Isolation and identification of lipopeptides produced by B. subtilis SQR 9 for suppressing Fusarium wilt of cucumber

Scientia Horticulturae 135 (2012) 32–39

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Isolation and identification of lipopeptides produced by B. subtilis SQR 9 for suppressing Fusarium wilt of cucumber Yun Cao, Zhihui Xu, Ning Ling, Yujuan Yuan, Xingming Yang, Lihua Chen, Biao Shen, Qirong Shen ∗ Jiangsu Provincial Key Lab for Organic Solid Waste Utilization, Nanjing Agricultural University, Nanjing 210095, China

a r t i c l e

i n f o

Article history: Received 4 March 2011 Received in revised form 24 June 2011 Accepted 1 December 2011 Keywords: Bio-organic fertilizer Fusarium wilt Lipopeptide Cucumis sativus

a b s t r a c t Fusarium wilt is one of the major constraints on cucumber production worldwide. The introduction of beneficial microorganisms into soil has been widely adopted for suppression of the causative soilborne pathogen Fusarium oxysporum f. sp. cucumerinum J. H. Owen. The goal of this study was to investigate the effects of the new bio-organic fertilizer (BIO A) made from organic fertilizer and Bacillus subtilis SQR 9 on Fusarium wilt control in pot experiments. The results showed that application of BIOs significantly decreased the Fusarium wilt disease incidence and promoted plant biomass. The average disease incidence in BIO-treated plants was reduced by 68%, compared with the control treatment. Application of BIO A strongly reduced the number of the pathogen. The copy number of F. oxysporum DNA in BIO-treated soil declined to 105 /g fresh root 60 days after pathogen attack, while those in the control treatment remained high (107 /g fresh root). To determine the mechanisms of the antagonistic strain, polymerase chain reaction was used to screen SQR 9 for genes involved in biosynthesis of antibiotics. Amplicons of the expected sizes were detected as yndJ involved in the biosynthesis of Yndj protein, qk involved in subtilisin, sboA involved in subtilosin, bamC involved in bacillomycin, ituA, ituB, ituC and ituD involved in iturin, fenB and fenD involved in fengycin, and srfAB involved in surfactin synthesis. Fengycin and bacillomycin production in its culture filtrate were detected by liquid chromatography coupled with mass spectroscopy. The antifungal compounds significantly inhibited mycelial growth of F. oxysporum and caused a 13.4–83.6% reduction in the number of germinated spores compared with the control treatment. We speculate that the antibiotic production can be linked to the mechanism of protection of plants from pathogen attack by SQR 9. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Cucumber (Cucumis sativus) is an important vegetable cash crop worldwide. Fusarium wilt of cucumber, caused by Fusarium oxysporum f. sp. cucumerinum J. H. Owen (FOC), is one of the most serious soilborne fungal disease attacking crops throughout the world (Ahn et al., 1998; Armstrong and Armstrong, 1981). Chemical fungicides and soil disinfestation with methyl bromide are the main commercially available options for control of Fusarium wilt of cucumber. However, methyl bromide is now being phased out from agriculture due to environmental and food quality concerns. Highly resistant cultivars are not yet available and grafting is labor intensive and expensive (Ahn et al., 1998; Chung et al., 2008). Controlling of Fusarium wilt by antagonistic microorganisms represents an alternative disease management strategy due to its ability to provide environmentally friendly disease control (Lugtenberg and Kamilova, 2009; Compant et al., 2010).

∗ Corresponding author. Tel.: +86 25 8439 6291/5212; fax: +86 25 8443 2420. E-mail address: [email protected] (Q. Shen). 0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2011.12.002

The main mechanisms by which biocontrol agents (BCAs) suppress pathogens are antibiosis, competition, growth promotion and induction of systemically acquired resistance (Szczech and Shoda, 2006; Rampach and Kloepper, 1998; Romero et al., 2007). Several Bacillus subtilis strains were reported effective for control of plant pathogens (Asaka and Shoda, 1996; Moyne et al., 2001; Yu et al., 2002; Romero et al., 2007). Antibiotic production may play an important role in their biocontrol activity (Ongena and Jacques, 2008). B. subtilis strains could produce more than two dozen antibiotics. Peptide antibiotics synthesized by non-ribosomal peptide synthetases (NRPSs) and the ribosomal synthesized peptides represent the predominant class (Stein, 2005). Most of the antifungal peptides secreted by B. subtilis have a molecular weight of less than 2000 Da and are non-ribosomally synthesized (Moyne et al., 2001). The antibiotics synthesized non-ribosomally include the lipopeptides iturin, surfactin, fengycin and corynebactin (Stein, 2005). The mechanisms by which NRPSs suppress phytopathogens are linked with their roles in plant tissue colonization (Bais et al., 2004), direct antagonism of phytopathogens (Asaka and Shoda, 1996; Leclère et al., 2005; Ongena et al., 2005b) and inducing of plant resistance (Ongena et al., 2005a, 2007).

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39

The mechanisms employed by Trichoderma sp. to effect biological control of plant diseases are mycoparasitism, antibiotic production, rhizosphere competition, cell wall degradation enzymes such as chitinases and/or glucanase, induction of resistance in the host and metabolism of germination stimulants (Howell, 2003). T. harzianum SQR-T037 (SQR-T037) fermented organic fertilizer was a versatile weapon developed in our laboratory against Fusarium wilt on watermelon, banana and cucumber (Ling et al., 2010; Yang et al., 2010; Chen et al., 2011a, 2011b; Zhang et al., 2011). This strain was characterized by its ability to produce 6pentyl-␣-pyrone (6PAP), which Chen et al. (2011b) suggested plays a role in disease suppression. Another mode of action on biocontrol of Fusarium wilt by SQR-T037 relies on its biodegradation of allelochemicals in rhizospheres of plants (Chen et al., 2011a). Before being able to confer any plant beneficial effects, inoculated BCAs needed to be rhizosphere competent, and the ability to suppress disease is directly proportional to the population density (Compant et al., 2010). Compost addition to soil can maintain greater viability of biocontrol agents and achieve more stable biocontrol efficacy by providing a suitable substrate and a growthpromoting medium (Hoitink and Boehm, 1999; El-Hassan and Gowen, 2006; Zhao et al., 2011). Therefore, inclusion of composts with BCAs as a method to suppress soilborne pathogens is now a well established commercial practice (Hoitink and Boehm, 1999; Hoitink and Fahy, 1986). B. subtilis SQR 9 (SQR 9) was isolated from soil in which cucumber was continuously cropped and could significantly inhibit growth of FOC in vitro. We showed that SQR 9 inhibited the growth of FOC in vivo by colonizing plant roots (Cao et al., 2011). Identification of the antibiotics produced may improve our understanding of the mechanism involved in this and other biocontrol systems. Therefore, the objectives of this work were: (1) to isolate and identify the anti-fungal compounds produced by SQR 9, which is responsible for the in vitro inhibition of F. oxysporum and (2) to assess the capability of the new bio-organic fertilizer containing SQR 9 to control Fusarium wilt on cucumber under greenhouse conditions. 2. Materials and methods 2.1. Bacterial and fungal cultures Both antagonists and the pathogen F. oxysporum f. sp. cucumerinum J. H. Owen (FOC NJAU-2) were provided by Jiangsu Provincial Key Lab for Organic Solid Waste Utilization, Nanjing Agricultural University. B. subtilis SQR 9 (SQR 9) was isolated and identified in our laboratory and found to be highly efficient against Fusarium wilt in cucumber (Cao et al., 2011). T. harzianum SQR-T037 (SQRT037) was isolated from compost and identified in our laboratory (Yang et al., 2010). SQR-T037 showed significant inhibition against F. oxysporum in cucumber, watermelon, tomato and banana plants (Yang et al., 2010; Chen et al., 2011a, 2011b). SQR 9 was maintained at −80 ◦ C in Luria–Bertani (LB) broth with 15% glycerol (v/v). The fungal strains were stored on potato dextrose agar (PDA) slants at 4 ◦ C. 2.2. Bio-organic fertilizer preparation SQR 9 was incubated in LB liquid culture on a shaker at 170 rpm at 37 ◦ C for 48 h. The bacterial culture was centrifuged (6000 × g for 10 min at 4 ◦ C) and the cell pellets collected were resuspended in sterile water. The density of the bacterial cells was determined by the series dilution technique on LB plates. The concentration of the suspension was 4.0 × 1010 cfu/ml. SQR-T037 was cultured on PDA medium at 28 ◦ C for 10 days in the dark. Conidia were

33

harvested from the plates by rubbing the surface mycelium gently with a rubber swab and the spores were collected in distilled water. The culture was filtered through sterile cheesecloth to eliminate mycelial fragments. The conidia concentration was adjusted to 9.4 × 107 conidia/ml with a hemacytometer. The organic fertilizer, used for secondary fermentation by SQR 9, was composed of amino acid fertilizer and pig manure compost at a 1:1 (w/w) ratio. The amino acid fertilizer was made from rapeseed (Brassica napus L.) meal by solid-state fermentation with proteinase-producing bacteria for 7 days (Ling et al., 2010; Luo et al., 2010). This amino acid fertilizer contained 44.2% organic matter and 12.9% of amino acids, small molecular peptides and oligo peptides, 4.4% nitrogen (N), 2.3% P2 O5 , and 0.7% K2 O. The pig manure compost, containing 30.4% organic matter, 2.0% total N, 3.7% P2 O5 , and 1.1% K2 O, was kindly provided by Jiangsu Tianniang Agriculture and Technology Co. Ltd., Jiangsu, China. One liter of SQR 9 suspension (8.5 × 109 cfu/ml) or SQR-T037 conidia suspension (9.4 × 107 conidia/ml) was incorporated into 4 kg of the organic fertilizer, placed in open sterile plastic bags for secondary fermentation (Ling et al., 2010; Yang et al., 2010). The mixtures were kept at 40–45% moisture and were incubated separately at room temperature for 5 days and manually turned every day. The contents of B. subtilis and T. harzianum in the final products were counted by serial dilution on Bacillus-selective medium (Kinsella et al., 2009; Turner and Backman, 1991; Luo et al., 2010) and T. harzianum-selective medium (Josie et al., 2003; Yang et al., 2010), respectively. The numbers of antagonists were 109 /g for SQR 9 and 107 /g for SQR-T037. The obtained bio-organic fertilizers contained SQR 9 and SQR-T037 were called BIO A and BIO B, respectively. 2.3. Preparation of F. oxysporum inoculum and soil inoculation F. oxysporum was cultured on PDA medium at 28 ◦ C for 10 days in the dark. Conidia were harvested from the plates by rubbing the surface mycelium gently with a rubber swab and the spores were collected in distilled water. The conidia concentration was determined with a hemacytometer. 2.4. Design of pot experiment Cucumber seedlings “Jinchun 5” were grown in the nursery cups containing 350 g soil (31.1 g/kg organic matter, 2.04 g/kg total N, 13.86 mg/kg extractable P, 285.2 mg/kg exchangeable K and the pH of the soil was 7.13) until the seedlings had two true leaves, and then transplanted to pots with 5 kg F. oxysporum-infested soil with 35.4 g/kg organic matter, 2.12 g/kg total N, 2.17 g/kg total P, 34% <0.01 mm clay, and the pH of the soil was 6.8. Four treatments were designed in pot experiment. (1) CK (control), the nursery soil and pot soil were supplemented with chemical fertilizers containing the same amounts of N, P, K as in 2% (w/w) of organic fertilizer; (2) OF, the nursery soil and pot soil were supplemented with 2% (w/w) and 0.5% (w/w) of organic fertilizers, respectively; (3) BIO A, the nursery soil and pot soil were supplemented with 2% (w/w) and 0.5% (w/w) of bio-organic fertilizer made with SQR 9, respectively; and (4) BIO B, the nursery soil and pot soil were supplemented with 2% (w/w) and 0.5% (w/w) of bio-organic fertilizer made with SQR-T037, respectively. One cucumber plant was grown in each pot. Each treatment had three blocks with ten pots for each block. Thus, each treatment had 30 pots (replicates). The bioassay of disease incidence was performed 60 days after transplanting. Samples of plant and soil were also collected at this time. Wilt incidence and soil population of F. oxysporum were assayed 60 days after transplanting. The entire experiment was repeated once. Experiment 1 was conducted from May to July in

34

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39

2009 with temperatures of 18–35 ◦ C and the relative humidity from 60% to 85%. Experiment 2 was conducted from August to October in 2009 with temperatures of 20–32 ◦ C and the relative humidity from 60% to 75%. 2.5. Disease incidence Seedling infection by FOC was recorded every day, and the cumulative number of infected plants was also recorded. Disease incidence (DI) was calculated as the percentage of infected plants over the total number of plants in each block and was evaluated when the disease emerged (>20% of leaves wilted). 2.6. Quantification of F. oxysporum Three plants were sampled randomly for each treatment 60 days after transplantation. Plant roots with some rhizosphere soil were cut into 1-cm segments, and 0.5 g of these segments was placed into tubes containing 10 ml sterile distilled water, processed by Vortex Genie-2 (Scientific Industries Inc., USA) for 10 min at maximum speed. Soil DNA from the 1-cm root segments was extracted using an UltraClean kit for soil (MOBIO Laboratories Inc., Carlsbad, CA, USA). The F. oxysporum f. sp. cucumerinum-specific SCAR primer FocF3 (F) 5 -AAACGAGCCCGCTATTTGAG-3 and FocR7 (R) 5 -TATTTCCTCCACATTGCCATG-3 designed by Lievens et al. (2007) was used in a realtime PCR assay. The real-time conditions were previously described by Cao et al. (2011). Real-time PCR was run in an ABI Prism SDS 7500 instrument (PE Applied Biosystems, USA). All real-time PCR reactions were replicated three times. Each standard, sample and template-free control were prepared in triplicates. 2.7. Amplification of SQR 9 lipopeptide genes Genomic DNA was isolated from SQR 9 as previously described (Sambrook et al., 1989). Primers used to amplify the genes encoding for bioactive compounds of SQR 9 were either used as previously described by Joshi and Gardener (2006) or designed using Primer Premier 5 software from Premier Biosoft company (California, USA) based on the consensus sequences of known B. subtilis lipopeptide antibiotic genes deposited in GenBank (Table 1) (Tapi et al., 2010; Chung et al., 2008). PCR reactions were carried out in a 25 ␮l reaction volume containing 1 ␮l genomic DNA, 2.5 ␮l 10× PCR buffer, 20 mM MgCl2 , 0.2 mM of each dNTP, 0.5 ␮M of each primer and 1.25 U Taq DNA polymerase (Takara, Dalian). Amplification was performed with a PCR System DNA thermal cycler (Bio-rad, CA, USA) programmed for one cycle of 94 ◦ C for 5 min, followed by 35 cycles of 94 ◦ C for 30 s, annealing for 30 s at 52 ◦ C for fenD, ituC, yndJ, bamC and sboA specific primers, whereas those for srfAB, ituD, ituB, ituA, fenB and qk were set to 58 ◦ C and 72 ◦ C for 1 min, and extension at 72 ◦ C for 7 min was conducted after 35 cycles. A negative control without DNA was included in each PCR run. Each PCR reaction had three replicates. The amplified products were visualized by gel electrophoresis in a 1% agarose gel, stained by ethidium bromide. Expected PCR fragments were extracted using a Gel Extraction kit (Axygen, China). The obtained fragments were sequenced by Invitrogen Inc., Shanghai. Nucleotide sequences were compared with GenBank using the BlastN and BlastX software provided online by the National Center for Biotechnology Information. 2.8. Identification of lipopeptides produced by SQR 9 Isolation of antibiotics from SQR 9 was carried out as described previously (Chen et al., 2008; Moran et al., 2010). Cultures of SQR 9 were prepared by transferring 10 ml of over night culture from LB broth at 37 ◦ C into 200 ml of King’s B modified medium (Atlas, 1995) and incubated at 37 ◦ C on a rotary shaker at 170 rpm for

72 h. The suspension was centrifuged at 8000 × g for 20 min. The supernatant was adjusted to pH 2.0 with 6 mol/l HCl and stored overnight at 4 ◦ C. The precipitate was recovered by centrifugation at 8000 × g for 20 min, washed twice by acidic deionized waster (pH 2.0) and extracted twice with methanol (Roongsawang et al., 2002). The solution was dried with a rotary vacuum evaporator and the residue was dissolved in 1 ml of 0.01 mol/l, pH 7.4 PBS. The cell-free filtrates (CFF) of SQR 9 were prepared by passing the pale-yellow solution through a 0.22 ␮m hydrophilic membrane. Antibiotics were detected by reversed-phase HPLC as follows. The filtrate was injected into Agilent 1200 semi-preparative HPLC (Santa Clara, USA) with an Agilent ZORBAX SB-C18 Semi-preparative reverse phase column (9.4 mm × 150 mm, 5 ␮m) for purification. The mobile phase components were (A) 0.1% acetic acid in water and (B) acetonitrile at ratio of 60:40 with a flow rate of 0.8 ml/min. The elution pattern was monitored at 230 nm. The eluted fractions were collected every 2 min, each fraction (5 ml) was dried by rotary evaporator and dissolved in 1 ml PBS. Active fractions, identified by cylinder-plate assay against F. oxysporum on PDA, were pooled (Chen et al., 2008; Waseem et al., 2009). Antifungal compounds from HPLC were further analyzed by a mass spectrographic instrument Agilent 6410 Triple Quadrupole LC/MS (Agilent Technologies, Santa Clara, CA, USA) for molecular weight determination. The MS analysis was done by electrospray ionization in positive ion mode (Wang et al., 2004; Waseem et al., 2009). 2.9. In vitro antagonism tests SQR 9 was tested for antagonism against F. oxysporum on PDA by the dual culture technique as described elsewhere (Swain and Ray, 2006). A mycelium plug of F. oxysporum was put on one side of the PDA agar medium in a 90-mm Petri plate. Actively growing suspensions of the SQR 9 were placed on the opposite side of Petri plate 24 h after the pathogen inoculation. The cultures were incubated at 28 ◦ C for 7 days and evaluated for the presence or absence of an inhibition zone by SQR 9. The in vitro experiment was repeated three times and each test had three replicates. The CFF was adjusted to a concentration of 1 mg/ml and diluted to final concentrations of 100 and 500 ␮g/ml. For the cylinder-plate assay, 100 ␮l of the solutions were applied to sterilized open-ended cylinders placed onto PDA plate preinoculated with F. oxysporum (Brownlee et al., 1948). One hundred microliters of PBS (pH 7.4) was used as blank. Each concentration and the control were assayed three times and the diameters of inhibition zone were measured with a slide gauge. To determine the effect of antibiotics on FOC conidial germination, 100 ␮l of the solutions or PBS (pH 7.4) (control) were added into 100 ml of 2% water agar before pouring. The conidial suspension of FOC was diluted to no more than 1000 conidia per milliliter with sterile distilled water. One hundred microliters of diluted suspension was spread on plates and incubated at 28 ◦ C for 2 days. The number of colonies was counted on the 3rd day of incubation (Ling et al., 2010; Wu et al., 2008). Each treatment had three replicates. 2.10. Statistical analyses Disease reduction percentage in pot experiment and conidial germination reduction percentage by antibiotics (RP) described above were calculated using the following equation: RP = (1 − NT /NC ) × 100, where NT and NC were either disease incidence percentages or germinated spore numbers of FOC in treatments and control, respectively. Pot experiments were repeated once and results obtained were very similar. Therefore only data for Experiment 1 is presented. The data obtained were

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39

35

Table 1 PCR detection of antibiotic biosynthesis genes from SQR 9. Antibiotic

Code

Sequence (5 –3 )

Target gene

Amplicon size (bp)

GenBank accession number

Yndj

147F 147R

CAGAGCGACAGCAATCACAT TGA ATT TCG GTC CGC TTA TC

yndJ [Joshi and Gardener (2006)]

212

JN093032

Subtilisin

Qk1F Qk1R

CTTAAACGTCAGAGGCGGAG ATTGTGCAGCTGCTTGTACG

qk

704

JN093030

Subtilosin

Sbo1F Sbo1R

TCGGTTTGTAAACTTCAACTGC GTCCACTAGACAAGCGGCTC

sboA

334

JN0930029

Bacillomycin

bamC2F bamC2R

CTGGAAGAGATGCCGCTTAC AAGAGTGCGTTTTCTTCGGA

bamC

850

JN093031

Iturin

ITUCF1 ITUCR3 bamB1F bamB1R ituD2F ituD2R ituA1F ituA1R

TTCACTTTTGATCTGGCGAT CGTCCGGTACATTTTCAC AAGAAGGCGTTTTTCAAGCA CGACATACAGTTCTCCCGGTGATGCGATCTCCTTGGATGT ATCGTCATGTGCTGCTTGAG TGCCAGACAGTATGAGGCAG CATGCCGTATCCACTGTGAC

ituC [Joshi and Gardener (2006)]

575

JN093028

ituB

508

JN093026

ituD [Joshi and Gardener (2006)]

647

JN093033

ituA

885

JN093024

FNDF1 FNDR1 FenB1F FenB1R

CCTGCAGAAGGAGAAGTGAAG TGCTCATCGTCTTCCGTTTC TACCAATCGCAATGTCGTGT CTTCGATTTCTAACAGCCGC

fenD [Joshi and Gardener (2006)]

293

JN093027

fenB

767

JN093025

110F 110R

GTTCTCGCAGTCCAGCAGAAG GCCGAGCGTATCCGTACCGAG

srfAB [Joshi and Gardener (2006)]

308

JN084036

Fengycin

Surfactin

transformed and subject to one-way ANOVA analysis, and means were determined by Duncan’s multiple range test at P = 0.05. All statistical analyses were performed with SPSS (version.11.5) statistical software (SPSS, Chicago, USA). 3. Results 3.1. Biocontrol assays against Fusarium wilt of cucumber In the greenhouse trial, the highest percent of disease incidence (73%) occurred on the plants treated with F. oxysporum only. Application of BIO A significantly decreased the incidence rate to 28% which was similar to that of BIO B. Application of organic fertilizer performed better than the control (Fig. 1).

3.2. Pathogen detection in the rhizosphere Real-time PCR was carried out to determine the copy number of the target DNA present in cucumber rhizosphere soil. The DNA copy number varied from 6.7 × 105 to 1.3 × 107 copy/g fresh root (Fig. 2). The DNA copy number of F. oxysporum in cucumber rhizospheres was highest 60 days after the inoculation of the pathogen in the control treatment. However, the FOC DNA copy number in rhizosphere soil was significantly reduced by the application of either BIO A or BIO B.

100 90

Disease incidence (%)

80

a

70 60 50

b

40

c

30

c

20

Number of F. oxysporum DNA copies (×10 5 /g fresh root)

150

a

120

90

60

b 30

c

c

10

0

0

CK CK

OF

BIO A

BIO B

OF

BIO A

BIO B

Treatment

Treatment Fig. 1. Incidence of Fusarium wilt in cucumber at 60 days after pathogen inoculation in pot experiment. CK, the control (FOC only); OF (organic fertilizer); BIO A (bioorganic fertilizer containing B. subtilis SQR 9); BIO B (bio-organic fertilizer containing T. harzianum SQR-T037); all values are the means of three blocks with ten replicated pots/block. Columns for each experiment with the same letter are not significantly different at P = 0.05 according to Duncan’s LSD test.

Fig. 2. Number of Fusarium oxysporum f. sp. cucumerinum FocF3 (F) /FocR7 (R) amplified DNA copies (log) in rhizosphere soil samples determined with realtime PCR. A 10-fold serial dilution of pDNAFOC (5 × 103 to 5 × 108 copies/␮l) and primer pair FocF3 (F) /FocR7 (R) was used to construct the standard curve. The equation of the standard curve: Y = −3.6192X + 47.5580, R2 = 0.9928. Data are the means of three replicates. Values with the same letter are not significantly different (P ≤ 0.05) according to the Duncan’s LSD test.

36

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39

Table 2 Effects of bio-organic fertilizer treatments on plant growth of cucumber. Treatment CK OF BIO A BIO B

Root dry weight (g/plant)

Shoot dry weight (g/plant)

Shoot height (cm)

0.6c 1.6b 1.9a 1.9a

12.6c 30.2b 36.9a 42.0a

67.4c 89.4b 99.3a 122.2a

Mean values in the same column followed by the same letter are not significantly different at P ≤ 0.05 according to Duncan’s least significant difference (LSD) test.

3.3. Promotion of plant growth by bio-organic fertilizer Plant growth parameters varied significantly among the control, OF- and BIO-applied treatments by 60 days after FOC inoculation (Table 2). The BIO treatments not only suppressed Fusarium wilt but also significantly promoted cucumber plant growth. Plants treated with BIOs showed on average a 2-fold increase in root dry weight. Inoculation with FOC alone resulted in significantly less biomass of shoot than plants treated with BIO or OF. Plants treated with BIOs were taller than the control or OF treated plants. However, no significant difference of plant growth promotion was observed between the BIO A and BIO B application. BIO application enabled the plants to withstand the Fusarium-infested soil and to attain better growth (shoot height) than the control plants. 3.4. Identification of antibiotic biosynthesis genes from SQR 9 PCR was used to detect genes involved in the biosynthesis of 6 antibiotics reported to be produced by B. subtilis. A total of 11 gene fragments of the size expected to be correlated with biocontrol activities were efficiently amplified from SQR 9 (Fig. 3). The DNA sequences obtained from these amplifications confirmed the identity of these genes. FenB1F/FenB1R and FNDF1/FNDR1 primers amplified fragments similar to the fengycin (synonymous to plipastatin) synthetase (99% of homology). Analysis of sequences of amplified by primers ituD2F/ituD2R, bamB1F/bamB1R, ituA1F/ituA1R, bamC2F/bamC2R and ITUCF1/ITUCR3 showed 97–99% identity with regions of iturin synthetase or its closely related compounds in the iturin family. The surfactin synthetase gene was detected in SQR 9 with a homology of 95% (e value = 1e−133) by primer pair 110F/110R. The PCR products obtained using the 147F/147R, primer pairs showed 96% identity with yndJ, a gene coding for Yndj protein with biocontrol potential. Finally, analysis of DNA sequences from PCR products amplified with the primer sets of Sbo1F/Sbo1R and Qk1F/Qk1R, respectively, showed 99% identity to albA (coding for subtilosin A synthetase) in B. subtilis MZ-32 and 96% identity to qk (coding for subtilisin synthetase) (Table 3).

Table 4 Assignment of lipopeptides characterized in this study. Retention time (min)

Mass peak (m/z)

Assignment

5.7 5.9 6.2 6.3 6.6 6.7 7.2 7.2 7.4 7.6 7.8

1063.6 1017.5 1506.0 1031.6 1045.6 1435.0 1059.6 1449.9 1463.9 1492.9 1477.9

C17 C13 C17 C14 C15 C14 C16 C15 C16 C18 C17

Bacillomycin L, (M+H)+ Bacillomycin D, (M+H)+ Fengycin B, (M+H)+ Bacillomycin D, (M+H)+ Bacillomycin D, (M+H)+ Fengycin A, (M+H)+ Bacillomycin D, (M+H)+ Fengycin A, (M+H)+ Fengycin A, (M+H)+ Fengycin A, (M+H)+ Fengycin A, (M+H)+

3.5. Identification of antifungal compounds The antifungal metabolites produced by SQR 9 were extracted from a 3-day-old cell-free culture filtrates. It was found that the antifungal substances could readily be precipitated from the acidified fermentation broth. Eight fractions were collected with elution time through HPLC (Fig. 4), and their antagonistic activities were examined. Only fractions collected from 2–4 and 4–6 min when four major peaks appeared, inhibited the growth of F. oxysporum. Thus, the two fractions were pooled and used for further study. Liquid chromatography–mass spectrometry analysis showed several molecules around peaks at m/z 1045.6 and 1478.0 (Fig. 5). Six peaks appeared at m/z 1435.9, 1449.9, 1463.9, 1477.9, 1492.9 and 1506.0, suggesting a series of homologous molecules with a difference of 14 Da ( CH2 ), which have similar m/z values to the antifungal lipopeptide and fengycin. Another group had peaks at m/z 1017.5, 1031.6, 1045.6, 1059.6 and 1063.6. Compared our results with those in the literatures, the second group compounds were designated as bacillomycin. The general structures of lipopeptide families are similar, it is difficult to purify each family of these molecules, although a variety of chromatographic conditions and mobile phases were tested. The detected lipopeptides were summarized in Table 4. 3.6. Antifungal activities of SQR 9 and its antibiotics SQR 9 inhibited the growth of FOC by presence of a 24.2-mmdiameter inhibition zone on PDA plates. The hyphae of FOC close to the inhibition zone were yellow, suggesting some antifungal compound were released by the strain. The antibiotics extracted by methanol strongly inhibited growth of FOC, leading to a reduction in number of germinated spores and mycelial growth (Table 5). Compared with the control treatment, there was approximately a 13.4–83.6% reduction in the number of germinated spores with increasing amounts of

Table 3 Genes showing highest similarity to the sequenced products obtained from PCR amplification from biosynthetic genes. Primer name

Isolate

Match with proper genes by BlastN

GenBank accession numbers of matching genes

Match with proper proteins by BlastX

e value of BlastX

e value of BlastN

110F/110R FenB1F/FenB1R FNDF1/FNDR1 ituD2F/ituD2R bamB1F/bamB1R ituA1F/ituA1R ITUCF1/ITUCR3 bamC2F/bamC2R Sbo1F/Sbo1R Qk1F/Qk1R 147F/147R

B. amyloliquefaciens FZB42 B. subtilis 168 B. subtilis MBI600 B. subtilis MH25 B. subtilis ATTCAU195 B. amyloliquefaciens FZB42 B. subtilis MH25 B. subtilis ATTCAU195 B. subtilis MZ-32 B. subtilis QK02 B. amyloliquefaciens FZB42

srfAB ppsE fenD ituD bamD BmyA ituD bamD albA qk yndj

CP000560.1 AL009126.3 DQ011336.1 EU263005.1 AY137375.1 CP000560.1 EU263005.1 AY137375.1 FJ151506.1 AJ579472.2 CP000560.1

Surfactin synthetase plipastatin synthetase fengycin synthesis iturin A operon bacillomycin D operon iturin A synthetase A iturinA synthetase C bacillomycin D synthetase C subtilosin A subtilisin Yndj

3e−47 1e−130 2e−47 2e−116 2e−92 3e−152 9e−95 3e−152 9e−05 1e−110 8e−30

1e−133 0.0 6e−141 0.0 0.0 0.0 0.0 0.0 2e−156 0.0 2e−94

Identity of corresponding gene by BlastN (%) 95% 99% 99% 99% 99% 97% 99% 98% 96% 99% 96%

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39 Table 5 Conidia germination and diameter of inhibition zone of Fusarium oxysporum f. sp. cucumerinum in presence of antibiotics isolated from SQR 9. Concentration (␮g/ml)

Number of germinated conidia (spores per Petri plate)

Diameter of inhibition zone (mm)

Control 100 500 1000

67a 58a 20b 11c

6c 14.77b 22.54a 24.42a

Diameter of the cylinder: 6 mm. Mean values in the same column followed by the same letter are not significantly different at P ≤ 0.05 according to Duncan’s least significant difference (LSD) test.

antifungal compounds 2 days after incubation. The greatest inhibition of mycelial growth was in the treatment of the highest concentration of lipopeptides (1000 ␮g/ml). Significant suppression of mycelial growth of FOC on PDA in presence

37

Table 6 Antagonistic activity of antibiotics produced by SQR 9 against soilborne pathogens. Pathogen

Inhibition zone (mm)

F. oxysporum f. sp. nevium F. oxysporum f. sp. cubense F. oxysporum f. sp. vasinfectum V. dahliae P. capsici P. nicotianae R. solani

26.33 21.65 27.23 24.77 28.02 25.34 18.25

of CFF was also observed even at the lowest concentration of 100 ␮g/ml. The antifungal spectra of antibiotics were shown in Table 6. Most of the strains tested were soilborne phytopathogens, and were found to be highly sensitive to the extracted antibiotics. The Rhizoctonia solani and less sensitive to the antibiotics than other tested fungal pathogens.

Fig. 3. Agarose gel-electrophoresis of PCR products for antibiotic biosynthesis genes from B. subtilis SQR 9. Lane 1, srfAB; lane 2, ituA; lane 3, ituD; lane 4, fenB; lane 5, ituB; lane 6, fenD; lane 7, ituC; lane 8, sboA; lane 9, qk; lane 10, bamC; lane 11, yndJ; lane 12, DL 2000 DNA marker.

Fig. 4. Reversed-phase HPLC chromatograms of antibiotics produced by B. subtilis SQR 9.

Fig. 5. Mass spectroscopic analysis of antifungal compounds produced by B. subtilis SQR 9.

38

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39

4. Discussion Fusarium wilt of cucumber was significantly suppressed by the bio-organic fertilizers (BIOs) tested in the present study. The wilt incidence rates were decreased by 80% with application of BIO A, compared with the control. However, application of organic fertilizer alone had limited suppressive effect. These data suggested that the better control of Fusarium wilt by BIOs may be due to the combination of antagonists with suitable organic amendments (Trillas et al., 2006; Zhang et al., 2008, 2011; Ling et al., 2010; Luo et al., 2010; Zhao et al., 2011). Here we also found that B. subtilis SQR 9 from BIO A was as effective as T. harzianum SQR-T037 from BIO B in controlling F. oxysporum in situ. Considering the facts that SQR 9 was isolated from a healthy cucumber root in a severely Fusarium wilt-disease field and that BCAs specific for wilt diseases might perform better in controlling Fusarium wilt (Zhang et al., 2011), the new bio-organic fertilizer (BIO A) was characterized by a great potential in control of wilt diseases in other plants. In addition, plant biomass yields in treatments of BIO A and BIO B were higher than CK and OF, demonstrating that BIOs not only reduced Fusarium wilt but also promoted plant growth. This was probably due to the beneficial contribution of the enriched microorganisms in the compost (Swain and Ray, 2006). Several B. subtilis strains were used as biocontrol agents of plant diseases (Romero et al., 2007). One of the most convincing properties contributing to the antagonism is the broad spectrum antibiotic and antimicrobial compounds synthesized (Joshi and Gardener, 2006). The involvement of these antibiotics in the protective action towards plant by Bacillus has been reported either by hampering the pathogens directly or inducing systemic resistance of host plants (Asaka and Shoda, 1996; Ongena et al., 2005a, 2005b; Romero et al., 2007). Among these antimicrobial compounds, cyclic lipopeptides have well-recognized potential uses in biotechnology (Ongena and Jacques, 2008). Lipopeptides production played a major role in successful control avocado root rot by B. subtilis strains (Cazorla et al., 2007; Leclère et al., 2005). In this study, B. subtilis SQR 9 had significant inhibitory effects on the growth of F. oxysporum causing cucumber Fusarium wilt in vitro and in vivo. PCR analysis revealed the existence lipopeptide-synthetic genes, coding for surfactin, fengycin, iturin, bacillomycin, subtilosin, subtilisin synthetases. When compared with GenBank sequences, the 11 cloned sequences had the highest degrees of similarity to homologous sequences previously identified in other biocontrol strains, i.e., FZB42 (Koumoutsi et al., 2004), B. subtilis ATTCAU195 (Moyne et al., 2004) and MBI 600 (Joshi and Gardener, 2006). Genomes with such genes have an enhanced capacity to produce antibiotics with an inhibitory activity against root pathogens (Joshi and Gardener, 2006). LC–MS analysis of culture filtrate from SQR 9 proved the occurrence of two different lipopeptide antibiotics, fengycin and bacillomycin. Moyne et al. (2001) reported that Bacillomycin D analogs produced by B. subtilis AU195 showed high activity against A. flavus and a broad range of plant pathogenic fungi. Antibiotics of iturin family were found to act upon the sterol present in the cytoplasmic membrane of the organism (Quentin et al., 1982). Fengycins retained a strong fungitoxic activity against filamentous fungi (Koumoutsi et al., 2004; Vanittanakom et al., 1986; Hofemeister et al., 2004), our study also demonstrated that the antibiotics produced by SQR 9 significantly inhibited growth of F. oxysporum, Verticillium dahliae, Phytophthora capsici and Phytophthora nicotianae. The action of fengycins consisted of interaction with lipid layers and of alteration of cell membrane structure and permeability (Deleu et al., 2005). Other antibiotics of subtilosin, subtilisin and surfactin were not detected in SQR 9 culture filtrates, probably because the processes of culture implemented are not optimized or because the lack of an essential gene prevents the expression of this phenotype (Tapi et al., 2010).

Formulation and delivery of an antagonist were important for successful biocontrol under normal growing conditions (Knudsen et al., 1991; Thangavelu et al., 2004). The organic fertilizer provided good nutrients to antagonists to ensure a high inoculum dose to the plants at the times of treatment (Ling et al., 2010). The newly formulated bio-organic fertilizer could inhibit F. oxysporum growth in the soil. The pathogen populations were significantly lower in BIO-treated soils than in CK (Fig. 5), suggesting that application of BIOs in the soil could significantly inhibit the invasion of F. oxysporum into plant roots. These results were in agreement with the report by Muslim et al. (2003), who indicated that tomato seedlings inoculated with hypovirulent binucleate Rhizoctonia had significantly lower pathogen densities for all diseases studied. The decreased population of F. oxysporum might be closely related to the reduced disease incidence in BIOs treatments (Zhao et al., 2011). B. subtilis SQR 9 proved to be an excellent root colonizer in the control of cucumber Fusarium wilt (Cao et al., 2011). In this work, we have provided experimental evidence represented by the presence of the antifungal compounds bacillomycin and fengycin, which supported the early assumption that antibiosis might be another main mode of action displayed by the strain in disease control. All of these features should come together to one action that is to provide better efficient disease control. 5. Conclusions Combination of organic fertilizer with the antagonist B. subtilis SQR 9 significantly reduced the incidence of Fusarium wilt disease of cucumber. Fengycin and bacillomycin analogs were detected in SQR 9 culture filtrate. The lipopeptide production was pursued as another possible mechanism underlying the biocontrol of Fusarium wilt disease by SQR 9. This provides a theoretical basis for the development of commercial bio-organic fertilizers with different functional biocontrol agents. Acknowledgments This research was financed by National Nature Science Foundation of China (40871126), by Chinese Ministry of Science and Technology (2010AA10Z401) and by Department of Science and Technology of Jiangsu Province (2009120). References Ahn, I.P., Chung, H.S., Lee, Y.H., 1998. Vegetative compatibility groups and pathogenicity among isolates of Fusarium oxysporum f. sp. cucumerinum. Plant Dis. 82, 244–246. Armstrong, G.M., Armstrong, J.K., 1981. Formae speciales and races of Fusarium oxysporum causing wilt disease. In: Nelson, P.E., Toussoun, T.A., Cook, R.J. (Eds.), Fusarium: Disease, Biology, and Taxonomy. Pennsylvania State University Press, University Park, PA, pp. 391–399. Asaka, O., Shoda, M., 1996. Biocontrol of Rhizoctonia solani damping off of tomato with Bacillus subtilis RB14. Appl. Environ. Microbiol. 62, 4081–4085. Atlas, R.M., 1995. Handbook of Media for Environmental Microbiology. CRC, Boca Raton, FL. Bais, H.P., Fall, R., Vivanco, J.M., 2004. Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol. 134, 307–319. Brownlee, K.A., Delves, C.S., Dorman, M., Green, C.A., Grenfell, E., Johnson, J.D.A., Smith, N., 1948. The biological assay of streptomycin by a modified cylinder plate method. J. Gen. Microbiol., 40–53. Cao, Y., Zhang, Z., Ling, N., Yuan, Y., Zheng, X., Shen, Q., 2011. Bacillus subtilis SQR 9 can control Fusarium wilt in cucumber by colonizing plant roots. Biol. Fertil. Soils 47, 495–506. Cazorla, F.M., Romero, D., Pérez-García, A., Lugtenberg, B.J.J., de Vicente, A., Bloemberg, G., 2007. Isolation and characterization of antagonistic Bacillus subtilis strains from the avocado rhizoplane displaying biocontrol activity. J. Appl. Microbiol. 103, 1950–1959. Chen, H., Wang, L., Su, C., Gong, G., Wang, P., Yu, Z., 2008. Isolation and characterization of lipopeptide antibiotics produced by Bacillus subtilis. Lett. Appl. Microbiol. 47, 180–186.

Y. Cao et al. / Scientia Horticulturae 135 (2012) 32–39 Chen, L., Yang, X., Waseem, R., Li, J., Liu, Y., Qiu, M., Zhang, F., Shen, Q., 2011a. Trichoderma harzianum SQR-T037 rapidly degrades allelochemicals in rhizospheres of continuously cropped cucumbers. Appl. Microbiol. Biotechnol. 89, 1653–1663. Chen, L., Yang, X., Waseem, R., Luo, J., Zhang, F., Shen, Q., 2011b. Solid-state fermentation of agro-industrial wastes to produce bioorganic fertilizer for the biocontrol of Fusarium wilt of cucumber in continuously cropped soil. Biores. Technol. 102, 3900–3910. Chung, S., Kong, H., Buyer, J.S., Lakshman, D.K., Lydon, J., Kim, S., Roberts, D.P., 2008. Isolation and partial characterization of Bacillus subtilis ME488 for suppression of soilborne pathogens of cucumber and pepper. Appl. Microbiol. Biotechnol. 80, 115–123. Compant, S., Clément, C., Sessitsch, A., 2010. Plant growth-promoting bacteria in the rhizo- and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biol. Biochem. 42, 669–678. Deleu, M., Paquot, M., Nylander, T., 2005. Fengycin interaction with lipid monolayers at the air-aqueous interface—implications for the effect of fengycin on biological membranes. J. Colloid Interface Sci. 283, 358–365. El-Hassan, S.A., Gowen, S.R., 2006. Formulation and delivery of the bacterial antagonist Bacillus subtilis for management of Lentil vascular wilt caused by Fusarium oxysporum f. sp. lentis. J. Phytopathol. 154, 148–155. Hofemeister, J., Conrad, B., Adler, B., Hofemeister, B., Feesche, J., Kucheryava, N., Steinborn, G., Franke, P., Grammel, N., Zwintscher, A., 2004. Genetic analysis of the biosynthesis of nonribosomal peptide- and polyketide-like antibiotics, iron uptake and biofilm formation by Bacillus subtilis A1/3. Mol. Genet. Genomics 272, 363–378. Hoitink, H.A.J., Fahy, P.C., 1986. Basis for the control of soilborne plant pathogens with composts. Anu. Rev. Phytopathol. 24, 93–114. Hoitink, H.A.J., Boehm, M.J., 1999. Biocontrol within the context of soil microbial communities: a substrate-dependent phenomenon. Annu. Rev. Phytopathol. 37, 427–446. Howell, C.R., 2003. Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis. 87, 4–10. Josie, W., John, M.C., Peter, R.M., Richard, M.C., 2003. A selective medium for quantitative reisolation of Trichoderma harzianum from Agaricus bisporus compost. Appl. Environ. Microbiol. 69, 4190–4191. Joshi, R., Gardener, B.B.M., 2006. Identification and characterization of novel genetic markers associated with biological control activities in Bacillus subtilis. Phytopathology 96, 145–154. Kinsella, K., Schulthess, C.P., Morris, T.F., Stuart, J.D., 2009. Rapid quantification of Bacillus subtilis antibiotics in the rhizosphere. Soil Biol. Biochem. 41, 374–379. Knudsen, G.R., Eschen, D.J., Dandurand, I.M., Bin, I., 1991. Potential for biocontrol of Sclerotinia sclerotiorum through colonization of sclerotia by Trichoderma harzianum. Plant Dis. 75, 466–470. Koumoutsi, A., Chen, X.H., Henne, A., Liesegang, H., Hitzeroth, G., Franke, P., Vater, J., Borriss, R., 2004. Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J. Bacteriol. 186, 1084–1096. Leclère, V., Béchet, M., Adam, A., Guez, J., Wathelet, B., Ongena, M., Thonart, P., Gancel, F., Chollet-Imbert, M., Jacques, P., 2005. Mycosubtilin overproduction by Bacillus subtilis BBG100 enhances the organism’s antagonistic and biocontrol activities. Appl. Environ. Microbiol. 71, 4577–4584. Lievens, B., Claes, L., Vakalounakis, D.J., Vanachter, A.C.R.C., Thomma, B.P.H.J., 2007. A robust identification and detection assay to discriminate the cucumber pathogens Fusarium oxysporum f. sp. cucumerinum and f. sp. radiciscucumerinum. Environ. Microbiol. 9, 2145–2161. Ling, N., Xue, C., Huang, Q., Yang, X., Xu, Y., Shen, Q., 2010. Development of a mode of application of bioorganic fertilizer for improving the biocontrol efficacy to Fusarium wilt. BioControl 55, 673–683. Lugtenberg, B., Kamilova, F., 2009. Plant-growth-promoting Rhizobacteria. Anu. Rev. Microbiol. 63, 541–556. Luo, J., Ran, W., Hu, J., Yang, X., Xu, Y., Shen, Q., 2010. Application of bio-organic fertilizer significantly affected fungal diversity of soils. Soil Sci. Soc. Am. J. 74, 2039–2048. Moran, S., Robertson, K., Paradisi, F., Rai, D.K., Murphy, C.D., 2010. Production of lipopeptides in Bacillus sp. CS93 isolated from Pozol. FEMS Microbiol. Lett. 304 (1), 69–73. Moyne, A.L., Shelby, R., Cleveland, T.E., Tuzun, S., 2001. Bacillomycin D: an iturin with antifungal activity against Aspergillus favus[J]. J. Appl. Microbiol. 90, 622–629. Moyne, A.L., Cleveland, T.E., Tuzun, S., 2004. Molecular characterization and analysis of the operon encoding the antifungal lipopeptide bacillomycin D. FEMS Microbiol. Lett. 234, 43–49. Muslim, A., Horinouchi, H., Hyakumachi, M., 2003. Biological control of fusarium wilt of tomato with hypovirulent binucleate Rhizoctonia in greenhouse conditions. Mycoscience 44, 77–84.

39

Ongena, M., Duby, F., Jourdan, E., Beaudry, T., Jadin, V., Dommes, J., Thonart, P., 2005a. Bacillus subtilis M4 decrease plant susceptibility towards fungal pathogens by increasing host resistance associated with differential gene expression. Appl. Microbiol. Biotechnol. 67, 692–698. Ongena, M., Jacques, P., 2008. Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol. 16 (3), 115–125. Ongena, M., Jacques, P., Touré, Y., Destain, J., Jabrane, A., Thonart, P., 2005b. Involvement of fengycin-type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl. Microbiol. Biotechnol. 69, 29–38. Ongena, M., Jourdan, E., Adam, A., Paquot, M., Brans, A., Joris, B., Arpigny, J.L., Thonart, P., 2007. Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environ. Microbiol. 9, 1084–1090. Quentin, M.J., Besson, F., Peypoux, F., Michel, G., 1982. Action of peptidolipidic antibiotics of the iturin group on erythrocytes. Effect of some lipids on hemolysis. Biochim. Biophys. Acta 684, 207–211. Rampach, G.S., Kloepper, J.W., 1998. Mixtures of plant growth-promoting rhizobacteria enhance biological control of multiple cucumber pathogen. Phytopathology 88, 1158–1164. Romero, D., de Vicente, A., Rakotoaly, R.V., Dufour, S.E., Veening, J.W., Arrebola, E., Cazorla, F.M., Kuipers, O.P., Paquot, M., Perez-Garcia, A., 2007. The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. Mol. Plant Microbe Interact. 20, 430–440. Roongsawang, N., Thaniyavarn, J., Thaniyavarn, S., Kameyama, T., Haruki, M., Imanaka, T., Morikawa, M., Kanaya, S., 2002. Isolation and characterization of a halotolerant Bacillus subtilis BBK-1 which produces three kinds of lipopeptides: bacillomycin L, plipastatin, and surfactin. Extremophiles 6, 499–506. Sambrook, J., Fitsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Stein, T., 2005. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol. Microbiol. 56 (4), 845–857. Swain, M.R., Ray, R.C., 2006. Biocontrol and other beneficial activities of Bacillus subtilis isolated from cowdung microflora. Microbiol. Res., doi:10.1016/j.micres.2006.10.009. Szczech, M., Shoda, M., 2006. The effect of mode of application of Bacillus subtilis RB14-C on its efficacy as a biocontrol agent against Rhizoctonia solani. J. Phytopathol. 154, 370–377. Tapi, A., Chollet-Imbert, M., Scherens, B., Jacques, P., 2010. New approach for the detection of non-ribosomal peptide synthetase genes in Bacillus strains by polymerase chain reaction. Appl. Microbiol. Biotechnol. 85, 1521–1531. Thangavelu, R., Palaniswami, A., Velazhahan, R., 2004. Mass production of Trichoderma harzianum for managing fusarium wilt of banana. Agric. Ecosys. Environ. 103, 259–263. Trillas, M.I., Casanova, E., Corxarrera, L., Ordovas, J., Borrero, C., Aviles, M., 2006. Composts from agricultural waste, the Trichoderma asperellum strain T-34 suppress Rhizoctonia solani in cucumber seedlings. Biol. Control 39, 32–38. Turner, J.T., Backman, P.A., 1991. Factors relating to peanut yield increases after seed treatment with Bacillus subtilis. Plant Dis. 75, 347–353. Vanittanakom, N., Loeffler, W., Koch, U., Jung, G., 1986. Fengycin—a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J. Antibiot. 39, 888–901. Wang, J., Liu, J., Wang, X., Yao, J., Yu, Z., 2004. Application of electrospray ionization mass spectrometry in rapid typing of fengycin homologues produced by Bacillus subtilis. Lett. Appl. Microbiol. 39, 98–102. Waseem, R., Yang, X., Wu, H., Wang, Y., Xu, Y., Shen, Q., 2009. Isolation and characterisation of fusaricidin-type compound-producing strain of Paenibacillus polymyxa SQR-21 active against Fusarium oxysporum f. sp. nevium. Eur. J. Plant Pathol. 125, 471–483. Wu, H.S., Waseem, R., Liu, D., Wu, C., Mao, Z., Xu, Y., Shen, Q., 2008. Allelopathic impact of artificially applied coumarin on Fusarium oxysporum f. sp. niveum. World J. Microbiol. Biotechnol. 24, 1297–1304. Yang, X., Chen, L., Yong, X., Shen, Q., 2010. Formulations can affect rhizosphere colonization and biocontrol efficiency of Trichoderma harzianum SQR-T037 against Fusarium wilt of cucumbers. Biol. Fertil. Soils 47, 239–248. Yu, G.Y., Sinclair, J.B., Hartman, G.L., Bertagnolli, B.L., 2002. Production of iturin A by Bacillus amyloliquefaciens suppressing Rhizoctonia solani. Soil Biol. Biochem. 34, 955–963. Zhang, N., Wu, K., He, X., Li, S., Zhang, Z., Shen, B., Shen, Q., 2011. A new bioorganic fertilizer can effectively control banana wilt by strong colonization with Bacillus subtilis N11. Plant Soil, doi:10.1007/s11104-011-0729-7. Zhang, S.S., Raza, W., Yang, X.M., Hu, J., Huang, Q.W., Xu, Y.C., Liu, X.H., Ran, W., Shen, Q.R., 2008. Control of Fusarium wilt disease of cucumber plants with the application of a bioorganic fertilizer. Biol. Fertil. Soils 44, 1073–1080. Zhao, Q.Y., Dong, C.X., Yang, X.M., Mei, X.L., Ran, W., Shen, Q.R., 2011. Biocontrol of Fusarium wilt disease for Cucumis melo melon using bio-organic fertilizer. Appl. Soil Ecol. 47, 67–75.