Isolation and promoter mapping of the gene encoding murine co-stimulatory factor B7-1

GENE AN INTERNATIONAL dOURNAL GENES AND OENOME5

ELSEVIER

ON

Gene 183 (1996) 1-6

Isolation and promoter mapping of the gene encoding murine co-stimulatory factor B7-1 Haiying Zhang *, Deanna Haasch, Kenneth B. Idler, Gregory F. Okasinski Department of Growth Factor Research, Pharmaceutical Products Division, Abbott Laboratories D-4MG, AP9A, 100 Abbott Park Road, Abbott Park, IL 60064, USA Received 3 February 1996; revised 1 April 1996; accepted 12 April 1996

Abstract BT- l is one of the co-stimulatory factors which plays an important role in immunity. We have cloned and functionally mapped the promoter of the murine B7-1 gene using transient transfection assays in mouse L (tk-) cells. The B7-1 basal promoter consists of three positively regulated regions. The distal region, located at -2597 to - 1555, contains an assortment of putative transcription factor binding sites. The proximal upstream region, located at - 1 3 0 to - l l 0 , contains a tandem repeat sequence 5'GTGTTCTAGTGTT-3'. A downstream region is positioned at + 269 to + 25. We have also identified an alternatively spliced form of the murine BT-1 gene in L (tk-) cells. Keywords: Transfection; Luciferase reporter; Immunity; Nucleotide sequence; L (tk-) cells; Transcription factor; RT-PCR

1. Introduction Complete activation of naive T cells requires at least two distinct biological signals. One signal is mediated by the interaction between T-cell receptors ( T C R ) and peptides bound to M H C molecules on the surface of antigen presenting cells (APC). The second signal is provided by costimulatory molecules on the surface of A P C interacting with specific counter-receptors on the surface of T cells. In the absence of the second signal, T C R signaling can induce a long-lasting anergic state in which an appropriate presentation of antigen fails to elicit lymphokine production (Brestcher and Cohn, 1970; Lafferty and Cunningham, 1975; Muller et al., 1989; Liu et al., 1992). * Corresponding author. Tel. + 1 847 9384857; Fax + 1 847 9386046; e-mail:[email protected] Abbreviations: APC, antigen-presenting cell(s); ATCC, American Type Culture Collection; B7-1, a B cell activation antigen; B7-1, gene encoding B7-1; 13Gal,13-galactosidase;BHK, baby hamster kidney; bp, base pair(s); kb, kilobase(s) or 1000 bp; Luc, luciferase light unit; MEM, minimal essential medium; MHC, major histocompatibility complex; NF, nuclear factor; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RLU, luciferase activity/13Gal unit; RT-PCR, reverse transcription polymerase chain reaction; TCR, T-cell receptor(s); tsp, transcription start point. 0378-1119/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved PH S0378-1119(96) 00362-9

B7, a family of costimulatory factors, is the most potent of all of the costimulatory molecules known. Several lines of evidence from both in vitro and in vivo studies have shown that the interaction of B7 molecules with their counter-receptors, CD28 and CTLA4, plays an important role in T cell clonal expansion and in the induction of effector functions(Allison, 1994; Powers et al., 1994). Interruption of the interaction of CD28 with its ligand blocks T cell activation and results in clonal anergy (Sperling et al., 1993). M a n y studies have shown the importance of this signal pathway in relation to tissue transplantation, autoimmune diseases and protective immunity against tumors (Blazar et al., 1994; Verwilghen et al., 1994; Matulonis et al., 1995) Little is known about the transcriptional regulation of BT-1 expression. Here we report the cloning and mapping of the murine B7-1 basal promoter using transfection assays and the discovery of an alternatively spliced form of the B7-1 message.

2. Experimental and discussion 2.1. Isolation, sequencing and subcloning o f the promoter region o f the B7-1 gene A D N A fragment containing the mouse B7-1 5'-flanking region was obtained by screening a mouse

2

H. Zhang et al./Gene 183 ~1996) 1-6

g e n o m i c D N A l i b r a r y in the v e c t o r ~, F I X II ( S t r a t a g e n e , L a Jolla, C A ) using an oligo p r o b e ( E x o n l ) c o r r e s p o n d ing to a p o r t i o n o f the exon 1 sequence o f m o u s e B7-1 c D N A ( F r e e m a n et al., 1991; Table 1). A s a n initial step t o w a r d s the g o a l o f m a p p i n g the B7-1 p r o m o t e r , a 3.4 k b XbaI f r a g m e n t f r o m a g e n o m i c clone in X F i x I I was sequenced a n d s u b c l o n e d into the S m a I site o f the PXP1 v e c t o r ( A T C C ) d e s i g n a t e d as - 3 0 8 4 ( G e n B a n k accession N o . U33063). O f the 3357 nt sequenced, 3084 were 5' to the tsp d e t e r m i n e d b y S e l v a k u m a r et al. (1993) a n d the l o c a t i o n o f this tsp was r e - c o n f i r m e d in o u r l a b o r a t o r y using in vitro t r a n s c r i p t i o n a n d p r i m a r y extension ( d a t a n o t shown). T h e sequence was a n a l y z e d for the presence o f p u t a t i v e b i n d i n g sites for t r a n s c r i p tion factors k n o w n to regulate gene expression in o t h e r systems. N u m e r o u s p o t e n t i a l t r a n s c r i p t i o n f a c t o r b i n d ing sites in the B7-1 p r o m o t e r region suggested t h a t a systematic f u n c t i o n a l analysis o f the 5' a n d 3'-flanking D N A was necessary to identify f u n c t i o n a l basal p r o m o t e r elements. Therefore, a series o f 5', 3' a n d internal d e l e t i o n c o n s t r u c t s were g e n e r a t e d f r o m the p a r e n t c o n s t r u c t - 3 0 8 4 to test for p r o m o t e r activity. In o r d e r to d e t e r m i n e w h e t h e r L ( t k - ) , a m o u s e f i b r o b l a s t cell line, c o n t a i n e d the a p p r o p r i a t e t r a n s c r i p t i o n a l m a c h i n e r y for B7-1 b a s a l expression a n d c o u l d be used to m a p the B7-1 p r o m o t e r , R T - P C R was p e r f o r m e d . Tissue f r o m C B 6 F I mice was used in R T - P C R as the controls. T h e R T - P C R d a t a is shown in ( F i g . 1). We were able to detect two b a n d s w h e n a p r o b e which c o v e r e d the j u n c t i o n between e x o n l a n d exon2 ( E x o n l a n d 2) was used. H o w e v e r , when Exon5 was used as p r o b e , three b a n d s were detected. T h e t o p b a n d is the expected f o r m (1210 nt) o f the B7-1 message. T h e b o t t o m b a n d is an a l t e r n a t i v e l y spliced f o r m o f the m u r i n e h o m o l o g u e o f B7-1 message, which was also o b s e r v e d a n d i s o l a t e d b y I n o b e et al. (1994) when an identical p a i r o f p r i m e r s + 2 6 3 a n d E x o n 5 b ( T a b l e 1) were used in R T - P C R . (Specifically, exon3 has been spliced o u t f r o m this f o r m o f the B7-1 message). T h e m i d d l e b a n d m a y be a different f o r m o f a l t e r n a t i v e l y spliced p r o d u c t s l a c k i n g the sequence t h a t hybridizes with the exon2 p r o b e . This w o u l d e x p l a i n w h y the Table 1 Oligonucleotides used in this study Designation

Sequence (5' to 3')

Sense

+263 +27 -44 -214 Exon 1

CTAAGCTCCATTGGCTCTAGATTC GATTCAGAACTCTCACTCTG GAACAGGCCTGGACAAGTCA CTTTCATGGCCTAGCTGCTA GAGTTTTATACCTCAATAGACTCTTACTAG CACAAGTGTCTTCAGATGTTG CTGACTTGGACAGTTGTTCA TAGTTCTTCTCTGTCCATGTGGGA CTCATGAGCCACATAATACCATGT

+ + + + +

Exon Exon Exon Exon

1, 2 2 5a 5b

+ +

EI~

"1

23

~-

r-

~

M.W.

(Kb)

1.0

0.5

Fig. 1. Expression of endogenous B7-1 gene in L (tk-) cells. Murine B7-1 gene is expressed in L ( t k ) cells as well as in lung, spleen and thymus of CB6F 1 mice, but not in the muscle, as detected by RT-PCR. Oligo + 263 was used as the 5' primer and Exon5b was used as the 3' i~rimer. The PCR product was hybridized with both B7-1 oligo Exon2 (a) and Exon5a (b). Methods: RT-PCR was performed using the standard methods indicated by the Perkin Elmer kit (Perkin Elmer, Foster City, CA). Total RNA was prepared from tissues from CB6FI mice and L (tk-) cells. The samples were treated with DNase. 1 gg of each sample was reverse transcribed using MuLV Reverse Transcriptase and oligo (dT)l 6. The entire reverse transcription reaction was used in the PCR which included 0.8 pM of each primer for 30 cycles. The PCR primers and oligos used in this study are summarized in Table 1 and Fig. 4a. PCR was performed in the Perkin Elmer DNA Thermal Cycler 480. m i d d l e b a n d is only d e t e c t a b l e b y the E x o n 5 a p r o b e a n d n o t b y the E x o n 2 p r o b e . Overall, similar forms o f B7-1 messages were detected in L ( t k - ) cells as well as in lung, spleen a n d t h y m u s tissue f r o m a CB6F1 mouse. B7-1 message was n o t detected in muscle tissue. Therefore, L ( t k ) cells were chosen for the transfection assays in this study. 2.2. Three regions are important to confer mouse B7-1 promoter activity

T h e d e l e t i o n c o n s t r u c t s o f the m o u s e B7-1 p r o m o t e r are illustrated in Fig. 2. T r a n s f e c t i o n results o f these c o n s t r u c t s are s h o w n in Fig. 3. T h r e e m a j o r r e d u c t i o n s in the p r o m o t e r activity a m o n g the set o f deletion c o n s t r u c t s were found. (i) BOth - 1 5 5 1 / + 2 6 9 , a 5' d e l e t i o n c o n s t r u c t a n d A - 2 5 9 7 / - 1551, an internal deletion construct, s h o w e d r e d u c t i o n s in luciferase activity by 38% a n d 36%, respectively. (ii) D e l e t i o n o f the sequence between - 215 a n d - 51 r e d u c e d the luciferase

H. Zhang et al./Gene 183 (1996) 1-6

3

MB7-1 Promoter Deletion Constructs Smot/Xl~

ml

143

I

I

I

]OMi/I~II1

Xbel~l

I

I

-21§ +1

~÷~,eo

t

+2611

J

I

+1

+35

Bgl It/Ncol

I

I

I

I

I

-2sos/.2w

+1

~ I

Eco4'nll

I

-t4~V,t,~

I

I

I

I

I

I

+1 I

-140

-1551/*260

I

-1073/+260

XkmVe~mmt

+1 I

I

+1 ",,25

i

-215/+269

I

-511+26t)

t

i

-130

+1

I

-,~.~

+1 [

XI~&'Smo1

+1 I S~I/X]boI

ml

~

t

l~nml/Xllml

1-13

i

I

I

-I10

+1

I

+1

l

-.~*~

XI~'Sml

Xlxd/Smal

I

i

A-2597/-1 SS5

I

i

-60

+1

I

+,-Is~-1om

+1

~tl

I

I

+1 XI~I/Smal

H3

8molOtl~d

-371+269

I

XboltSmml ..30/.~S

I -30

-215

+1 +IS

Sllnal~

I

I~

A-15771+269

Xbal/Smal

t

I

I

+1

+260

-2151+269

Xl~tl/Smal I

I +1

I +94

-215/+94

Xl~lll,'~llta 1

I

i

+1

m

-215/+25

+25

Fig. 2. Schematic representation of the deletion constructs of the murine B7-1 gene promoter used in the transfection assays in Fig. 3. Constructs containing indicated sequences were placed upstream of the luciferase gene (shaded bar).

activity by 48%. The results from the set of detailed 5' deletion constructs further showed that a 20 nt sequence between - 1 3 0 to - 1 1 0 , in the - 2 1 5 / + 2 5 construct, was important and conferred 70% luciferase activity (Fig. 3b). Within this 20 nt there is imbedded a tandem repeat sequence 5'-GTGTTCTAGTGTT-3'. A search of the transcription data base with this sequence was performed. None of the known transcription factors have been reported to bind to this sequence. However, we did find protein(s) that specifically bind to this sequence using nuclear extracts from L ( t k - ) and Raji

cells (unpublished data). When the mouse B7-1 promoter was deleted to - 3 7 , little luciferase activity remained. (iii) The data from the 3' deletion analysis suggests that downstream sequence of the B7-1 promoter is important to the promoter activity since constructs - 2 1 5 / + 94 and - 2 1 5 / + 2 5 conferred 33% and 10% luciferase activity, respectively, compared with the - 215/+ 269 promoter construct. It is not clear whether these sequences are important for the stability of the message or if they directly contribute to promoter strength at the transcriptional level.

4

H. Zhang et aL/Gene 183 (1996) 1 6 B7-1 Constructs

%RLU

-3084/+269 -2595/+269 -1551/+269 -1073/+269 -215/+269 -51/+269 -37/+269 ,~-2597/-1555 A-1556/-1063 ~,-215/+269 ,~-1577/+269

1O0 91 (20) 53 (11) 58 (13) 68 (17) 20 (3.1) 4.8 (1.5) 64 (12) 96 (7.3) 0.40 (0.00) 0.33 (0.05)

-215/+25 -149/+25 -130/+25 -110/+25 -60/+25 -30/+25

1O0 94 (6.4) 80 (5.7) 10 (0.64) 24 (2.1) 6.5 (0.85)

-215/+269 -215/+94 -215/+25

1O0 34 (0.71) 8.8 (0.14)

4000

3500 3000 , m

=

2500

m

¢t~zt 2000 1500 1000 500 0

I ~ 1 -215/+25 -149/+25 -130/+25 -110/+25 -60/+25

0 = standard deviation of the mean

~

-30/+25

_ PXP1

Constructs

Fig. 3. (a) Percentage of luciferase activity of murine B7-1 promoter constructs calculated from the luciferase activity (RLU) obtained from the transfection assays. The results are mean values of three separate transfections. Each transfection was performed in duplicate or triplicate. (b) The bar graph shows the results of the detailed 5'-deletion mapping of the murine B7-1 promoter in L (tk) cells. This result is the mean values of a representative transfection peformed in duplicate. RLU was calculated as Luc/[3Gal unit. Methods: Each 10-cm dish of cells was transfected with 3 picomoles of test plasmid and 1 picomole of pRSV-~Gal using calcium phosphate precipitation. The cell extracts were assayed for the amount of total protein by the Bradford method. [3Gal activity (~Gal unit/ug protein/minute) was determined to normalize transfection efficiency (Zhang and Young, 1993). Luc was measured by a luminometer (EG&G Berthold LB 9501/16, Nashua, NH).

2.3. An alternatively spliced form o f B7-1 message was detected by R T - P C R in L (tk-) cells Selvakumar et al. (1993) determined the tsp of the mouse B7-1 gene by primer extension in CH1 cells, a mouse B7-1 positive B-cell lymphoma cell line. Our in vitro transcription and primer extension data also confirmed these results (data not shown). More recently, Borriello et al. (1994) showed by RACE that the 5'-untranslated region of the B7-1 promoter extends over 1505 nt upstream of the previously reported tsp. Our functional mapping data supports Selvakumar's results. There was only 0.4% luciferase activity left when sequence from - 215 to + 296 (construct - 215/+ 296) was deleted. However, the deletion construct A - 1 5 5 6 / - 1 0 6 3 in which, presumably, the promoter indicated by Borriello et al. (1994) is located retained 96% luciferase activity. To further study this discrepancy, a series of primers were designed (Table 1 and Fig. 4a) and R T - P C R was performed. Fig. 4b-d shows the R T - P C R results. The even numbered lanes are the R T - P C R controls without reverse transcriptase. Exon5a was used as the probe. As expected, only one product was detected when oligo Exon2 was used as the 3' primer and three R T - P C R products were detected when oligo Exon5b was used as the 3' primer. Overall, the

R T - P C R results showed that the messages with the expected size (Fig. 4a) can be detected when 5' primers are used starting from - 4 4 , + 27 and + 263. However, there were no products of the expected size of the B7-1 message detectable in our experiment when 5' primers were used starting at - 2 1 4 and beyond. When a 5' primer at - 2 1 4 and a 3' primer in exon 2 were used for PCR, a 662 nt product was expected (Fig. 4a). However, we detected a smaller R T - P C R product, 363 nt (Fig. 4b, lane 13), which hybridized with the B7-1 Exonl and 2 probe. Sequencing data of this fragment showed (Fig. 5) that 299 nt from - 1 8 8 to +111 was spliced out; the junction sequence showed the precise features required for intron/exon excision. We were not surprised to find that in our experiments, B7-1 messages were readily detectable using 5' primers starting at - 4 4 since the B71 gene is controlled by a TATA less promoter which often initiates messages at multiple sites and we also detected another initiation site at - 7 5 in the in vitro system (data not shown). However, the alternatively spliced message (Fig. 5) which lacks the B7-1 cap site (--188 to + 111) suggests the possibility of two functional promoters. Multipromoter genes have been reported such as, chicken filamin and human neuronal nitric oxide synthase (Barry et al., 1993; Xie et al., 1995). In the case of chickenfilamin, a secondfilamin promoter

H. Zhang et al./Gene 183 (1996) 1-6

5

Exonl Exon5a 3'Prlmer

Exonl & 2 5' P r i m e r m

I

/ /

I'

+ +

+ +

/ +27

+

+

4. +

+

Reverse Transcriptase + M.W. (Kb)

7-->~

+

÷

F] - 4-214 4 _+263

"

+263-~

+2

[Exon5b kExon2

1

+

4. +

+

+

+

+

4.

4.

4.

+

-

+

-

+

+

+

+

÷

-

+

+

-

+

-

+

-

+

--

+

2

3

4

5

6

7

8

9

1 0 11 1 2 1 3 1 4 i!]

-4 4 - ~

-2 1 4-->" ~--Exo n 2

1

~--Exon5b

The e x o e c t e d size of the R T - P C R p r o d u c t s 5'pnmer

+263

+27

FLI¢XO 2

5" P r i m e r

--214 -44 427 L+2S3

421nt 1446nt

492nt 1517~

662nt 1687nt 3" P r i m e r

+

+

4.

+

÷ +

Reverse Tranecrlptase M.W.

-214

o.2 -~Ei: )

3'pnmers Exon2 185nt Exon5b 1210nt

3" P r i m e r

-44

+

4-

÷

+

+

+

+

4.

4-

5" P r i m e r

C kExo

5b

+

+

+

'-214 -44 +27

[_+263

+

+

+

+

+

+

+

+

+

+

-

+

-

+

-

+

-

2

3

4

5

6

7

8

+

+

Reverse Transcriptase

+

M,W.

1

+ -

+

-

+

-

÷

2 3 4 5 6 7 .o..,..............................................

8

(Kb)

i:.:

"

"°tl ii

,.o n

ii }~:iii~iiiiii

o.s -i~i~iiiiiiiiiii "

ii 5::

+

!~ ~

~::ii::;g~,,~s!{::iiii!iii~ii::)::i::::O

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

I.II,I]T,TI--

I''--

Fig. 4. A n alternatively spliced form of B7-1 message, which lacks the cap site region, was detected by R T - P C R . (a) Schematic representation of the primers used in this experiment along with the expected size of the P C R products. The horizontal bold line represents exons of the B7-1 gene. (b) R T - P C R was performed on L ( t k - ) cells as described in Fig. 1. (e and d) Hybridization blots of the P C R products. Oligo Exonl and 2 was used as the probe in (c); oligo Exon5a was used as the probe in (d).

is located at least 8 kb upstream from the downstream promoter. Our data and the results published by Borriello et al. (1994) suggest the possibility that B7-1 is another gene regulated by multipromoters.

3. Conclusions

(1) 3084 nt of 5' sequence of mouse B7-1 has been cloned and sequenced.

6

H. Zhang et al./Gene 183 (1996) 1 6 CTTT CATGGCCTAG

CTGCTAGTGA

AG_CI~TCTCTG

-181

CTTTTTTTTG

GCTGTTGTAT

GTGAAATGGG

GTTGGGTGGG

AACCACCTCA

CTGTGTTCTA

-121

GTGTTAGTCA

CCCCACCCCC

GCAAGCAGAA

TCCTTTTACC

CAGCTTTTTC

ACCCAGCTGT

-61

GCTCACCCGG

TGCTCAGAAC

AGGCCTGGAC

AAGTCACCTC

CCCTAGAGTT

CTGGGGACCT

-1

TTAGATTGCC

CTCATGGCCA

CACCCTGATT

CAGAACTCTC

ACTCTGTCGT

AAGATAGAGC

60

TACTGGGGAG

TTTTATACCT

CAATAGACTC

TTACTAGTTT

CTCTTTTTCA

GGTTGTGAAA

120

CTCAACCTTC

AAAGACACTC

TGTTCCATTT

CTGTGGACTA

ATAGGATCAT

CTTTAGCATC

180

TGCCGGGTGG

ATGCCATCCA

GGCTTCTTTT

TCTACATCTC

TGTTTCTCGA

TTTTTGTGAG

240

CCTAGGAGGT

GCCTAAGCTC

CATTGGCTCT

AGA

273

Fig. 5. Nucleotide sequence of an alternatively spliced junction in the 363 nt RT-PCR product with -214 as the 5' primer and Exon2 as the 3' primer. The spliced out sequence is indicated in plain text. The consensus sequence for the intron/exon splicing is underlined. Numbering corresponds to the position relative to the tsp. (2) Three positively regulated regions have been defined in the B 7 - 1 p r o m o t e r . (3) A n o v e l a l t e r n a t i v e l y spliced f o r m o f B 7 - 1 m e s s a g e , w h i c h l a c k s t h e c a p site r e g i o n , w a s d e t e c t e d by R T - P C R in L ( t k - ) cells.

Acknowledgement T h e a u t h o r s w o u l d like to t h a n k D e n n i s F r y a n d S e t h C r o s b y f o r f r u i t f u l d i s c u s s i o n s a n d critical r e v i e w o f t h e m a n u s c r i p t a n d T i m B o i l i n g f o r t e c h n i c a l a s s i s t a n c e in computer applications.

References Allison, J.P. (1994) CD28-B7 Interactions in T-cell activation. Current Biology Ltd, pp. 414-419. Barry, C.P., Xie, J., Lemmon, V. and Young, A.P. (1993) Molecular characterization of a multipromoter gene encoding a chicken filamin protein. J. Biol. Chem. 268, 25577-25586. Blazar, B.R., Taylor, P.A., Linsley, P.S. and Vallera, D.A. (1994) In vivo blockade of CD28/CTLA4: B7/BB 1 interaction with CTLA4-Ig reduces lethal murine graft-versus-host disease across the major histocompatibility complex barrier in mice. Blood, 83, 3815-3825. Borriello, F., Freeman, G.J., Edelhoff, S., Disteche, C.M., Nadler, L.M. and Sharpe, A.H. (1994) Characterization of the murine B71 genomic locus reveals an additional exon encoding an alternative cytoplasmic domain and a chromosomal location of chromosome 16, band B5. J. Immunol. 153, 5038 5048. Brestcher, P. and Cohn, M. (1970) A theory of self-nonself discrimination. Science, 169, 1042 1049. Freeman, G.J., Gray, G.S., Gimmi, C.D., Lombard, D.B., Zhou, L.-J., White, M. Fingeroth, J.D., Grivven, J.G. and Nadler, L.M. (199l) Structure, expression, and T cell costimulatory activity of the murine

homologue of the human B lymphocyte activation antigen B7. J. Exp. Med. 174, 525-531. Inobe, M., Linsley, P.S., Ledbetter, J.A., Nagai, Y., Tamakoshi, M. and Uede, T. (1994) Identification of an alternatively spliced form of the murine homologue of B7. Biochem. Biophys. Res. Commun. 200, 443 449. Lafferty, K.J. and Cunningham, A.J. (1975) A new analysis of alloreactivity. Aust. J. Exp. Biol. Med. Sci., 53, 27-42. Liu, Y., Jones, B., Brady, W., Janeway Jr., C.A. and Linsley, P.S. (1992) Co-stimulation of murine CD4 T cell growth: cooperation between B7 and heat-stable antigen. Eur. J. Immunol. 22, 2855 2859. Matulonis, U., Doisiou, C., Lamont, C., Freeman G.J., Nadler, L.M. and Griffin, J. (1995) Role of the B7-1 in mediating an immune response to myeloid leukemia cells. Blood, 85, 2507-2515. Muller, D.L., Jenkins, M.K. and Schwartz, R.H. (1989) Clonal expansion vs functional clonal inactivation: a costimulatory signalling pathway determines the outcome of T cell antigen occupancy. Annu. Rev. Immunol. 7, 445 480. Powers, G.D., Faherty, D.A., Connaughton, S.E., Biondi, D.A., Godfrey, D.I., Gault, A., Chen, C.-Y. and Nabavi, N. (1994) Expression and functional analysis of murine B7 delineated by a novel monoclonal antibody. Cell. Immunol. 153, 298-311. Selvakumar, A., White, P.C. and Dupont, B. (1993) Genomic organization of the mouse B-lymphocyte activation antigen B7. Immunogenetics 38, 292-295. Sperling, A.I., Linsley, P.S., Barrett, T.A. and Bluestone, J.A. (1993) CD28-mediated costimulation is necessary for the activation of Tcell receptor-76+ T lymphocytes. The J. Immunol. 151, 6043-6050. Verwilghen, J., Lovis, R., Boer, M.D., Linsley, P.S., Haines, G.K., Koch, A.E. and Pope, R.M. (1994) Expression of functional B7 and CTLA4 on rheumatoid synoval T cells. J. Immunol. 153, 1378 1385. Xie, J., Roddy, P., Rife, T.K., Murad, F. and Young, A.P. (1995) Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription. Proc. Natl. Acad. Sci. USA, 92, 1242 1246. Zhang, H. and Young, A. (1993) Exogenous, but not endogenous, glucocorticoid receptor induces glutamine synthetase gene expression in early stage embryonic retina. J. Biol. Chem., 268, 2850-2856.