Isolation, biochemical characterization and crystallization of the p15gag proteinase of myeloblastosis associated virus expressed in E. coli

0020-71IX/92 165.00+ 0.00 Copyright 0 1991 Pergamon Press plc

Int. J. Biochem.Vol. 24, No. 2, pp. 235-242, 1992 Printed in Great Britain. All rights reserved

ISOLATION, BIOCHEMICAL CHARACTERIZATION AND CRYSTALLIZATION OF THE p15gog PROTEINASE OF MYELOBLASTOSIS ASSOCIATED VIRUS EXPRESSED IN E. COL1 I. PICHOV&‘*

P. STROP,’ J. SEDLACEK,’ F. KAPR~~LEK,* V. BENES,’ M. TRAVNEEK,* S. FOUNDLING’

L. PAvLiCKov&’ M. SOUCEK,’ V. KOSTKA’ and

‘Institute of Organic Chemistry and Biochemistry, Czechoslovak Academy of Science, CS-166 10 Prague, Czechoslovakia [Tel. 3312-l I], *Institute of Molecular Genetics, Czechoslovak Academy of Science, (X-166 37 Prague, Czechoslovakia and ‘National Cancer Research Institute, Frederick Cancer Research Facility, Frederick, Md, U.S.A. (Received 15 March 1991) Abstract-l. The p15E’g proteinase responsible for the processing of the polyprotein precursor of the myeloblastosis associated virus was obtained by a recombinant technique in an E. coli expression system. The massive expression of the intentionally truncated precursor (Pr25’“‘-A’“9) was accompanied by its structurally correct processing. 2. Three procedures for the purification of the recombinant proteinase from both the cytoplasmic fraction and the inclusion bodies were developed. 3. The purified proteinase was compared with the authentic proteinase isolated from MAV virions by N-terminal sequence analysis and amino acid analysis, molecular weight determination, reverse-phase HPLC and FPLC elution profiles, electrophoretic mobility and isoelectric point determination, and activity assays with proteins and synthetic substrates. The identity of both enzymes was shown, 3. Contrary to reported data, the amino acid sequence of the plSgURproteinase differs from the sequence of the homologous Rous sarcoma virus proteinase in one residue only, as follows from cDNA sequencing. 4. Crystallization of the proteinase from a citrate-phosphate buffer at pH 5.6 afforded hexagonal crystals which diffracted well at 2.3 8, without deterioration,

INTRODUCTION

In all retroviruses the main open reading frames of the gng, pal and enu genes are translated as polypeptide precursors (Vogt and Eisenman, 1973). The gag and gag-@ polyproteins are then processed by a virus encoded proteinase during retrovirus maturation to infectious virions (Yoshinaka and Luftig, 1977). This important role of retroviral proteinases in the retrovirus replication life cycle makes them attractive targets of custom-synthesized inhibitors as possible therapeutic agents. In the Rous sarcoma virus (RSV) and in the myeloblastosis associated virus (MAV) the proteinases are typically encoded by the 3’ region of gag, the first open reading frame (ORF), whereas in mammalian retroviruses, such as the human immunodeficiency virus (HIV) by the 5’ region of pal, the second ORF. The bovine leukemia virus (BLV) proteinase is encoded by a separate short ORF gene between gag and pal (Krausslich and Wimmer, 1988). The pl ggagencoding region of MAV, a replicationcompetent helper retrovirus, comprises 124 codons in the 3’ region of the gag gene followed by a stop codon (Schwartz et al., 1983). Five major structural MAV proteins, ~19, ~10, ~27, p12 and ~15, are constituent parts of the gag polyprotein precursor. The ~15~“~ proteinase sepcifically liberates these proteins from *To whom

all correspondence

should

be addressed. 235

the common gag precursor as well as reverse transcriptase (~63) and integrase (~32) from the gag-pol precursor. The release of two major env proteins is supposed to be catalyzed by a host serine proteinase (Dickson et al., 1984). The recent recourse to the expression of recombinant DNA in heterologous systems, viz. E. coli (Mermer et al., 1983; Kotler et al., 1988; SedlaEek et al., 1986), and in yeast (Kramer et al., 1986) has led to a remarkable progress in our understanding of several aspects of the formation of retroviral proteinases and of their protein and enzymatic characteristics. The amino acid sequence of the MAV proteinase has been known for some time (Sauer et al., 1981). It is different from that of the RSV proteinase in one position only (No. 82, Val in RSV, Leu in MAV), as follows from the DNA sequencing (this work), contradictory to Sauer’s results which ascribed the difference to two other positions. In this study, we describe the isolation of the MAV from an efficient E. coli system p 15gag proteinase expressing a 25-kDa 3’ end portion of the gag open reading frame encoding 65 amino acids of the ~12~‘g protein and the complete ~15~“~ proteinase. The correctly processed and active ~159” proteinase was obtained in high yields and the other cleavage products of the primary translate were also identified. The proteinase was purified to a high degree of homogeneity characterized by reverse-phase HPLC (RP-HPLC), fast protein liquid chromatography

236

I. PmiovA et ai. BllmHl ATGACCAT~~TTACGCCAAIGCTGGGGAT~~~~GGtAC M T M I 1 PSWGSPGHYQAQCPK AAACGGAA~~CAGGAAACAG~~GTGAG~~~TG~~AGTTGTGT~A~GG~~~GGGA~A~AA~ KRKSGNSRERCQLCDGMGHN

130 150 GCTAAACAGTGTAGGAAGCGGGATGGCAACCAGGGCCAACGCCCAGGA~AG~CTCTCT AKQCRKROGNQGQRPGRGLS

170

190 210 230 TCGGGGCCGTGGCCCGTCTCTGAGCCGCCTG~~QT~T~GTTA~~S~TG~~A~TG~~~AT SGPWPVSEPPAVSjL -----~~~~~~~~-_----~~ 250 270 AAAGATCGCCCCTTGGTTAGGGT~ATTCTGACTAACACTG ~___4_~___9_~___u___R___V___I__L__T__~__~--~--~-_~__~-_~--~--~__

290

310 330 350 CGTTCGGTGTATATCACCGCGCTGTTGGACTCCGGAGCGGACATCACTATTATTTCGGAG ~___s___v___v__~__~___n__~__~___o__~__~__~__~_-~-_~__~__~__~__~__ 370 390 GAGGATTGGCClACCGAfTGGC~AGTGATGGAGG~TG~AACC~CAG~TC~AT~GG~TA EDWPTOWPUMEAANPQ ____________________________--________-__--__________-___-__

410

430 450 ~GA~GG~GAATTCCCATGCGAAAATCCCGGGATATGATAG~GTGGGUiTTI;\TT~AC~GA IPMRKSRaMIEVGV _I________________x_______~_~-___________---______________~~

470

490 510 GACGGATCCTTGGAGCGACCCCTGCTCCTCTTCCCCGCAGTGGCTATGGTT~GA~GG~~ OGSLERPLLLFPAVARV ____________________~~~~~~~~~~~~~~~~~~~_~___~~~~~~~~~~~~~~~~

530

550 570 590 ATCCTAGGAAGAGATTGTCTGCAGGGC~TAGSGCTCCG~TTGACAAATTTATAGGGAGGG _I___L___c___R___4__c___L___4__6___t___o I * 610 630 CC~CT~TT~n8CT~TT~CG~TA~AT~TG~CTATTCCGCTCAAATGGAAGCC~ACCACA IPLKWKPNHT

650

670 690 CGCCTGTGTGGATTGACCAGTGGC~CCTGARGGTAFT PVWIDQWPLPEGK

710

G

R

A

LUALTQL

730 750 TAGTGGAAAAAGAATTACAGTTAGGA~ATATAGAACCTTCACTTAGTT~TGGAACA~AC IEPSLSCWNTP V E K E L (3 L G H

770

810 790 CT~TC,‘“~TG~TC~GG~AG~CT~CC~GGTCTTATCGCTTA~TGCATG~TTGCGCGCTG SYRLLHOLRA’J

830

850 Tl~A~~~~AG~TT XindIII

Fig. 1. Precursor of ~15~~~proteinase of MAV. The nucleotide and amino acid sequences of the recombinant proteinase precursor and of a part of - 1 pol frame shift are shown; the differences from the homologous RSV proteinase sequence (Schwartz et al., 1983) are in italics. The sequence from the start to the BumHI site corresponds to the E. coli P-galactosidase and linker segments, from BarnHI to Hind111 site to virus-specific DNA (Perbal et al., 1985) as contained in expression plasmid pMG45 (a tcfc promoter controlled, PUC-series based construct (SedlaEek et nl., 1988). The p12jp15 gag boundary is shown by a vertical bar, and the sequence of the mature p15gq proteinase is underlined.

(FPLC) and ion exchange chromatography, by SDS-PAGE, by isoelectric focusing, by amino acid analysis and N-terminal sequence analysis. The data obtained provide evidence of the identity of the recombinant enzyme with the authentic viral plS@g proteinase. METHODS

Nucleotide sequencing The nucleotide sequence of the MAV-specific DNA contained in the expression piasmid pMG45 (SedliEek et al., 1988) was determined using the Ml3 phage subclones and the Sanger chain termination method (Sanger and Coulson, 1975). Isolation of proteinase from inclusion bodies Wet cells were suspended in 50mM Tris-HCI buffer containing I mM EDTA, 50 mM NaCl and 68 mM PMSF

(PH 8; buffer A) and were then disrupted by freezing. After the addition of 764 ml of buffer A, the cells were treated at room temperature with 23 ml of lysozyme solution (50 mg/mI) for 20 min and then with 99.5 ml of 1% aqueous sodiumn deoxychoiate for 20 min. The inctusion bodies were then sonicated and separated from thecytoplasmatic fraction by centrifugation for 20 min at 15,000 rev/min and 2°C. They were then resuspended in 200ml of buffer A and spun off again. Cell debris on top of the chalk-like sediment of the inclusion bodies was removed, the inclusion bodies were resuspended in 54 ml of 50 mM Tris-HCl buffer containing 50 mM phosphate, 0.1% 2-mercaptoethanoi, 30 mM NaCl and 2 mM EDTA @H 7; buffer B), and injected into 540 ml of 9 M urea in the same buffer. The solution was stirred for 20min at room temperature and then dialyzed against 3 x 10 liters of 20 mM Tris-HCl buffer containing 10 mM phosphate, 20mM NaCl, 1 mM EDTA and 0.05% 2-mercaptoethanol (PH 7; buffer C). The precipitate formed during dialysis, and still containing large quantities of the ~1.5

plsp”g proteinase of MAV proteinase, was removed by centrifugation for 30min at 15,000 rev/min and again solubilized in 900 ml of 9 M urea, and the solution was dialyzed as described above. The quantity of active proteinase in the pooled supematants from both steps was determined by activity measurement using a synthetic substrate. For the isolation of the pIY@ proteinase from the supematant three different procedures were developed. Procedure I. The pooled supernatants were concentrated using an Amicon HP 3 hollow fiber, and small peptides were removed. The concentrate was directly applied to a column of SP-Sephadex C25 (2.4 cm x 20 cm) equilibrated with buffer C (PH 7). Fractions containing unretained material were collected and pooled. The pH of the effluent was adjusted to 7.5 and a double volume of DEAE-Sephadex A50 equilibrated beforehand on a glass filter with 1OmM Tris-HCl buffer containing 0.05% 2-mercaptoethanol and 1 mM EDTA (PH 7.5) for 2 hr at 4°C. The gel was filtered off and washed with an equal volume of the equilibration buffer. The pH of the effluent was adjusted to pH 5 by acetic acid and the solution was applied to a column of SP-Sephadex C25 (2.4 cm x 20 cm) equilibrated with IOmM sodium acetate containing 0.05% 2-mercaptoethanol and 1 mM EDTA (pH 5; buffer D). The proteinase was eluted by a linear gradient of NaCl. The fractions were assayed for proteolytic activity with HSA and a synthetic peptide substrate (Strop er al., 1989) and were then pooled and stored at 4°C. Procedure II. The pooled supernatants were concentrated 10 times using an Amicon UM 2 membrane, made up to the original volume with 50mM Tris-HCl buffer containing 1 mM EDTA and 0.05% 2-mercaptoethanol @H 8; buffer E) and the solution was again concentrated to 40ml. A lo-ml sample was then separated on a Sephadex G-75 column (4cm x 6Ocm) eauilibrated in buffer E. Proteinase activity was assayed as described below and pooled fractions were diluted IO times with 16% ethylene glycol in water. The pH was adjusted to pH 5 by acetic acid and the solution was dialyzed against buffer D containing 16% of ethylene glycol, and- then applied to an SP-Sephadex column (2 cm x 20 cm) eouilibrated with buffer-D. The elution of the proteinase was performed by a linear gradient of NaCl in buffer E containing 16% of ethylene glycol. The active fractions were pooled and dialyzed against 50 mM Tris-HCI buffer containing 20 mM phosphate, 1mM EDTA and 0.1% 2-mercaptoethanol (pH 7.5). Procedure III. Peptide contaminants from the supernatant obtained in the dialysis step were removed by passage over three columns used in series: a Phenyl-Sepharose column in buffer C @H 7; approximately 1 ml of Phenyl-Sepharo~ is used for IOmg of active proteinase), an SP-Sephadex C25 column (2 cm x 2Ocm) in buffer C (pH 7) and a QAE-Sephadex A25 column (2.4 cm x 20 cm) equilibrated with buffer E. The pH of the final effluent was adjusted to pH 5 after dialysis against buffer D. the filtrate was applied to the Sephadex C25 column at pH S as described under procedure I. Isolation fractions

of

MA V pf5

proteinase

from

cytoplasmat~~

The supernatant after the separation of the inclusion bodies was dialyzed against buffer D @H 5). The precipitate formed in the tubing during the dialysis was removed by centrifugation (30 min, 15,000 rev/min, S’C) and the supernatant was applied to an SP-Sephadex C25 column (2.0 cm x 20 cm) equilibrated with buffer D. The proteinase was eluted by a linear gradient of NaCl (0-0.4M, 400 + 400 ml). Fractions containing the proteinase were tested for activity and further purified on a reverse-phase C-3 Ultrapore column (0.46 cm x 7.5 cm) in 0.05% aqueous trifluoroacetic acid using a gradient of &50% acetonitrile containing 0.05% TFA as eluent.

237

Isolation of authentic MA V p I5 proteinase The pi5 proteinase was isolated from the blood plasma of chickens with myeloblastosis leukemia in its terminal stage according to the procedure of Trt&niEek and &man (1980). The final pu~fi~ation step was repeated twice on SP-Sephadex. The purity of the recombinant and the authentic plS proteinase was checked by FPLC using an ion-exchange Mono S HR S/S column (Pharmacia) and a linear gradient of NaCl O-O.5M in 0.02 M acetate buffer (pH 5.0), containing 0.05% 2-mercaptoethanol, 0.005% Triton X100, at a-flow rate of 0.5-ml~min or on a reverse-phase 0.46cm x 7.5cm Ultrauore C3 RPSC column (Beckman) using a linear gradieni of water-60% acetonithle (O.OS”/, TFA in 60 min, flow rate 0.5 ml/min). Electrophoresis

SDS-PAGE according to Laemmli (1970) was carried out in gradient gels (&22.5%) using Coomassie Blue as the stain. Western blots were detected on nitrocellulose, with 4-chloro-I-naphthol, by the double antibody technique, using rabbit antiserum against the MAV virion gag proteins and porcine antirabbit IgG coupled to horseradish peroxidase. Activity assays

Routinely, the activity of the MAV ~15 proteinase was measured in terms of HSA cleavage followed by evaluation of digests by SDS-PAGE (Dittmar and Moelling, 1978). For quantitative activity measurements, the absorbance decrease at 305nm during hydrolysis of synthetic chromogenic peptide substrate; Ala-Thr-HisGlu-ValTyr*Nph-Val-Arg-Lysla-OH, in 0.2 M phosphate buffer containing 1.9 M NaCl (pH 6) was determined (* denotes the scissiie bond). Amino acid and N-terminal sequence analysis

The amino acid analysis was performed in a Durrum D500 analyzer on 20-hr hydrolysates of samples according to Spackman et a/. (1958) and Benson and Patterson (1965). The N-terminal sequences were determined in a Model 470 A Gas-phase Protein Sequencer (Applied Biosystems, U.S.A.).. The phenyi~ioh~dantoins were identified by HPLC (Beckman Liauid Chromatoaranhv Svstem. Model 345) on‘an Ultrasphere ODS column u&g 6.03 M’ acetate buffer @H 4.5) containing 35% of acetonitrile, 0.3 mM SDS and 0.6 mM dithiothreitol for elution. molecular mass ~termination

The molecular mass of the proteinase was determined by gel permeation chromatography on a Sephadex G-75 column (1 cm x 32.5 cm) eauilibrated with McIlvain buffer @H 6) eluted at a flow rate-of 0.2 ml/min and monitored at 280 nm. Alternatively, the molecular mass was determined in an analytical ultracentrifuge (Beckman Spinco, model E, 2O”C, 33,450 rev,!min, 8 hr, rotor AnH-Ti) using the equilibration method in the long column described by Chervenka (1970). A volume of 50 ~1 of the sample was used for one determination under various conditions. Crystallization

A procedure similar to that used for the crystallization of the RSV proteinase (Miller et al., 1989) was employed. The solution-of the proteinase was adjusted to pH i&and concentrated to 0.1 mM. Crystals suitable for diffraction analysis were obtained from droplets containing 4~1 of 0.1 mM MAV proteinase and 4 p 1 of the reservoir solution [50 mM citrate/phosphate (PH S.6), 8-12% saturated ammonium sulfate, 5% w/v dimethyl formamide and 0.05% 2-mercaptoethanol]. The crystals were grown for a week at room temperature.

I.

238 RESULTS

PICHOVi

AND DISCUSSION

Expression of recombinant p 15g”gproteinase of MA V To obtain a massive supply of the proteinase a 0.82 kb segment of MAV proviral DNA (Perbal et al., 1985) comprising the 3’ part of the gag region was manipulated into an expression plasmid construct (SedlaEek et al., 1988). This segment encodes 65 amino acids of the pl2g”g moiety of the gag polyprotein precursor and all 124 amino acids of the pl ggogproteinase; a translational stop signal follows. A segment of E. coli /?-galactosidase DNA and a linker sequence were attached to the 5’ end of the cloned proviral DNA fragment, thus extending the end of the viral protein by other eight amino acids. This truncated and fused precursor of pl5g”g can be designated Pr27’“‘+*@g,according to its composition and calculated molecular mass. The nucleotide sequence of the MAV proteinase differs from that of RSV in position 82 and in positions 52 and 54 from the amino acid sequence of the MAV proteinase published by Sauer et al. (1981). In the expression plasmid construct employed, pMG45 (Strop et al., 1989) control elements which have proved efficient in the expression of another proteinase zymogen, fusion calf prochymosin, were used: P,,, and the translation initiation signal of E. coli P-galactosidase. The cultivation of E. coli strain MT harboring pMG45 was also carried out in analogy to the previous system. In induced cultures all the cells formed polar cytoplasmatic inclusions that filled up a considerable part of the cell volume. Processing The primary separation of the ~15~~~ proteinase from the urea-solubilized proteins of the inclusions took place during the removal of urea by dialysis. The bulk of contaminating proteins formed a precipitate, whereas the supernatant contained the proteinase in a high quantity, free of other proteins, contaminated by small peptides only. Similar partition phenomena have only rarely been mentioned for insoluble

Table I. Purification

et

al.

recombinant products (Gribskov and Burgess, 1983). The Pr25’0c-k4g precursor formed in large quantities in E. coli MT cells harboring pMG45 was then rapidly processed to the ~158”~ proteinase. Both the precursor and a small amount of the proteinase were incorporated in the inclusions, whereas the cytoplasmic fraction contained the processed proteinase only. N-Terminal sequence analysis of the p 15gag proteinase purified from the solubilized inclusion bodies by reverse phase HPLC showed that the proteinase was processed correctly in the inclusion bodies. The uniform sequence Leu-AlaMet-Thr-Met-Glu-His-Lys found corresponded to the amino-terminal sequence of the authentic MAV proteinase and also of the RSV proteinase (Schwartz et al., 1983; Sauer et al., 1981). The recombinant proteinase from solubilized inclusion bodies was able to cleave the gag precursor into structural viral proteins. We were able to isolate several products found in E. coli from during the Pr25’“‘*g4g processing the soluble material contained in the supernatant fraction. In addition to products of cleavage at the main processing site, the p12/p15 boundary, two other peptides products with N-terminal sequence Thr-Met-Ile-Thr-Pro-Ser-Trp and Lys-Arg-Asp Gly-Asn-Gln-Glywere isolated by chromatography on SP-Sephadex or by RP HPLC. The first of these sequences corresponds to E. coli P-galactosidase but lacks its N-terminal methionine. The removal of this amino acid has been reported for several other recombinant products (Marston, 1986). The second sequence found indicates that the processing took place also within the p12 structural protein region, between residues Arg(45) and Lys (46) of Pr25”‘@g. Processing at this site appeared to be due to the membrane-associated proteinase VII (Sugimura and Higashi, 1988), which cleaves specifically Arg-Lys, Lys-Lys, and Arg-Arg sequences. When E. coli proteinase VII is removed from inclusion bodies the self-processing of intact precursor is slowed down.

of p15p”g proteinase

from inclusion

bodies

Activity Total protem step Procedure

(U x 10-S)

Yield

degree

(kw)

(%I

(-fold)

37.31 36.94 34.25 21.56 6.82 28.81

5.29 5.55 5.71 10.45 8.19 21.54

100 98.8 91.67 73.74 18.25 77.07

I .05 I .08 I .98 1.55 4.06

290 270 221 32.9 53. I

15.39 15.04 14.46 2.63 10.37

5.31 5.57 6.45 7.12 19.55

100 97.66 93.94 17.06 67.37

I.21 I .34 3.68

23 20 I8 I6 2.8 4.2

I.18 1.06 0.97 0.98 0.22 0.75

5.12 5.32 5.41 6.12 7.75 8.12

100 95.76 82.71 83. I3 18.82 64.01

1.0 I .04 I .06 I.19 I.51 3.54

PH

(w)

7 7 7 7 5 7

706.5 665.5 600.0 264.0 83.3 133.8

7 7 7 5 7 7 7 7 8 5 7

I

Supernatant Ultrafiltration SP-Sephadex DEAE-Sephadex SP-Sephadex Procedure II Supernatant Ultrafiltration Sephadex G75 SP-sephadex Procedure III Supernatant PhenylkSepharose SP-Sephadex QAE-Sephadex SP-Sephadex The activity

Purification Specific

Total

was determined

with the synthetic

chromogenic

peptide substrate.

I .o

I .o

I .05

239

~158” proteinase of MAV Table 2. Determination of molecular mass of p15g’g proteinase by ultracentrifugation

PH 5 6.5 6.5 6.5 The

NaCl (M) 0.15 0.15 0.5 0.15 determination Methods.

Mercptoethanol (M)

(k%)

was carried

(k)

26.0 29.2 30.16 26.6

0.05 0.05 0.05 0 out

28.3 33.4 38.5 48.2

as described

Phjication of p lYag proteinase inclusion bodies

0.4 mm in length and from 0.1 to 0.2 mm in diameter, were obtained at room temperature by the hangingdrop method after 2days. They were of the same shape and quality as those of the viral RSV p15 proteinase and diffracted at a 2.3 b; resolution without deterioration. plFg

under

of MA V from

The main problem of the purification is the removal of incorrectly folded, inactive proteinase and of E. coli proteins coprecipitated with the active proteinase at pH ~6. The procedures we developed for the purification are compared with respect to the recovery and purity of the material in Table 1. The most effective purification protocol involves ultrafiltration, DEAE-Sephadex treatment at pH 7.5, and SP-Sephadex chromatography at pH 5 (Table 2, Procedure I). This last step removes the impurities of molecular mass higher or lower than that of the p15 proteinase without loss of its activity. This procedure, using about 3 ml gel/mg active proteinase, gave routinely higher yields. The solution of the proteinase after this treatment did not precipitate after acidification to pH 5 before the final purification step by chromatography on SP-Sephadex at pH 5. Crystallization of recombinant ~15 MA V proteinase isolated from inclusion bodies The procedure successfully employed for the crystallization of the native RSV proteinase (Miller et al., 1989) was used also with the recombinant p15 MAV proteinase isolated from the inclusion bodies. The crystals, hexagonal rods from 0.1 to

proteinase from cytoplasmic fraction

The isolation of the proteinase from the cytoplasmic fraction after the removal of the inclusion bodies by centrifugation was affected by one-step ion exchange chromatography on SP-Sephadex at pH 5.0. Samples of this p15 proteinase fraction showed no proteolytic activity when assayed with denatured HSA as substrate. No activity was observed either when the proteinase was refolded (by 20min treatment in urea followed by dialysis). We found that the proteinase isolated from the cytoplasmic fraction showed the N-terminal sequence Ala-Met-ThrMet-Glu-His, which is shorter by the N-terminal leucine than the sequence of the authentic viral p 15= proteinase or of the proteinase isolated from inclusions. The “shorter” proteinase was the only product isolated from the cytoplasm and its quantity increased with prolonged incubation of E. coli. Hence, the strain used obviously contains a strong aminopeptidase activity immediately cleaving all molecules of the proteinase not caught up in the inclusions. These findings indicate the importance of N-terminal leucine for the activity of the enzyme. The N-terminus forms antiparallel p-strands with the C-terminal chain of the second molecule. This interaction is important for the formation of the active dimer. The N-terminal leucine side-chain is close to the side-chain of Leu-36 and this interaction is obviously essential for catalytic activity.

tB)

(A)

\

k!

\

/”

Fig. 2. FPLC of recombinant p 19 proteinase (A) and authentic p 1 VP proteinase (B) on mono S column. Elution gradient of cl.2 M NaCl in 0.05 M acetate buffer, containing 0.05% 2-mercaptoethanol, and 0.005%

Triton

X-100 (pH 5).

I. PICHOVh

240

1

2

3

et

al.

4

5

Fig. 3. SDS-PAGE patterns of solubilized inclusion bodies (I), cell cytoplasmic fraction (2), supernatant (3) and sediment (4) of solubilized inclusion bodies after first dialysis, recombinant p1Y’c proteinase (5).

pl 5p”gproteinase of MAV Table 3. Amino acid composition of authentic plYQ proteinase and of recombinant plY_ proteinase Authentic proteinase from amino acid sequence [I I] Lys, His,Arg,, Asp,Thr,Ser, Clu,Pro,Gly,, Ala,Cys,Val, Met,Ile,, Leu,, Tyr, Phe,Trp, Asn,Gln,

Recombinant proteinase Composition from nucleotide sequence Lys,His,Arg,, Asp,,Thr,Ser, Glu,Pro,Gly,, Ala,Cys,Val, Met,Ile,, Leu,, Tyr,Phe,Trp, Asn,Gln,

Composition from amino acid analysis Lys,,H%sArg,,, Asp,,.,Thr,.&r, Gla,,~Pro,,qGly

5 , I,

Ala6&ysI.4Va18 d M%Jle9,Leu,5.2 Tyro7Phe0,

The conditions of amino acid analysis are described under Methods.

Characteristics of recombinant pITgag proteinase

Chromatographic and electrophoretic behavior was assayed by FPLC on a Mono S and reversephase C3 Ultrapore column. The recombinant proteinase prepared by procedure I yielded elution patterns showing its identity with the authentic viral proteinase (Fig. 2) and its high purity. The molecular mass and purity of the purified proteinase were also confirmed by SDS-PAGE and gel chromatography on a Sephadex G-75 column. The SDS-PAGE pattern showed one band corresponding to a M, of 14 kDa in the position identical to the band of the authentic ~15 proteinase isolated from the virions (Fig. 3). On gel permeation chromatography in 1.5 M NaCl or in a buffer of low ionic strength the authentic p 1Fag proteinase and the recombinant proteinase were eluted in a single symmetrical peak and in a volume corresponding to M, of 14 kDa. The molecular mass determination of the proteinase was also effected by ultracentrifugation under different conditions (at pH 56.5 and at an ionic strength of 0.1 S-0.5 M NaCl; Table 2). The results of these measurements show, in contrast to chromatography, that the proteinase is present in dimeric and multimeric forms under these conditions. The ratio of the individual forms depends on ionic strength and PH. By now it has been established that retroviral proteinases are active in the form of molecular dimers. Our molecular mass determination on the Sephadex column shows that dimerization observed during ultracentrifugatjon is largely suppressed during chromatography because of low concentration of the enzyme and probably also because of its interactions with the chromatographic support. Isoelectric point A simple band and an isoelectric point of 6.7 identical for both the native and the recombinant proteinase, were observed during isoelectric focusing. Amino acid composition

The amino acid composition of the recombinant proteinase is shown in Table 3. It differs from the composition of the authentic plYa8 proteinase (Sauer et al., 1981) in lower alanine content (seven residues only) and in higher content of tryptophan (two residues). This difference can be ascribed to residues 50-54 from nucleotide sequence data. Acknowledgements-We ihank Mr J. Neumann for the molecular mass measurements in the analytical ultracen-

241

trifuge, the laboratory of Dr M. Pavlik for the sequencing experiments, the laboratory of Mr J. Zbroiek for the amino acid analyses, and the skilful technical assistance of MS E. Bulantova and MS Z. Senfelderova in the ex~~mental work. REFERENCES

J. V. and Patterson J. A. (1965) Accelerated automatic chromatographic analysis of amino acids on a spherical resin. Analyt. Chem. 37, 1108-l 110. Chervenka Ch. H. (1970) Long-column meniscus depletion sedimentation ~uilibrium techique for the analytic ultracentrifuge. Anaiyt. Biochem. 34, 24-29. Dickson C., Eisenman R., Fan H., Hunter E. and Teich N. (1984) Protein biosynthesis and assembly. In RNA Tumor Viruses I (Edited by Weiss R., Teich N., Varmus H. and Coffin J.), pp. 528547. Cold Spring Harbor Laboratory, Cold Spring Harbor. Dittmar K. J. and Moelling K. (1978) Bi~hemical properties of pi5 associated protease in an avian RNA-tumor virus. J. Viral. 28, 106-118. Gribskov M. and Burgess R. R. (1983) Overexpression and purification of the sigma subunit of Escherichia colt RNA polymerase. Gene 26, 109-l 18. Kotler M., Katz R. A. and Skalka A. M. (1988) Activity of avian retroviral protease expressed in Escheriehia colt. J. Viral. 62, 26962700. Kramer R. A., Schaber M. D., Skalka A. M., Ganguly K., Wong-Staal F. and Reddy E. F. (1986) HTLV-III gag protein is processed in yeast cells by the virus pol-protease. Science 231, 1580-1584. Krlusslich H. G. and Wimmer E. (1988) Viral proteinases. A. Rev. Biochem. 57, 701-754. Laemmli U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T. Nature 227, 680-685. Marston F. A. 0. (1986) The purification of eukaryotic peptides synthesized in Escherichia coli. Biochem. J. 240, I-12. Mermer B., Malamy M. and Coffin J. M. (1983) Rous sarcoma virus contains sequences which permit expression of the gag gene in Escherichiu coli. Molec. Celi. Biol. 3, 1746-l -isS: Miller M., Jaskolski M., Rao J. K. M., Leis J. and Wlodawer A. (1989) Crystal structure of a retroviral protease process relationship to aspartic protease family. Nature 337, 576-579. Perbal B., Lipsick J. S., Svoboda J., Silva R. F. and Baluda M. A. (1985) Biologically active proviral clone of myeloblastosis associated virus type A: implications for the genesis of avian myeloblastosis associated virus. J. Yirol. 56, 240-244. Sanger F. and Coulson A. R. (1975) Rapid method for determining sequences in DNA by primed synthesis with DNA polyher&e. J. molec. Biol: $4, 444448. Sauer R. T.. Allen D. W. and Niall H. D. (19811Amino acid sequence of p15 from avian myeloblastdsis virus complex. Biochemistry 20, 3784-3791. Schwartz E., Tizard R. and Gilbert W. (1983) Nucleotide sequence of Rous Sarcoma virus. Cell 32, 853-869. SedllEek J., Fabry M., KaSpar P., Zadraiil F. and Kapralek F. (1986) Plasmid constructs for overproduction of chymosin in E. coli. Biotechnot. Bioind (Sofia) 6, 17-19. SedliEek J., Strop P., KaprLlek F., PaEenka V., Kostka V., Trivnlcek M. and I&man J. (1988) Processed enzymatitally active protease (pl5@r) of avian retrovirus obtained in an E. coli system expressing a recombinant precursor (Pr25’aC-A@‘“s). FEBS Lett. 237, 187-190. Spackman D. H., Stein W. H. and Moore S. (1958) Automatic recording apparatus for use in the chromatography of amino acids. Analyt. Chem. 30, 1190-1205. Benson

242

I.

PICHOVA

Strop P., Konvalinka J., Blaha I., PavliEkovi L., I., Fusek M. and SouEek M., Velek J., Pichova Kostka V. (1989) Characterization of ~15 protease of myeloblastosis associated virus by specificity and inhibition studies. In Proteases of Reiroviruses (Edited by Kostka V.), pp. 141-153. de Gruyter, Berlin. Sugimura K. and Hugashi N. (1988) A novel outer-membrane-associated protease in E. coli. J. Bact. 170, 3650-3654.

et al.

TravniEek M. and Riman J. (1980) Isolation of native internal structural proteins of avian oncovirions by SP-Sephadex column chromatography. Biochem. biophys. Res. Commun. 96, 1768-1777. Vogt V. M. and Eisenman R. (1973) Identification of a large polypeptide precursor of avian oncornavirus proteins. Proc. natn. Acad. Sci., U.S.A. 70, 17341738. Yoshinaka Y. and Luftig R. B. (1977) Properties of a P70 proteolytic factor of murine leukemia viruses. Cell 12, 709-7 19.