Isolation and Identification of Differentially Expressed Genes in Sugarcane Infected by Ustilago scitaminea

ACTA AGRONOMICA SINICA Volume 35, Issue 3, March 2009 Online English edition of the Chinese language journal Cite this article as: Acta Agron Sin, 2009, 35(3): 452–458.

RESEARCH PAPER

Isolation and Identification of Differentially Expressed Genes in Sugarcane Infected by Ustilago scitaminea QUE You-Xiong, YANG Zhi-Xia, XU Li-Ping*, and CHEN Ru-Kai Key Laboratory of Sugarcane Genetic Improvement, Ministry of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China

Abstract: The objective of this study was to survey the molecular mechanism of resistance to sugarcane smut (Ustilago scitaminea Syd.). Two sugarcane (Saccharum officinarum complex) varieties NCo376 with high resistance and F134 with susceptibility were infected by U. scitaminea and the genes associated with the smut resistance were detected with 12 anchored primers and 8 random primers via differential display reverse transcription PCR (DDRT-PCR). Seven differentially expressed fragments were obtained through cloning, sequencing, and semiquantitative RT-PCR validation. The results of Blast in GenBank showed that they shared high homology (35–99%) with cytochrome C oxidase (CCO) gene, ribosomal protein gene, NAD-dependent malic enzyme gene, aminotransferase gene, binding protein gene, RNA polymerase specific transcription initation factor and retrotransposon. The results of semiquantitative RT-PCR showed that CCO gene expression was regulated by U. scitaminea and salicylic acid, and was independent of H2O2. Besides, CCO gene was expressed in root, stalk, and leaf of sugarcane at relatively low levels. Thereby, the phytoalexin induced by CCO gene was inferred to inhibit the pathogen after infection. Keywords:

sugarcane; Ustilago scitaminea; mRNA differential display; RT-PCR

Sugarcane smut, caused by Ustilago scitaminea Syd., is an air-borne fungal disease and occurs as the most dominant fungal disease in almost all the countries and regions where sugarcane is planted. This disease has not only caused severe losses of cane stalk yields and sucrose content of infected varieties, but also resulted in discard of some local principal varieties [1, 2]. Although the morphology, cytology, and physiology of sugarcane in relation to smut resistance have been reported [3, 4], the molecular basis of the interaction between sugarcane and smut is rarely studied. Orlando et al. [5] studied the molecular response of resistant sugarcane after inoculating with U. scitaminea or Bipolaris sacchari using cDNA-AFLP technique and 62 differentially expressed genes were obtained, of which 52 were up-regulated and 10 were down-regulated. In our earlier studies, we cloned the NBS-LRR type disease-resistance gene from sugarcane and studied its possible mechanism in response to the smut resistance [6]. To date, multiple techniques have been developed to dissect the mechanism of plant and pathogen interaction at the RNA

level, among which differential display reverse transcription PCR (DDRT-PCR) is widely applied [7–9]. This technique can simultaneously detect genes differentially expressed in at least 2 types of cells or tissues at different stages or in different growing conditions. In addition, fluorescence difference display technique originating from radioactivity difference display technique has made progresses in sample amount, sensitivity, and repeatability. For instance, the high false positive rate in traditional DDRT-PCR analysis can be controlled under conditions of the proper quantities of total RNA, primers, cDNA, and dNTP, as well as the optimal PCR conditions. Besides, the fluorescence difference display technique completely gets rid of the isotope pollution [10, 11]. Semiquantitative reverse transcription PCR (RT-PCR) proves to be effective to verify the differential expression of genes and eliminate the false positive rate [12]. In this paper, fluorescence DDRT-PCR was used to identify the differentially expressed genes between resistant and susceptible sugarcane varieties and to explain the possible molecular mechanism for smut resistance.

Received: 27 June 2008; Accepted: 5 September 2008. * Corresponding author. E-mail: [email protected] Copyright © 2009, Crop Science Society of China and Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Published by Elsevier BV. All rights reserved. Chinese edition available online at http://www.chinacrops.org/zwxb/ DOI: 10.1016/S1875-2780(08)60068-1

QUE You-Xiong et al. / Acta Agronomica Sinica, 2009, 35(3): 452–458

1 1.1

Materials and methods Plant materials and race of pathogen

Sugarcane (Saccharum officinarum complex) varieties NCo376 and F134 were provided by the Sugarcane Research Institute, Fujian Agriculture and Forestry University, Fuzhou, China. NCo376 is resistant to U. scitaminea race 1 and race 2, whereas F134 is resistant to race 1 but susceptible to race 2. They were used as the control varieties in the identification of smut resistance in sugarcane. Ustilago scitaminea race 2 was preserved in our laboratory and reproduced on F134. Freshly diseased parts of plants were collected in paper bags from sugarcane, and stored at 4°C after they were naturally dried. The spore suspension of 5 u 105 spores mL1 was used for inoculation. 1.2

Treatment and sampling methods

In the treatment for DDRT-PCR and RT-PCR analysis, cane buds of NCo376 and F134 were inoculated with U. scitaminea race 2 or sterile ddH2O (control) through stabbing method, and then cultured in moist sand at 28 ± 0.5°C for 72 h. The normal bud tissues from the control and the inoculated plants were used to extract total RNA. In the treatment for the expression analysis of cytochrome C oxidase gene (CCO), only NCo376 was used as the material. Six pots of plant with 30 cane buds per pot were cultured in sand until 5-leaf stage. The pots were placed into a PGX-380C illumination incubator under the condition of 27±0.5°C and 13 h light/ 11 h dark with a light intensity of 440 mol m2 s1. Spore suspension was inoculated through stabling bud tissues. To further analyze the expression of CCO gene regulated by salicylic acid (SA) and H2O2, 5 mmol L1 of SA and 10 mmol L1 of H2O2 solution were sprayed onto the leaf surface of some other plants, respectively. Buds treated with distilled water were taken as the control. At time points of 0, 6, 12, 24, 48, 60, and 72 h after treatments, 20 uniform plants were selected, and their first 3 leaves from the top hypertrophy originated from 20 uniform plants were punched into 1 cm-diameter leaf disks. Each sample contained 3 leaf disks from 3 leaves. Besides, the root and stalk of the control were also sampled. All the samples were immediately fixed with liquid nitrogen and stored under –80°C before RNA extraction. 1.3

Extraction of RNA and synthesis of first-strand cDNA

The total RNA was extracted using Trizol kit (GIBCO BRL, Grand Island, NY, USA) [13], and the RNA quality was examined with a Beckman DU-640 spectrophotometer and electrophoresed on 1.0% agarose gels. In a PCR tube, 3.0 μL of total RNA (1 g L1) and 2.0 L of 3' anchored primer (AP) were added, and then ddH2O treated by diethypyrocarbonate

(DEPC) was filled to the total volume of 12.0 μL. The mixture was incubated at 70°C for 5 min and quickly chilled down on ice. PCR was carried out in a Mastercycler gradient (Eppendorf, German) after the following regents supplemented orderly to the system: 4.0 L of 5× RT buffer, 2.0 L of dNTP mixture (250 mol L1 each), 2.0 L of dithiothreitol (DTT) (100 mol L1), 0.2 L of superscript II (200 U L1, Sangon, Shanghai, China). The PCR conditions were 42°C for 5 min, 50°C for 60 min, 72°C for 15 min, and 4°C for maintaining. PCR products were stored at –20°C for further operations. 1.4

DDRT-PCR

Each primer pair was composed of a T7 fluorescence anchored primer and an M13 random primer. The PCR system (10 μL) consisted of 3.0 μL of cDNA, 1.0 μL of 10u buffer, 0.7 μL Mg2+ (3.75 mmol L1), 2.0 μL of dNTP (50 μmol L1), 0.7 μL of 3' TMR-AP (2.5 pmol L1; the primer sequences shown in Table 1), 1.75 μL of ARP (2.5 pmol L1; the primer sequences shown in Table 1), 0.1 μL of Taq polymerase (0.05 U μL1), and 0.75 μL of ddH2O. PCR procedure was as follows: 94°C for 2 min; 4 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 90 s; 30 cycles of 94°C for 30 s, 59°C for 30 s, 72°C for 90 s; 72°C for 7 min. PCR products were separated on 1.0 % polyacrylamide gels and analyzed with a Beckman Genomyxlr DNA sequencing/ difference display system (Pennsylvania, USA) according to the users’ instructions.

Table 1

Anchored and random primer sequences for DDRT-PCR

Primer

Sequence (5'ĺ3')

T7 Anchored primers TMR-T7(dT12)AP1

ACGACTCACTATAGGGCTTTTTTTTTTTTGA

TMR-T7(dT12)AP2

ACGACTCACTATAGGGCTTTTTTTTTTTTGC

TMR-T7(dT12)AP3

ACGACTCACTATAGGGCTTTTTTTTTTTTGG

TMR-T7(dT12)AP4

ACGACTCACTATAGGGCTTTTTTTTTTTTGT

TMR-T7(dT12)AP5

ACGACTCACTATAGGGCTTTTTTTTTTTTCA

TMR-T7(dT12)AP6

ACGACTCACTATAGGGCTTTTTTTTTTTTCC

TMR-T7(dT12)AP7

ACGACTCACTATAGGGCTTTTTTTTTTTTCG

TMR-T7(dT12)AP8

ACGACTCACTATAGGGCTTTTTTTTTTTTAA

TMR-T7(dT12)AP9

ACGACTCACTATAGGGCTTTTTTTTTTTTAC

TMR-T7(dT12)AP10 ACGACTCACTATAGGGCTTTTTTTTTTTTAG TMR-T7(dT12)AP11 ACGACTCACTATAGGGCTTTTTTTTTTTTAT TMR-T7(dT12)AP12 ACGACTCACTATAGGGCTTTTTTTTTTTTCT M13 random primers M13r-ARP1

ACAATTTCACACAGGACGACTCCAAG

M13r-ARP2

ACAATTTCACACAGGAGCTAGCATG

M13r-ARP3

ACAATTTCACACAGGAGACCATTGC

M13r-ARP4

ACAATTTCACACAGGAGCTAGCAGA

M13r-ARP9

ACAATTTCACACAGGATAAGACTAG

M13r-ARP10

ACAATTTCACACAGGAGATCTCAGA

M13r-ARP11

ACAATTTCACACAGGAACGCTAGTG

M13r-ARP12

ACAATTTCACACAGGAGGTACTAAG

QUE You-Xiong et al. / Acta Agronomica Sinica, 2009, 35(3): 452–458

1.5 Recovery of differential fragments and their reamplifications Differential cDNA bands were cut from the gels and resolved in 30 μL of TE (pH 7.4) that was composed of 60 mmol L1 of Tris-HCl and 1.0 mmol L1 of ethylene diamine tetraacetic acid (EDTA). After incubating at 37°C for 3 h, reamplification was carried out with 2.0 μL of primers M13 (5'-AGCGGATAACAATTTCACACAGGA-3') and T7 (5'-GTA ATACGACGACTCACTATAGGGC-3'). The amplification system was in 20 μL volume, consisting of 2.0 μL of 10u buffer, 1.6 μL of dNTP (50 mmol L1), 0.7 μL of Mg2+ (3.75 mmol L1), 2.0 μL of M13 primer (2.5 pmol L1), 2.0 μL of T7 primer (2.5 pmol L1) and 0.2 L of Taq polymerase (0.05 U L1). The PCR conditions were as follows: 94°C for 2 min; 4 circles of 94°C for 30 s, 53°C for 30 s, and 72°C for 1.5 min; 30 circles of 94°C for 30 s, 62°C for 30 s, and 72°C 1.5 min; finally 72°C for 7 min. 1.6 Cloning and sequence analysis of differential fragments The differential cDNA fragments were cloned into pMD18-T vector (TaKaRa) according to the instructions of the kit. The positive clones were sequenced by the Shanghai Sangon Biological Engineering Technology and Service Company (Shanghai, China). The target sequences were obtained after the vector and primer sequence were kicked off. These target sequences were indexed in GenBank using tBlastx procedure. 1.7 Semiquantitative RT-PCR verification of differential fragments and expression characteristics of CCO gene The primer sequences of 25S rRNA gene (internal reference) and the differential fragments were designed with Primer premier 5.0 (Table 2). The reverse transcription was carried out with 1 μg of total RNA from sugarcane buds (template) and anchored primers corresponding to the target differential

Table 2

fragments. The reaction system and procedures were the same as despcribed earlier. The products of reverse transcription were used as the templates of another PCR reaction in a 20 μL volume: 3.0 μL of template, 2.0 μL of 10u buffer (Mg2+ plus), 2.0 μL of dNTP 1 1 (50 mol L ), 0.4 μL of primers (2.5 pmol L ), and 0.6 μL of Taq polymerase. The PCR procedure was as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 1.5 min; 72°C for 10 min. The PCR products were inspected by electrophoresis on 1.0% agarose gels. PCR without template was carried out as the negative control. Semiquantitative RT-PCR was used for analyzing the expression characteristics of CCO gene after the pathogen inoculation and treatments with SA and H2O2. The expression of CCO was also compared in different organs of sugarcane, such as root, stalk, and leaf.

2

Results

2.1 Generation of total RNA and differential cDNA fragments The total RNA extracted from each sample showed clear 5S, 18S, and 28S bands. Besides, the absorbance ratio between the RNA of 28S and 18S was around 2 and the A260/A280 value ranged from 1.98 to 2.05. These results indicated that the total RNA extracted was qualified for further experiments. There were amplification bands in all DDRT-PCR reactions, and the majority of them were identical in both varieties before and after inoculation. A total of 11 differential fragments larger than 350 bp were obtained between the inoculation treatment and the control (Figs. 1 and 2), including 10 fragments from the inoculated buds. The differential bands RI1, RI2, RI3, and RI4 were from NCo376 and the bands SI1, SI2, SI3, SI4, SI5, and SI6 were from F134. The remaining band,

Primer sequences used in RT-PCR

Primer

Forward sequence (5'ĺ3')

Reversed sequence (5'ĺ3')

RI1

GGATGTTGGCTGAAAGAA

ATGGCATTTCCACGATTA

RI2

CAACCCTTCCAGCCACTT

CCATTTCACGCAACATCC

RI3

GGGGTGTTGGAGTATAGGT

AAAGGGAACTGCTGGTGT

RI4

TCAACTTCCTCGTGTCCC

TCCAATATCCTGCCAACC

SI1

CGAGGTGTCGGTGTTGTG

AGGACGCCATCGCATTAG

SI2

TGATGAACAAGATAACGACCAC

AGCCAGGATTGACGAGCA

SI3

CTCCCTGGNCCGGCTT

GGACCTTTGGAGCTTTGA

SI4

GATGACAAAGCCAGATGC

CAATGTGCCCTGAAACAC

SI5

CTGGACAAGATGGAGGCG

TCCTGCGAATGAGACACG

SI6

AAAACAGAGCCATTTCGC

TTCCTTTCCTGGTCATCG

S01

GATGTTTCTGTGGGCACTA

CCAACGAAATCAGCTTTAT

25S rRNA

GCAGCCAAGCGTTCATAG

CGGCACGGTCATCAGTAG

RI1 is the primer pair for cytochrome C oxidase gene.

QUE You-Xiong et al. / Acta Agronomica Sinica, 2009, 35(3): 452–458

2.2 Verification of differential fragments with semiquantitative RT-PCR Seven differentially expressed fragments obtained from DDRT-PCR yielded corresponding bands in semiquantitative RT-PCR. Among them, RI1, RI2, RI3, S11, S13, and S14 were only present in sugarcane inoculated with U. scitaminea, and S01 was only present in uninoculated sugarcane. Thus, these genes were considered as true differentially expressed genes and their GenBank accession numbers were FK939136, FK939137, FK939138, FK939139, FK939140, FK939141, and FK939142, respectively. The remaining 4 sequences, which were found to yield corresponding bands either before or after inoculation, were regarded as false positive products (Fig. 3).

Fig. 1 Electrophoresis of partial products with DDRT-PCR

Fig. 2 Electrophoresis of reamplification PCR products of differentially expressed cDNA fragments 0: Control; 1–11: Differential fragments between control and inoculation treatment in the order of RI1, RI2, RI3, RI4, SI6, SI5, SI4, S01, SI3, SI2, and SI1; M: 100 bp DNA ladder plus.

2.3

S01, was from the control F134. Since small fragments may not contain enough information related to gene function, some other differential bands smaller than 350 bp were not analyzed. The infection of U. scitaminea induced the expressions of some genes in sugarcane, whereas expression of some other genes were depressed. In general, more differential bands should appear after inoculation.

Sequence analysis of differential fragments

The functions of the 7 sequences verified by semiquantitative RT-PCR were annotated with the help of homology index in GeneBank. Sequence RI1 shared 99% homology with Oryza sativa CCO gene (AAX99137) and it was inferred to be partial sequence of sugarcane CCO gene. The other 6 sequences were associated with genes encoding ribosomal protein, NAD-dependent malic enzyme, aminotransferase, ethylene-responsive element binding protein, RNA polymerase specific transcriptional initiation factor, and retrotransposon protein, and the corresponding homologies ranged from 35% to 97% (Table 3).

25S rRNA

1000 bp 750 bp 500 bp

TCO TCO R11 R12

Fig. 3

TCO R13

TCO S11

T C O S12

TCO S13

TCO T C O TCO S15 S16 S14

TCO M S01

Expression validation of 11 differentially expressed bands obtained from DDRT-PCR by semiquantitative RT-PCR T: Sample treatment; C: Sample control: O: Blank control; M: 250 bp DNA ladder.

Table 3 Differential sequence

TCO R14

Source

Differentially expressed fragments and their tBlastx results

Accession

Primer

number

combination

Function

Gene/sequence in GenBank Accession number

Homology (%) 99

RI1

NCo376

FK939136

AP7/ARP3

Cytochrome C oxidase

AAX99137

RI2

NCo376

FK939139

AP7/ARP3

Ribosomal protein

NP001050397

97

RI3

NCo376

FK939140

AP7/ARP3

NAD-dependent malic enzyme

P37224

92

SI1

F134

FK939141

AP8/ARP11

Aminotransferase

AAK43507

86

SI3

F134

FK939137

AP7/ARP4

Ethylene-responsive element binding protein

AAP32467

69

SI4

F134

FK939142

AP7/ARP11

RNA polymerase specific transcription initiation factor

BAD45609

71

S01

F134

FK939138

AP7/ARP11

Retrotransposon protein

ABF97201

35

QUE You-Xiong et al. / Acta Agronomica Sinica, 2009, 35(3): 452–458

2.4

Expression characteristics of CCO gene

In the inoculation treatment, the expression of CCO gene was up-regulated over time, indicating that it was induced by U. scitaminea. In the SA treatment, the expression of CCO was at a low level from 0 to 24 h, significantly increased at 36 h, and relatively stable thereafter. This result indicated that the expression of this gene could be regulated by SA treatment. In contrast, the expression of CCO gene in H2O2 treatment maintained a relatively stable level without significant changes. Thereby, the functional mechanism of CCO was inferred to be independent of H2O2 (Fig. 4). In different tissues of sugarcane plant, CCO was expressed constitutively without significant differences (Fig. 5). This is in agreement with the expression characteristics of a disease resistant gene. Thereby, the CCO gene is considered as an important component in the resistance mechanism in response to U. scitaminea.

3

Discussion

False positive result is a great problem in differential analysis of cDNA or protein. The proper control varieties and well-controlled sampling are important for reducing false positive percentage in DDRT-PCR analysis. Besides, semiquantitative RT-PCR is an effective means to verify the result of DDRT-PCR. In this study, the standard resistant varieties, NCo376 and F134, were used, and the samples were collected from uniform cane stalks at the same growth stage to minimize the influence of genetic background. Furthermore, both blank and positive controls were employed in the experiment for screening the truly differential sequences. Finally, the differential expressed fragments obtained from

Fig. 4 Expression profile of cytochrome C oxidase gene under different treatments NC: Control; 0–6: 0, 12, 24, 36, 48, 60, and 72 h after treatment, respectively.

Fig. 5

Expression profile of cytochrome C oxidase gene in various tissues NC: Control; 1: Root; 2: Stalk; 3: Leaf.

DDRT-PCR were further tested with semiquantitative RT-PCR. Among the 11 differential expressed fragments from DDRT-PCR, 7 fragments were verified as true differential fragments. The false positive percentage was 36.4% in this study, which was lower than the general rate (•70%) [8]. Phytoalexin, commonly induced by pathogens, plays an extremely important role in the defense reaction in plants. Currently, 2 kinds of key enzymes have been found during the synthesis of phytoalexin: tryptophan synthase and cytochrome oxidase. In this study, the differentially expressed fragment RI1 shared a high homology (99%) with CCO gene, which is closely associated with disease resistance. Thus, the RI1 fragment was underlined in this study. The signal factors SA and H2O2 proved to play important roles in signal transduction and resistance response of plant at early stages, such as hypersensitive response (HR) and systemic acquired resistance (SAR) [14–16]. Our results showed that the expression of sugarcane CCO gene in NCo376 was induced by U. scitaminea and regulated by SA. The sugarcane CCO gene is thus considered as an inducible gene. This gene was expressed in the root, stalk, and leaf of sugarcane at low levels, and was not regulated by H2O2. These results were in accordance with the common characteristics of disease resistance genes involved in SAR [17]. The resistant variety NCo376 probably activates the synthesis of phytoalexin through up-regulating the expression of CCO gene under exogenous pathogen stress. Ribosome is the main structural component and the place of protein synthesis, whose amount is closely related to protein synthesis. The differentially expressed gene RI2 shared a high homology (97%) with the sequences of ribosomal protein genes (GenBank accession number: NP001050397). This indicates that a large number of resistance-related proteins are synthesized when the sugarcane is exposed to inoculation of U. scitaminea. These proteins may cooperate to defense or resist further invasion of the pathogen. Malic acid is the key metabolite participating in C4 circulation, sedum acid circulation, and other metabolic pathways. The differentially expressed gene RI3 shared a homology of 71% with the NAD-dependent malic enzyme gene (GenBank accession number: P37224), and it is inferred to be functional in the photosynthesis reaction during sugarcane–smut interaction. Another differential gene SI4, which encodes the RNA polymerase specific transcription initiation factor, may initiate the expressions of some genes related to molecular resistance mechanism of sugarcane. In this study, we observed the differentially expressed genes and expression patterns of resistant or susceptible varieties during the sugarcane–smut interaction. We hypothesize there are different response mechanisms of smut resistance between the resistant and susceptible varieties. However, additional evidence is required in future.

QUE You-Xiong et al. / Acta Agronomica Sinica, 2009, 35(3): 452–458

4

Conclusions

The molecular mechanism in the sugarcane–smut interaction is complex and various genes are involved. The resistant and susceptible sugarcane varieties have different gene expression patterns after inoculation of pathogen. Among the 7 differentially expressed genes obtained, RI1 is highly homologous to CCO gene. It possesses the constitutive expression characteristics of disease-resistance genes and is assumed to participate in SAR. Other differential expressed genes encode various functional proteins, including ribosomal protein, NAD-dependent malic enzyme, and RNA polymerase specific transcription initiation factors.

Acknowledgments This study was financially supported by the National High Technology Research and Development Program of China (2007AA100701), and the Program of Introducing International Super Agricultural Science and Technology of China (2006-G37), and the Natural Science Foundation of China (30170639).

[6]

[7]

[8]

[9]

[10]

[11]

[12]

References [1] [2]

[3]

[4]

[5]

Hoy J W. Incidence of sugarcane smut in Louisiana and its effects on yield. Plant Dis, 1986, 70: 59–60 Padmanaban P, Alexander K C, Shanmugam N. Studies on certain characters associated with smut resistance. Indian Phytopathol, 1988, 41: 594–598 Xu L P, Chen R K. Current status and prospects of smut and smut resistance breeding in sugarcane. Fujian J Agric Sci, 2000, 15: 26–31 (in Chinese with English abstract) Que Y X, Xu L P, Lin J W, Chen T S, Chen R K, Li Y L. Establishment of evaluation system of smut resistance for sugarcane varieties. J Plant Genet Resour, 2006, 7: 18–23 (in English with Chinese abstract) Orlando B H, Thomma B P, Carmona E, Borroto C J, Pujol M, Arencibia A, Lopez J. Identification of sugarcane genes induced in disease-resistant somaclones upon inoculation with Ustilago scitaminea or Bipolaris sacchari. Plant Physiol Biochem, 2005, 43: 1115–1121

[13]

[14] [15]

[16]

[17]

Que Y X, Lin J W, Zhang J S, Ruan M H, Xu L P, Zhang M Q. Molecular cloning and characterization of a non-TIR-NBSLRR type disease resistance gene analogue from sugarcane. Sugar Tech, 2008, 10: 71–73 Liang P, Pardee A B. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science, 1992, 257: 967–971 Zhi L F, Yu T, Peng M M, Zhu Y G, Li Y S. Cloning and characterization of novel rice cell cDNAs under iron-deficiency by improved DDRT-PCR method. J Wuhan Bot Res, 2005, 23: 7–10 (in Chinese with English abstract) Zhao C P, Li Y F, Ma R C, Shan F H, Zhang F T, Ye Z J, Qin N. Analysis of photoperiod temperature sensitive male sterility related genes in wheat with DDRT-PCR. Chin J Biochem Mol Biol, 2007, 23: 56–62(in Chinese with English abstract) Mao A J, Wang T, Song Y R. Analyzing plant gene expression differences using a silver staining based DDRT-PCR protocol. Prog Biochem Biophys, 2001, 28: 736–739 (in Chinese with English abstract) Chen X, Wang B L, Qu D, Zhang Y. Establishment of the semi-quantitative RT-PCR system of sulphur transporter genes in wheat. Acta Bot Boreali-Occident Sin, 2006, 26: 309–313 (in Chinese with English abstract) Zhang L N, Liu J S, Yu L. Expression analysis of wheat TaMlo-A1c gene by semi-quantitative RT-PCR. Acta Bot Boreali-Occident Sin, 2005, 25: 1368–1371 (in Chinese with English abstract) Que Y X, Li W, Xu J S, Xu L P, Zhang M Q. A simple and versatile protocol for isolation of RNA from plant, fungi and animal. Agric Sci Technol, 2008, 2: 63–65 Durner J, Shah J, Klessing D F. Salicylic acid and disease resistance in plants. Trends Plant Sci, 1997, 2: 266–274 Delaney T P, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, Ryals J. A central role of salicylic acid in plant disease resistance. Science, 1994, 266: 1247–1249 Wu G, Shortt B J, Lawrence E B, Levine E B, Fitzsimmons K C, Shah D M. Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants. Plant Cell, 1995, 7: 1357–1368 Yang X H, Chen Q S, Yang Q K, Li W B. Isolation and sequence analysis of a full-length NBS class of resistance gene homolog from soybean. High Technol Lett, 2005, 15(2): 71–78 (in Chinese with English abstract)