibbs et al., 1987) and mouse (Kuo and Darnell, 1989) GS mRNAs. The similarity for the 5'-untranslated region is 83~o and 7 9 ~ compared with the mouse and Chinese hamster, respectively. The translation start codon, located in the second exon, is in the sequence UCCACCAUGG which is almost identical to the consensus sequence for initiation: GCCRCCAUGG (Kozak, 1987). The similarity at the nt level for the protein-coding part of the mRNA is 93 ~ , 89.5 ~ and 86.1 ~ compared with the mouse, Chinese hamster and human GS sequences, respectively, resulting in aa similarities of well over 90~o. As in the mouse (Kuo and Darnell, 1989), there is no typical AAUAAA sequence

immediately upstream from the polyadenylation site for either the 2.8-kb or 1.4-kb mRNA. A comparison of the nt sequence of the 3' untranslated region of the rat and mouse mRNAs (Kuo and Darnell, 1989) reveals an overall simil&"ityof 81 ~o- However, between nt 1621 and 1791, this similarity breaks down to only 45 ~o. (b) The G$ gem Screening of 3.8 × l0 s recombinants of the rat genomic library in ~.Charon4A with cDNA clone pGS2 (i.e., nt 220-1672; Van de Zande et al., 1988) yielded two different clones designated ~.GS 1 and ~GS2. ~.GS 1 contains three EcoRI fragments (0.6, 5.0 and 8.0 kb). ~GS2 is identical to ~GSI except for a 2.8-kb extension at its 3' end. Southern blots of EcoRI digestion patterns showed that the 2.8-kb EcoRI fragment contains the sequences complementary to the 3' EcoRI fragment of GS cDNAs (downstream from nt 744; Fig. 1) and that the 5.0-kb EcoRI fragment contains more 5' sequences. As the cDNA clone pGS2 does not contain the first 220 nt of the rat GS mRNA, the 5' 470 nt ofpGSC45, itselfa full-length Chinese hamster GS cDNA clone (Hayward et al., 1986), were initially used as a prob~ to locate the first (most 5') exon in the 8.0-kb EcoRI fragment. The 0.6-kb fragment is located at the 5' end of the ~.GS 1 and ~GS2 inserts.

1

2

Fig. 2. Northern-blot analysis of poly(A) ÷ RNA fractions subjected to electron microscopy. 240/tg poly(A) ÷ RNA was fractionated by centrifugation through an isokinetic sucrose gradient (15-36%). The fractions containing GS mRNA were identified by Northern-blot analysis of 10% of the fraction volume, after electrophoresis on a 1% agarose gel containing 6 ~ formaldehyde. The 1.4-kb (lane !) and 2.8-kb (lane 2) GS mRNAs were visualized by hybridization to cDNA clone pGS2.

228 (¢) lutroa/exon analysis Electron microscopy of hybrids was used as a first approach to elucidate the genomic map of the GS gene. Hybridization of the genomic clone ~GS2 with sizefractionated poly(A)+mRNA (Fig. 2) showed that, with both the long and the short GS mRNAs, seven exons and six introns could be identified (Fig. 3). With the possible

exception of the 3'-terminal exon, the estimated sizes of the exons and introns for the two mRNA fractions were the same (Table I). This, together with the sequence identity of the cDNAs, indicates that both messengers are encoded by a single gene of 9.5-10 kb and result from a differential polyadenylation site selection. The resulting linear map of the GS gene is shown in Fig. 4. Far fewer unambiguous

B

D .. . . . . . . .

6

3 '

1

6

2

0.2~ I

I

Fig. 3. Genomic DNA: mRNA hybrids as visualized by electron microscopy. A Sprague-Dawley rat genomic EcoRI library in ZCharon4A (Sargent et al., 1979) was used to isolate the G$ gene. A 1.5-kb eDNA insert ofpGS2 (Van de Zande et al., 1988) was used as a probe. Denatured genomic DNA (GS2) was mixed with poly(A) ÷ RNA enriched for the 1.4-kb and 2.8-kb GS mRNAs, respectively (Fig. 2), and incubated in 70% formamide/0.1 M Pipes pH 6.8/10 mM EDTA/0.4 M NaC! for 16 h, applying a linear temperature gradient from 65°C to 55°C. Samples ofthe hybridization mixture were spread from 65% formamide/0.12 M Tris, HCI pH 8.5/30 mM NaCl/8 mM Pipes/13 mM Na2EDTA/0.01% cytochrome c onto a hypophase of triple-distilled water. Further processing of the specimens and electron microscopy on a Philips EM201 were performed as described (Arnberg et al., 1980). ,pX174 viral and replicative forms DNA were used as internal length standards. (A and B) Hybrids with the 2.8-kb GS mRNA; (C and D) hybrids with the 1.4-kb GS mRNA. In the schematic drawings (B and D), the dashed lines represent mRNA and continuous lines genomic DNA. In both figures, seven exons (hybridized sections) and six introns (R-loops, numbered l to 6) can be distinguished. Asterisk, 5' end of gene; arrow, poly(A) + tail. The 1.4-kb GS mRNA differs from the 2.8-kb GS mRNA only in the length of the last exon.

229 TABLE I Measured lengths of introns and exons of the G$ gene Exon"

Calculated length b

Sequenced lengthc

2.8-kb mRNA

1.4-kb mRlqA

1 2 3

leo (n= 1) 2oo (n= 1) 175 ± 2 9 ( n = 5)

4

175 ± 4 6 ( n =

leo _+23 215 ± 29 170 ± 29 150 ± 26

13)

5 6 7

135 ± 26 (n = 17) 2OO±29(n= 17) 1770 ± 6 9 ( n = 10)

Intron e

Calculated lengthb

2695 1445 ± 1585 ± 555± 200± 445 ±

(n= leo(n= 136(n= 64(n= 25(!!= 50 (n =

= = = =

3) 3) 4) 9)

115 (118) 179 162 147

130 ± 23 (n = 10) 205 ± 23 (n -- 10) 400 ± 20 (n -- 7)

128 200 1853/441

Mean value e

2.8-kb mRNA 1 2 3 4 5 6

(n (n (n (n

1.4-kb mRNA 2610 ± 1415 ± 1665 ± 555 ± 205 ± 470 ±

1) 5) 13) 17) 17) 10)

111 (n = 92 (n = 119 (n = 78 (n = 25 (n = 42 (il =

3) 4) 9) 10) 10) 10)

2630 1430 1620 555 173 f 460

a Exons are numbered from 5' to Y. u Calculated length in bp as determined by electron microscopy of DNA: RNA hybrids (+ standard deviation; n, number of measurements). c Length in bp as deduced from a comparison of sequenced eDNA and genomic subclones. d Introns are numbered from 5' to 3'. • Average length calculated from both sets of observations. r Sequenced length.

DNA: RNA hybrids were found in the 5' part than in the 3' part of the gene (Table I). Although the reason for this observation is not known, it may explain why primer extension results were difficult to reproduce (see Van de Zande et al., 1988). With the structural information obtained from 8000

5000

2800

|coRI

EcoRI

EcoRI

t

t

t

1 132

these hybrids, the sequence of most of the intron/exon boundaries could be determined (Fig. 5). The positions of the spliced introns on the mRNA are shown in Fig. 4. All of the intron/exon boundaries that were sequenced had the 5'-donor-site (AGgtragt) and 3'-accepter-site (polypyrimidine-ag dinucleotide) consensus sequences (Shapiro and Senapathy, 1987).

EcoRI

(d) Flanking sequences

12531375 I

poly(A)

2787 I

poly(A)

Fig. 4. Linear map of the GS gene and GS mRNA. EcoRl sites and resulting fragment lengths are shown. Boxes represent exons. The localization of the exon junctions on the mRNA is indicated. On the map for the mRNA, hatched boxes represent noncoding leader and trailer sequences, and the cross-hatched box the ORF coding for GS. The poly(A)-addition sites at nt 1375 and 2787 relate to the 1.4.kb and 2.8-kb mRNAs, respectively.

Sequence analysis of 5'-terminal genomic subclone pgGSl4 revealed the presence of promoter elements for eukaryotic gene expression. A TATA box-like element (CAATAAAAA) is found at nt -32, a CCAAT box nt -66, and a G + C-rich element (homologous to the SPl site: GGGCGG) at nt -49 (Fig. 5). A comparison of the first 120 nt upstream from the cap site in the rat with those in the mouse (Kuo and Darnell, 1989) and Chinese hamster (R.H. Wilson, unpublished) reveals 83.5% and 81~ similarities, respectively. In particular, the sequence and location of the promoter elements and the sequence around the tsp are conserved. The observed small difference in the location of the tsp in rat and mouse is therefore most likely due to experimental inaccuracy. The GGGCGG sequence

230 -118

gggc~cggtgca~a~gcaactgatgggcacggggtt~caggc~taqgccag~caat~¢aggg~gcctggaaacaa~ca¢aa -37 1 ~ctgccaataaaaagtactgagcagccc~caaccct~ACAG~CG&G~ATGGGAGTAGGGCGGAGTGTTTGAGCAGCAC~ 44 118 CATTTCCTCTCCGCTCTTCGTCTCGTTCTCGTGGCCTGTCCACCCATCCATCATCCTGCCGGCCACCGCTC~aagcgo acggagggt:ccaggggtgcacagccaccccggg ................................................ ...........................


:119 tcgt::ct:ctct:ccagkis.CkCCTT. . . .

297 ....

TGTRGAAGgtgago .........

....

GOCCGCAGgtgtgt .........

....

606 &(:(:CrJ~AG . . . . . . . . . . . . . . .

298 <2n4

intron

(1.4kb)

• ......................

<3rd

lntron

(1.6kb)

• ........

459

AGTTROOO . . . . 460

<4th

intron

734

.... C T C ~ C C A G g t a a a t ......... < 5 t h I n t r c n 934

.... G G T C T G A G g t a a g t ......... < 6 t h I n t r o n

(. 55kb)> ........

ttttttatttotagAO&OCkAC

....

607 cttgactccttcagG&CCCTkT

....

735

(. 1 7 k b ) • ........ t t t t t t c t c t ~ c a g T G G G A A T T .... 935

(. 46kb )• ........ c c t g t t t g c ~ t a g G T G C A T T G

....

2607 • • • CAGCTGTGGTTTTTTTCTCTTGCCACGATGACTCTAATTACCATGTATAGTATGTTCAGTTAGATAACTCACTGTAAA 2685

CAGACTGTA~TG~G~G~AGAGCTTGTA~AT~AA~CTAACGTTTAT~AGATTT~cT~TGACTTGTTT~TTTGTGGTTC~AA 2766 2787 L~%)IkR&Nt ~ % L ~ % L ~ b ~ C T C a a a a o t aact at at = g t t c o t t c t t t o t c t a t = a a a a g a a a g g a g g t g g t a ~ t t g t t t a +60 ~agg~aaaataatttgtttac~tgtg~ttttgtttttaaaatgtgttga¢tagggttggggttttttgggggtttttggtt +141 ttttttgtttttt~gt atttttgagaog=ggtcotagt~cotggoctggagotoaotgtgtagaccagtotgg=otttata +222 t t t t a c a c a g t c t t g g = a g o t c c c a a t t t c a t a t t t g g t ¢ t t a t atttt a a a a g o a g t g t t g t c t a = a g a a t t o

Fig. 5. The immediate upstream sequence, the exon/intronjunctions and the immediate downstream sequence of the rat G$ gene. Exon/intron transitions were sequenced in genomic subelones with either plasmid SP6 or T7 primers or primers that had also been used for sequencing G$ eDNA (Van de Zande et al., 1988) Genomic flanking sequences were obtained by analysis ofgenomic subelone pgGSI4, a 276.bpApaI-$mal fragment that contains the entire first exon and I 18 bp ofpromoter sequence, and ofgenomic subclone pgGS20, a 476-bp Pmll.£coRl fragment that contains the Y-terminal 181 noncoding bp for the long GS mRNA and 295 bp of Y-flanking sequence. Nontranscribed and introni¢ sequences are in lower-case letters. The tsp is labeled as 1, Upstream sequences are preceded by a minus symbol and downstream sequences by a plus symbol, ccaat and caataaaa sequences and a G + C-rich element, 888c88, are underlined.

at nt 21 in our sequence is absent in the mouse (Kuo and Darnell, 1989) and Chinese hamster (Hayward et at., 1986) and may therefore have no functional significance. A comparison of the 3'-flanking sequences of the rat gene (Fig. 5) with *.bose of the mo,se (Kuo and Darnell, 1989) shows good similarity (80 ~ ) up to nt + 97. Further downstream, two stretches of 25 n( and 48 nt with similarities of 92~o and 86~o are found, starting at nt + 162 and nt + 242 in the rat, respectively. The functional significance of these conserved sequences remains to be established.

(e) GS mRNAs When complementary RNA was synthesized with the 276.bp insert of pgGS 14 serving as a template, and used in an RNase protection experiment, fragments of 118 nt and 115 nt were protected (Fig. 6). By comparing the sequence of pgGS 14 with rat GN eDNA sequences and taking into account the consensus sequences at the 5' and 3' splice sites (Fig. 5), the location of the most 5' terminal protected nt in this fragment could be determined and, hence, the cap

site could be localized (Fig. 5). This result implies that the cap site must be 3 nt downstream from the sequence previously proposed (Van de Zande et at., 1988) to belong to the promoter region ofthe G8 gene. The poly(A)-addition site of the 1.4-kb GS mRNA was determined via RNase protection analysis with a fragment corresponding to nt 1260-1576 (Taql end of eDNA clone pSG2) of the 2.8-kb mRNA (Fig. I). In addition to the entire fragment, fragments of 109nt and l l6nt were protected, which implies that poly(A) addition takes place at nt 1368 and 1375. The presence of the short poly(A) tract in cDNA clone pGS5, starting at nt 1375, supports this assertion. RNase protection experiments to identify the poly(A)addition site of the 2.8-kb nIRNA, using genomic subclone pgGS20 as a template to synthesize complementary RNA (starting at Y-untranslated nt :?606 of the mRNA; Fig. I), show that approx. 150 nt are protected, suggesting that the point of poly(A) additiort is around nt 2760. This result contrasts with a comparison of the sequence data of the pGS4 cDNA and the genomic DNA (Figs. I and 5), which

231 AB ~

C eB..a,.

D -

•

e m B I D

152 _,,. 149==

•

---

370

•- -

316

--

156

147

, - - - 126 118..., 115 ~

II

..-. .

i .,,...116 .,.. 109 --" 106

95--.- O

Fig. 6. Characterization of GS mRNA-size by RNase protection assay. Radioactive RNA transcripts were synthesized with [~-32p]UTP (3000 Ci/mMol) and SP6, T7 or T3 RNA polymerases. Approx, l0s cpm oflabeled anti-sense RNA was added to 10 ttg ofrat liver poly(A)+RNA. Samples were denatured at 85°C for $ rain and hybridized overnight at 40°C in 30/d of 40ram Pipes pH6.4/400mM Na.acetate/I mM EDTA/80Yo f0rmamide. Incubation was continued at 30°C for I h after adding 350/41 of 10 mM "Iris. HCI pH 7.5/300 ~nM Na. acetate/5 mM EDTA containing 14/~g RNase A. RNA fragments were deproteinized with proteinase K and separated on a 6Yo polyaerylamide/8M urea gel. The size of markers is indicated by bars and the size of protected fragments by arrows. Lanes: A, protection of a 95-nt eRNA fragment transcribed from 5'-genomic subclone pgGS 14 (containing the first exon), by mRNA transcribed from eDNA clone pGS4; B, protection of 115-nt and 118-nt fragments (i.e., the entire first exon) of cRNA transcribed from pgGSl4 by poly(A)+RNA; C, protection of 147-nt, 149-nt and 152-nt fragments of cRNA transcribed from 3°-genomi¢ subclone pgGS20 (encoding the Y-terminal 182 nt of pGS4 and adjacent genomie DNA) by poly(A)+RNA; D, protection of 109-nt and 116-ntfragmentsofcRNA transcribed from nt 1260-1576 ofeDNA clone pGS2 by poly(A)÷RNA. The 316-nt fragment originates from protection by the 2.8-kb GS mRNA and the 370-nt fragment from undegraded eRNA.

locates the poly(A)-addition site at nt 2787. Most likely, this discrepancy is due to a stretch of 21 A-residues in the mRNA just before the start of the poly(A) tract. (f) Cenclusions Similar structures have now been found for rat, mouse (Kuo and Darnell, 1989) and Chinese hamster (R.H.

Wilson, unpublished results) G$ gene and flanking sequences. However, the putative GS gene isolated from mouse 3T3-LI adipocytes (Bhandari et el., 1988) is strikingly different in intron/exon structure. Adipocytes differ from other tissues in that an additional GS mRNA species is expressed, as identified by Northern-blot analysis (2.1 kb; Kuo and Darnell, 1989) and by primer-extension analysis (a 5'-untranslated leader sequence of 221 nt (Bhandari et al., 1988), i.e., 90 nt longer than that found in liver). However, it remains to be established whether the GS gene that is described by Bhandari et al. (1988) is expressed in mouse adipocytes, or whether it represents a pseudogene (Kuo and Darnell, 1989).

?.CKNOWLEDGEMENTS

This work was partly supported by the Netherlands Foundations for Medical Research (MEDIGON) (Grant No. 900-523-084) and Chemical Research (SON), with fmancial aid from the Netherlands Organization for Scientific Research. We thank A.W. de Wit for technical assistance, and C.J. H,~rsbach, K. Gilissen and A. van Horssen for preparing the illustrations. The sequences reported here have an EMBL accession No. X07921 and a GenBank accession No. M28542.

R~FERENCES Arnberg, A.C., Van Ommen, GJ.B., Grivell, L.A., Van Bruggen, E.FJ. and Borst, P.: Some yeast mitochondrial RNAs are circular. Cell 19 (1980) 313-319. Atkinson, A.E. and Bourke, E.: Metabolic aspects of the regulation of systemic pH. Am. J. Physiol. 252 (1987) F947-956. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Geidman, J.G., Smith, J.A. and Struhl, K. (Eds.): Current Protocols in Molecular Biology. Wiley-lnterscience, New York, 1988. Bennett, A.L., Paulson, K.E., Miller, K.E. and Darnell Jr., J.E.: Acquisition of antigens characteristic of adult pericentral hepatocytes by differentiatingfetal hepatocytes. J. Cell Biol. 105 (1987) 1073-1085. Bhandari, B., Beckwith, K.D. and Miller, R.E.: Cloning, nucleotide sequence and potential regulatory elements of the giutamine synthetase gene from murine 3T3-LI adipocytes. Proc. Natl. Acad. Sci. USA 85 (1988) 5789-5793. Des, A.T., Moerer, P., Charles, R., Moorman, A.F.M. and Lamers, W.H.: Nucleotide sequence of rat liver glutamate dehydrogenase eDNA. Nucleic Acids Res. 17 (1989) 2355. De Groot, CJ., Zonneveld, D., De Laaf, R.T.M., Dingemanse, M.A., Mooren, P.G., Moorman, A.F.M.o Lamers, W.H. and Charles, R.: Developmental and hormonal regulation of earbamoylphosphate synthetase gene expression in rat liver: evidence for control mechanisms at different levels in the perinatal period. Biochim. Biophys. Acta 866 (1986) 61-67. De Groot, CJ., Ten Voorde, G.HJ., Van Andel, R.E., Te Kortschot, A., Gaasbeek Janzen, J.W., Wilson,R.H., Moorman, A.F.M.,Charles, R. and Lamers, W.H.: Reciprocal regulation of giutamine synthetase

232 and carbamoylphosphate synthetase levels in rat liver. Biochim, Biophys. Acta 908 (1987) 231-240. Gaasbeek Janzen, J.W., Gebhardt, R., Ten Voorde, G.HJ, Lamers, W.H., Charles, R. and Moorman, A.F.M.: Heterogeneous distribution of glutamine synthetase during rat li,.,er development. J. Histochem. C~tochem. 35 (1987) 49-54. Gebhardt, R. and Mecke, D.: Heterogeneous distribution of 0ut_amine synthetase among rat liver parenchymal cells in situ and in primary culture. EMBO J. 2 (1983) 567-570. Gibbs, C.S., Campbell, K.E. and Wilson, R.H.: Sequence of a human glutamine synthetase eDNA. Nucleic Acids Res. 15 (1987) 6293. Hayward, B.E., Hussain, A., Wilson, R.H., Lyons, A., Woodcock, V., Melntosh, B. and Harris, TJ.R.: The cloning and nucleotide sequence ofcDNA for an amplified glutamine synthetase gene from the Chinese hamster. Nucleic Acids Res. 14 (1986) 999-1008. Henikoff, S.: Umdirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28 (1984) 351-359. Kozak, M.: An analysis of 5'-coding sequences from 699 vertebrate messeng¢r RNAs. Nucleic Acids Res. 15 (1987) 8125-8148. Kuo, C.F. and Darnell Jr., J.E.: Mouse glutamine synthetase is encoded by a single gene that can be expressed in a localized fashion. J. MoL Biol. 208 (1989) 45-56. Kuo, C.F., Pau;son, K.E. ~nd Darnell Jr., J.E.: Positional and developmenta~ regulation ofglutamine synthetase expression in mouse liver. Mol. Cell. Biol. 8 (1988) 4966-4971.

Lamers, W.H., Gaasbeek Jansen, J.W., te Kortschot, A., Charles, R. and Moorman, A.F.M.: Development of enzymic zonation in liver parenchyma is related to development of acinar architecture. Differentiation 35 (1987) 228-235. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Moorman, A.F.M., De Boer, P.AJ., Geerts, WJ.C., Van de Zande, L., Lamers, W.H. and Charles, R.: Complementary distribution of carbamoylphosphate synthetase and glutamine synthetase in rat liver acinus is regulated at a pre-translational level. J. Histochem. C'~ochem. 36 (1988) 751-755. Sargent, T.D., Wu, J.R., Sala-Trepat, J.M., Wallace, R.B., Reyes, A.A. and Bonner, J.: The rat serum albumin gene: analysis of cloned sequences. Proc. Natl. Acad. Sci. USA 76 (1979) 3256-3260. Shapiro, M.B. and Senapathy, P.: RNA splice junctions of different classes ofeukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15 (1987) 7155-7174. S~ith, D.D. and Campbell, J.W.: Distribution of glutamine synthetase and earbamoyl-phosphatesynthetase I in vertebrate liver. Proc. Natl. Acad. Sci. USA 85 (1988) 160-164. Van de Zande, L., Labruy~re, W.T., Smaling, M.M., Moorman, A.F.M., Wilson, R.H., Charles, R. and Lamers, W.H.: Nucleotide sequence of rat glutamine synthetase mRNA. Nucleic Acids Res. 16 (1988) 7726.