Isolation of a cDNA encoding Fasciola hepatica cathepsin L2 and functional expression in Saccharomyces cerevisiae1

Molecular and Biochemical Parasitology 88 (1997) 163 – 174

Isolation of a cDNA encoding Fasciola hepatica cathepsin L2 and functional expression in Saccharomyces cere6isiae 1 Andrew J. Dowd, Jose Tort, Leda Roche, Thecla Ryan, John P. Dalton * School of Biological Sciences, Dublin City Uni6ersity, Glasne6in, Dublin 9, Ireland Received 5 February 1997; received in revised form 2 June 1997; accepted 6 June 1997

Abstract Cathepsin L2 is a major cysteine proteinase secreted by adult Fasciola hepatica. The enzyme differs from other reported cathepsin Ls in that it can cleave peptide substrates that contain proline in the P2 position. A cDNA was isolated from an expression library by immunoscreening with antiserum prepared against purified native cathepsin L2. This cDNA was sequenced and shown to encode a complete preprocathepsin L proteinase. Functionally active recombinant cathepsin L proteinase was expressed and secreted by Saccharomyces cere6isiae transformed with the cDNA. The recombinant enzyme was purified from large-scale fermentation broths using ultrafiltration and gel filtration chromatography on Sephacryl S200 HR columns. NH2-terminal amino acid sequencing showed that the cleavage point for activation of the recombinant pro-enzyme is identical to that of the F. hepatica-produced cathepsin L2. The mature active recombinant proteinase behaved similarly to the native enzyme when analysed by SDS-PAGE, immunoblotting and zymography and also cleaved peptides containing proline in the P2 position. Finally, the recombinant cathepsin L2 cleaved fibrinogen to form a fibin clot, a property we described for F. hepatica cathepsin L2. © 1997 Elsevier Science B.V. Keywords: Fasciola hepatica; Yeast expression; Proteinase; Cathepsin L

Abbre6iations: DTT, dithiothreitol; E/S products, excretory/ secretory products; E-64, trans-epoxysuccinyl-l-leucylamido (4-guanidino) butane; GS-PAGE, gelatin substrate polyacrylamide gel electrophoresis; NHMec, 7-amino-4-methyl coumarin; PCR, polymerase chain reaction; PVDF, poly(vinylidine difluoride); Tos, tosyl; Z, benzyloxycarbonyl. * Corresponding author. Tel.: +353 1 7045407; fax: +353 1 7045412; e-mail: [email protected] 1 Note: Nucleotide sequence data reported in this paper are available in the GenBank™ data base under the accession number U62289.

1. Introduction Proteinases secreted by Fasciola hepatica are believed to be involved in several important aspects of fascioliasis including tissue penetration, immune evasion and pathogenesis [1–8]. The major endoproteolytic activity secreted by the para-

0166-6851/97/$17.00 © 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 6 - 6 8 5 1 ( 9 7 ) 0 0 0 9 0 - X

164

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

site has been ascribed to two cathepsin L cysteine proteinases, cathepsin L1 and cathepsin L2 [9,10]. Members of the cathepsin L class of proteinases are characterized by their preference for substrates, such as benzyloxycarbonyl-Phe-Arg-7amino-4-methyl coumarin (Z-Phe-Arg-NHMec), that contain hydrophobic residues in the P2 position. Cathepsin L2, however, differs to cathepsin L1 and all other cathepsins described, both parasite and mammalian, in that it can cleave substrates with a proline residue in this P2 position [10]. We showed that the enzyme efficiently cleaved substrates, such as tosyl-Gly-Pro-ArgNHMec (Tos-Gly-Pro-Arg-NHMec), which are also cleaved by the serine proteinase thrombin and other clot-forming enzymes such as the snake venom proteinases [10,11]. Moreover, we reported that cathepsin L2 could cleave fibrinogen to form fibrin clots [12]. In this study we isolated a cDNA that encodes a complete preprocathepsin L. We have obtained a fully processed and functionally active cathepsin L proteinase by transforming Saccharomyces cere6isiae with a plasmid containing this cDNA. Substrate specificity studies demonstrate that the cDNA encodes the F. hepatica cathepsin L2. Moreover, we show that the yeast-expressed enzyme cleaves fibrinogen in a similar manner to that of the native cathepsin L2.

2. Materials and methods

2.1. Materials Yeast nitrogen base (code no. 0392-15-9) was obtained from Difco, Detroit, MI. Sephacryl S200HR was obtained from Pharmacia, Uppsala, Sweden. The synthetic peptides Z-Arg-ArgNHMec and Tos-Gly-Pro-Arg-NHMec were obtained from Sigma. The synthetic peptide Z-Phe-Arg-NHMec was obtained from Bachem, Bubendorf, Switzerland. The BCA protein assay kit was supplied by Pierce, Rockford, IL. Oligonucleotides were obtained from Oswel DNA Service, Edinburgh University, UK. Media containing F. hepatica secreted proteins were prepared as described previously [2]. Purified native

F. hepatica cathepsin L2 and rabbit anti-cathepsin L2 were prepared in our laboratory [10].

2.2. Isolation and sequencing of preprocathepsin L cDNA RNA isolation from adult F. hepatica was performed according to Chomczynski and Sacchi [13]. A cDNA library was constructed in lgt11 and screened according to the instructions in the manufacturer’s users manual (Promega, Madison, WI). Several clones were picked after three rounds of immunological screening of the library with anti-cathepsin L2. Polymerase chain reaction (PCR) amplification with universal lgt11 primers of the positive clones generated a product of approximately 1 kb that was subcloned into pGEMT (Promega). The complete DNA sequence from both strands of the insert of this clone (pFheCLT41) was determined by an automated method (Applied Biosystems) at the Department of Biological Sciences, University of Durham, UK.

2.3. Yeast expression plasmid construction Primers with HindIII overhangs (underlined) were designed based on the sequences crossing the start and stop codons of cathepsin L2 [H3297(URUF):AACAATAAGCTTATGCGR T T M T T C R T A T T A G C C G T C and H3296(IREB): TGACAGAAGCTTATCACGGAAATCGTGCCAC]. PCR of the anti-cathepsin L2 positive clones with URUF and IREB generated the complete coding sequence of cathepsin L2. The amplified fragments were cloned into pGEMT (Promega) and also sequenced. The insert was excised with HindIII and ligated to HindIII-linearized pAAH5 yeast expression vector [14]. The orientation of the insert in pAAH5 vector was assessed by restriction mapping and PCR with the primers used for cloning and a pAAH5 primer: GTGATGTCGGCGATATAG. A clone, pFheCLh42, with the correct orientation for expression was isolated. E. coli strains JM109 and MC1061 were used as the host for pGEMT plasmid propaga-

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

tions and manipulations and for transformation with pAAH5 derived plasmids.

2.4. Transformation and culturing of Saccharomyces cere6isiae S. cere6isiae strain DBY746 (a his3-D1-leu2-3 leu2-112 ura3-52 trp1-289a) (Yeast Genetic Stock Center, Department of Biophysics and Medical Physics, University of California, Berkeley, CA) was transformed with the plasmid pFheCLh42 by the lithium acetate method [15]. The DBY746 strain was routinely maintained in complex media (YEPD): yeast extract 10 g l − 1, peptone 20 g l − 1, −1 D-glucose 20 g l . Yeast transformants were cultured in selective minimal media: Bacto Yeast Nitrogen Base 6.7 g l − 1, D-glucose 20 g l − 1, uracil 20 mg ml − 1 in 0.1 M phosphate buffer pH 6.5. The selection marker on the yeast vector is Leu2.

165

(E-64) and the fluorogenic substrate Z-Phe-ArgNHMec were performed according to the method of Barrett et al. [17].

2.6. Purification of yeast-expressed cathepsin L proteinase A 30 l volume of yeast culture media supernatant was concentrated to 20 ml using Amicon 2000A and 8400 concentrators and YM3 membranes (3000 Da molecular mass cut-off, Amicon, WI). The sample was applied to a Sephacryl S200HR gel filtration column (2.5× 114 cm) equilibrated in 0.1 M Tris–HCl, pH 7.0, at 4°C (Buffer A). The protein material was eluted from the column with Buffer A, and 5 ml fractions were collected. Each fraction was assayed for cathepsin L activity using Z-Phe-Arg-NHMec at a final concentration of 10 mM in Buffer A. Fractions containing Z-Phe-Arg-NHMec cleaving activity were pooled and concentrated to 10 ml as before.

2.5. Characterisation of enzyme acti6ity Proteinase activity was routinely measured fluorimetrically using the fluorogenic peptide ZPhe-Arg-NHMec as substrate. Z-Phe-ArgNHMec was stored as a 10 mg ml − 1 stock solution in dimethylformamide. Assays were carried out using a final concentration of 10 mM substrate in 0.1 M Tris – HCl, pH 7.0, containing 0.5 mM dithiothreitol (DTT), in a volume of 1 ml. The mixtures were incubated at 37°C for 30 min before stopping the reaction by the addition of 200 ml 1.7 M acetic acid. Under these assay conditions the enzyme reaction is linear for over 60 min.The amount of 7-amino-4-methyl-coumarin (NHMec) released was measured using a Perkin-Elmer fluorescence spectrophotometer with excitation set at 370 nm and emission at 440 nm. The substrate specificity of the yeast-expressed and native cathepsin L2 was determined with Z-Arg-Arg-NHMec, Z-Phe-Arg-NHMec and TosGly-Pro-Arg-NHMec. The kinetic constants, Km and kcat, were obtained by non-linear regression analysis using the programme Enzfitter [16]. Active site titrations using the inhibitor trans-epoxysuccinyl-l-leucylamido (4-guanidino) butane

2.7. Polyacrylamide gel electrophoresis, zymography, immunoblotting and fibrinogen clotting assays Native and yeast-expressed cathepsin L2 were analysed by reducing 12% SDS-PAGE and immunoblotting as described by Dowd et al. [10]. Zymography was performed in native, non-SDS polyacrylamide gels as before [10]. Preparation of the fibrinogen-agarose plates and clotting assays was as described previously [12]. Thrombin activity is expressed in National Institute of Health Units (NIH units) obtained by direct comparison to a NIH thrombin reference standard, Lot J. [18]. Cathepsin L2 clotting activity is described as NIH units equivalents by comparing the clotting activity of this enzyme in fibrinogen clotting assays with a commercially-obtained thrombin of known NIH units [18].

2.8. NH2 -terminal sequencing A 40 ml (10 mg) volume of purified yeast-expressed cathepsin L2 (peak III of Sephacryl S200HR) was subjected to reducing SDS-PAGE as described above. Proteins were transferred to a

166

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

poly(vinylidine difluoride) (PVDF) membrane and stained with Coomassie Blue [9,10]. The 29.5 kDa protein was sequenced on an Appied Biosystems 477 A protein sequencer at the Biochemistry Department, University College Cork, Ireland.

U62288), a Fasciola hepatica cathepsin L described by Wijffels et al. (accession number, S70380) [20], and an Fasciola spp. cathepsin L reported by Yamasaki and Aoki (accession number, L33771) [7].

3.2. Yeast expression of F. hepatica cathepsin L 3. Results

3.1. Isolation of a cDNA clone encoding a preprocathepsin L An adult F. hepatica lgt11 cDNA library (5 × 104 independent plaques) was screened with anticathepsin L2 antibodies. After three rounds of immunological screening, a clone, termed FheCLT41, was isolated. The insert was subcloned in pGEMT vector and the complete nucleotide sequence determined (GeneBank™ accession number U62289). The FheCLT41 sequence of 1065 nucleotides contains the complete coding region of a precursor cathepsin L (preprocathepsin L). The clone includes 21 untranslated nucleotides at the 5% end, 978 nucleotides encoding the 326 amino acids of the preproenzyme and 66 untranslated nucleotides at the 3% end which contains a polyadenylation signal. N-terminal amino acid sequencing of native cathepsin L2 and cathepsin L1 revealed that these enzymes differed from other cathepsins L in having an additional amino acid, alanine, on the N-terminus [9,10]. This alanine was present in the deduced amino acid sequence of FheCLT41 and defines the position of the cleavage point between the pro-peptide and mature protein. Accordingly, the deduced protein sequence contains a 15 amino acids pre-signal region, a 91 amino acid propeptide and 220 amino acid mature enzyme. The predicted molecular masses for the precursor and mature enzyme are 37 009 and 24 459 Da, respectively. No N-linked glycosylation signals are present in the predicted amino acid sequence of the precursor protein. FheCLT41 exhibits 97% identity at the amino acid level to a member (Fcp1c) of the cathepsin L gene family decribed by Heussler and Dobbelaere (accession number, Z22765 [19]) and 77% identity to cathepsin L1 isolated in our laboratory (accession number,

The complete cathepsin L zymogen coding region in FheCLT41 was subcloned into pAAH5 yeast expression vector generating the pFheCLh42 derivative plasmid. pAAH5 is a shuttle vector with the yeast replication region of the 2-mm circle and the E. coli replication region of pBR322. The HindIII cloning site is flanked at the 5% side by the promoter and the untranslated leader of the yeast alcohol dehydrogenase gene ADC1 containing the ribosome-binding site [14]. The insert provides the translation initiation and termination codons, and the signals for posttranslational processing and intracellular sorting of the pro-enzyme are contained within the cathepsin L pro-region. Yeast DBY746 cells were transformed with the pFheCLh42, or with pAAH5 alone and cultured in selective minimal medium. Cathepsin L activity was assayed in cell extracts and culture media supernatants using the fluorgenic peptide substrate Z-Phe-Arg-NHMec. Enzyme activity in the culture medium increased linearly for at least 50 h. The total enzyme activity in the supernatant at the end of a 50 h fermentation was approximately three-fold greater than that in the yeast cell extracts. This activity was demonstrated to correspond to a cysteine proteinase as it was enhanced ten-fold by 0.5 mM DTT and was undetectable in the presence of the specific cysteine proteinase inhibitor, E-64 (5 mM) and the cathepsin B and L inhibitor Z-Phe-Ala- CHN2 (10 mM) (data not shown). Yeasts transformed with pAAH5 did not express cysteine proteinase activity.

3.3. Purification of the recombinant cathepsin L Recombinant cathepsin L was purified from concentrated yeast culture supernatants by gel filtration on Sephacryl S200HR. Three peaks of Z-Phe-Arg-NHMec-cleaving activity eluted from

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

167

Fig. 1. Purification of recombinant cathepsin L2. Panel A, the culture medium in which S. cere6isiae cells were maintained was concentrated to 20 ml (58 mg protein) and applied to a Sephacryl S200HR column (2.5× 114 cm). The mobile phase was 0.1 M Tris–HCl, pH 7.0, (Buffer A). Protein elution from the column was monitored by absorbance at 280 nm using a flow-through spectrophotometer. Cysteine proteinase activity in collected fractions was assayed using the fluorogenic substrate Z-Phe-ArgNHMec. Three separate fractions containing Z-Phe-Arg-NHMec cleaving activity were pooled (peaks I, II and III, solid bars). SDS-PAGE under reducing conditions (Panel B) and immunoblot (Panel C) analysis was performed on the culture medium in which yeast cells were maintained (lane 1, 100 mg), on peak I (lane 2, 100 mg), peak II (lane 3, 10 mg), peak III (lane 4, 5 mg) from the Sephacryl S200 column and on purified native F. hepatica cathepsin L2 (lane 5, 10 mg). The position of the the molecular size markers triosephosphate isomerase (36 kDa) and lysozyme (14.4 kDa) are indicated by a large and small arrow, respectively.

168

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

the column (Fig. 1A). Only the activities in the second (peak II) and third (peak III) activity peaks were inhibited by the cathepsin L inhibitor, Z-Phe-Ala-CHN2, and enhanced by the reducing agent cysteine. The first peak of activity (peak 1) which eluted with the main protein peak may represent an endogenous yeast proteinase. The fractions of peaks I, II and III were separately pooled and aliquots were analysed by reducing SDS-PAGE and immunoblotting. Peak I contained most of the proteins that were present in the culture supernatant indicating that these may be in aggregates. They are possibly derived from yeast cells that lysed during the culturing period and harvesting steps. Nevertheless, immunoblotting revealed no reactivity of anticathepsin L2 serum with any proteins in this fraction (Fig. 1B and C, lanes 2). Peak II consisted of two proteins of 28 and 29.5 kDa; however, only the 29.5 kDa protein was reactive with antibodies in anti-cathepsin L sera (Fig. 1B and C, lanes 3). Peak III contained a single protein of 29.5 kDa that was reactive with anti-cathepsin L antibodies and which co-migrated with native cathepsin L2 purified from F. hepatica excretory/ secretory products (E/S) (Fig. 1B and C, lanes 4 and 5). Aggregation of cathepsin L proteinase to the 28 kDa protein in peak II may explain why some activity separated from the bulk of activity in peak III. Immunoblotting also detected a protein of approximately 37 kDa in the total culture medium and peak II which was not visualized by SDSPAGE; this protein most likely represents the pro-cathepsin L which has a similar estimated molecular mass (Fig. 1C, lanes 1 and 3). In addition, immunoblotting detected minor degradative products of cathepsin L in the peak III and native cathepsin L preparations (Fig. 1C, lanes 4 and 5). An NH2-terminal sequence of Ala-Val-Pro was obtained for the purified yeast-expressed 29.5 kDa cathepsin L in peak III. This sequence is identical to the first three NH2-terminal amino acids of the native F. hepatica cathepsin L2 [10]. The specific activity of the recombinant cathepsin L was 0.0226 U mg − 1 (peak III) which is about 4.5-fold lower than that obtained for purified native F. hepatica cathepsin L2 (0.102 U mg − 1). Typically,

peak III contained 2–3 mg protein which represented a yield of 66.6–100 mg l − 1 of fermentation broth.

3.4. Zymography and pH optima Both purified yeast-expressed and native cathepsin L2 proteinases migrate as single, broad bands when analysed by zymography under nondenaturing conditions (Fig. 2). The recombinant proteinase, however, migrates slightly slower than the native enzyme. As expected for cysteine proteinases, the activity of both proteinases was enhanced in the presence of the reducing agent, cysteine (Fig. 2). In enzyme assays the enhancement of both enzyme activites by cysteine was eight-fold (data not shown). The pH profiles of the recombinant and native cathepsin L2 for the substrate Z-Phe-Arg-NHMec were similar; both enzymes show a broad pH optimum for activity ranging from pH 5.0–8.0 (data not shown).

Fig. 2. Zymographic analysis was performed using native polyacrylamide gels on yeast-expressed recombinant cathepsin L2 from the Sephacryl S200 peak III (RecCL2) and purified native F.hepatica cathepsin L2 (FheCL2) in the absence and presence of 10 mM cysteine.

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

169

Table 1 Reaction kinetics for native cathepsin L2 and yeast-expressed recombinant cathepsin L2 on fluorogenic peptide substrates Substrate

Z-Arg-Arg-NHMec Z-Phe-Arg-NHMec Tos-Gly-Pro-Arg-NHMec

Native cathepsin L2

Recombinant cathepsin L2

Km (mM)

kcat (s−1)

kcat/Km (mM−1 s−1) Km (mM)

kcat (s−1)

kcat/Km (mM−1 s−1)

9.3 10.0 25.0

0.02 0.65 1.0

2.2 64.8 40.0

0.04 0.64 1.35

3.9 56.1 54.0

3.5. Substrate specificity of yeast-expressed cathepsin L The substrate specificity of the yeast-expressed and native F. hepatica cathepsin L2 were compared using the fluorgenic substrates Z-Arg-ArgNHMec, Z-Phe-Arg-NHMec and Tos-Gly-ProArg-NHMec (Table 1). Both the yeast-expressed and native F. hepatica enzymes showed a marked preference (as assessed by kcat/Km) for the cathepsin L substrate Z-Phe-Arg-NHMec, over the cathepsin B (Z-Arg-Arg-NHMec) substrate. Most importantly, both enzymes efficiently cleaved the substrate Tos-Gly-Pro-Arg-NHMec (Table 1). For all substrates examined, the native and recombinant enzymes exhibited similar kcat/Km values.

3.6. Fibrinogen clotting by recombinant cathepsin L The ability of enzymes to clot fibrinogen can be demonstrated visually by applying samples to wells cut in 0.5% agarose containing 0.4% fibrinogen (Fig. 3A). Thrombin-produced fibrin clots appear as opaque rings around the wells. Opaque rings also appeared around wells containing yeastexpressed and native F. hepatica cathepsin L2. However, these latter rings differed to those produced by thrombin in that they were more diffuse and had clear zones at the centre. These differences are consistent with our earlier report showing that cathepsin L2-produced clots differed physically to thrombin-produced clots [12]. Clotting assays performed in test tubes allowed the quantitation of the clotting activity of the cathepsin Ls relative to thrombin [12]. The clotting

10.2 11.4 25.0

activities of yeast-expressed and native F. hepatica cathepsin L2 were 7.2 and 23 NIH equivalent units mg − 1, respectively. SDS-PAGE analysis was performed on the fibrinogen clots produced by thrombin, recombinant cathepsin L2 and F. hepatica cathepsin L2 (Fig. 3B). The clots were prepared in test tubes and then solubilized after three washes with phosphate buffered saline (PBS) by boiling in Tris– HCl, pH 6.8, containing 2% mercaptoethanol and 2% SDS. SDS-PAGE analysis of fibrinogen revealed its a, b and g subunits (Fig. 3B, lane 1). Thrombin cleavage of fibrinogen to form clots involves the removal of fibrinopeptides A and B (16 and 14 amino acids, respectively) from the a and b fibrinogen subunits [21]. SDS-PAGE analysis of thrombin clots showed that the migration of these subunits was slightly altered and an additional band at 115 kDa appeared (Fig. 3B, lane 2). The pattern of the yeast-expressed and native F. hepatica cathepsin L2 were identical; the a and b fibrinogen subunits of fibrinogen were not present, whereas three additional major bands of 120, 100 and 25 kDa and several minors band of \150 kDa were observed (Fig. 3B, lanes 3 and 4).

4. Discussion Dalton and Heffernan [2] reported that adult F. hepatica secreted cysteine proteinases into medium in which they were maintained. Biochemical analysis of these secreted enzymes showed that they consisted of two cathepsin L proteinases, termed cathepsin L1 and cathepsin L2, with distinct physicochemical properties and

170

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

Fig. 3. Comparison of the fibrinogen-clotting activity of thrombin, yeast-expressed recombinant cathepsin L2 (RecCL2) and native F. hepatica cathepsin L2 (FheCL2). Panel A, fibrinogen-agarose plates were prepared by pouring a mixture of 0.4% bovine fibrinogen in 0.5% agarose (containing 12.5 mM DTT) onto microscope slides. Thrombin (46 and 23 NIH mU), yeast-expressed recombinant cathepsin L2 (RecCL2, 18 NIH equivalent mU) and native F.hepatica cathepsin L2 (FheCL2, 11.7 NIH equivalent mU) were added to wells cut in the agarose and incubated at room temperature for 18 h. Plaques were recorded by photography. Panel B, thrombin (9.2 NIH mU), yeast-expressed recombinant cathepsin L2 (18 NIH equivalent mU) and native F. hepatica cathepsin L2 (11.7 NIH equivalent mU) was added to 100 ml of 20 mg ml − 1 fibrinogen for 1 h. Clots were then washed three times with PBS, solubilised by boiling in Tris–HCl, pH 6.8, containing 2% mercaptoethanol and 2% SDS and analysed by reducing 10% SDS-PAGE. Lane 1, bovine fibrinogen; lane 2, thrombin-produced fibrin clot; lane 3, recombinant cathepsin L2-produced fibrin clot; lane 4, native F. hepatica cathepsin L2-produced fibrin clot. The molecular-mass markers (in the outside lanes, arrowed) were: b-galactosidase 125 kDa; fructose-6-phosphate kinase, 89 kDa; pyruvate kinase, 65 kDa; egg albumin 45 kDa; glyceraldehyde-3-phosphate dehydrogenase, 36 kDa; carbonic anhydrase 29 kDa.

substrate specificities [9,10]. Since these enzymes cleaved immunoglobulin at a specific site in the hinge region and degraded intracellular adhesion proteins, such as laminin and fibronectin, they were suggested to be involved in parasite tissue invasion, nutrition and immune evasion [1 – 7,22 – 25]. Consequently, they were considered good candidates to which novel vaccines or anti-parasitic drugs could be directed. Recently, Dalton et al. [26] demonstrated that vaccination of cattle with cathepsin L1 and cathepsin L2 elicited high levels of protection against reinfection and induced significant anti-embryonation effects. Wijffels et al. [8] have also shown that vaccination of sheep with a preparation of F. hepatica cysteine proteinases, which presumably contained both cathepsin L1 and cathepsin L2, could induce high

anti-fecundity effects. The study of Dalton and Heffernan [2] also showed that soluble extracts of adult F. hepatica contained many more cysteine proteinases than are actively secreted, suggesting that other proteinases may be involved in normal physiological functions, such as protein catabolism, within the parasite cells. More recently, using consensus primers for cysteine proteinases in PCR, Heussler and Dobbelaere [19] showed that the F. hepatica cathepsin L genes belong to a complex multigene family composed of at least five different members (termed Fcp1–5). Other laboratories have isolated cDNAs which encode members of this F. hepatica cathepsin L family [7,20], but none have correlated a precise activity or physiological role to the corresponding proteins. In the present study we

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

used antiserum prepared against purified cathepsin L2 to screen an adult F. hepatica cDNA library. A cDNA clone which encoded a complete preprocathepsin L was isolated. The deduced amino acid sequence of this enzyme was 97% identical to a composite sequence of a member of the cathepsin L family, namely Fcp1, described by Heussler and Dobbelaere [19]. The largest of the Fcp1 clones encoded a proenzyme but lacked the pre-peptide sequence. The availability of a cDNA sequence encoding the complete preproenzyme allowed us to express the gene in yeast since the pre-peptide is essential in translocation of the protein into the endoplasmic reticulum [27]. The recombinant cathepsin L was rapidly purified from yeast culture medium by gel filtration chromatography with a typical yield of 66.6 – 100 mg protein per litre of fermentation. The low production of proteinase reflects the need to grow the yeast cells in a medium (lacking leucine and protein) which selects for cells transformed with the plasmid carrying the cathepsin L2 insert. The purified recombinant protein co-migrated with the native cathepsin L2 in reducing SDS-PAGE but migrated more slowly under native electrophoretic conditions which indicates some charge differences between the two proteins. Wijffels et al. [20] and Bozas and Spithill [28] showed that certain proline residues of F. hepatica proteins, including cathepsin Ls, are modified to unusual 3-hydroxyproline derivatives. These modifications, which would increase the polarity of the molecule, would not be expected to occur in yeast cells and hence may explain the observed differences in the electrophoretic mobility between the recombinant and native F. hepatica cathepsin L2 (the native protein migrates faster towards the positive electrode). Nevertheless, the recombinant enzyme was reactive with anti-cathepsin L2 antibodies and exhibited a similar pH optimum against Z-PheArg-NHMec to the native cathepsin L2. Moreover, the recombinant enzyme cleaved the substrate Z-Gly-Pro-Arg-NHMec, which we previously demonstrated to be a substrate for F. hepatica cathepsin L2 but not other cathepsin Ls [10]. Collectively, these data suggest that the cDNA isolated in this study encodes the preproenzyme of the major secreted cathepsin L2 proteinase.

171

Dowd et al. [12] showed that purified cathepsin L2 cleaved fibrinogen in a manner that led to the formation of a fibrin clot. This report was the first demonstration of a fibrin clot-producing activity by a proteinase other than that exhibited by the serine proteinase thrombin and the snake venom serine proteinases. Furthermore, the mechanism of clotting was unique in that it involved a novel cross-linking between the fibrin molecules and did not result from cleavage of the fibrinopolypeptides in a manner similar to the serine proteinases [12,21]. Time course studies demonstrated that clotting by cathepsin L2 was preceeded by the cleavage of the a polypeptide (66 kDa) producing the 100 and 25 kDa polypeptides and then cleavage of the b and g polypeptides (52 and 46.5 kDa, respectively) with the appearance of the 120 kDa polypeptide. Covalent cross-linking of cleaved fragments was suggested because the 100 and 120 kDa polypeptides were resistant to boiling in the presence of mercaptoethanol [12]. The production of fibrin clots by yeast-produced recombinant cathepsin L2 supports our findings that cathepsin L2 displays this activity, and discounts the possibility that the clotting activity previously reported was due to the combined action of cathepsin L2 and minor co-purified enzyme(s). However, the relevance of this clotting mechanism to the etiology of fascioliasis still remains unclear. Since adult flukes feed on host blood by puncturing the bile duct wall, this clotting strategy may be involved in preventing excessive bleeding at this puncture site. Alternatively, the formation of fibrin clots around the migrating parasite may prevent access of immune effector cells to its surface. A recent study on the cellular responses of sheep to liver fluke infections show that many immune effector cells do not make contact with the parasite and that parasites can simply move away from sites of cellular infiltration [29]. While other cathepsin proteinases, such as human cathepsin S [30] and Schistosoma mansoni cathespin B [31] have been expressed in S. cere6isiae, a subsequent activation step was required to obtain functionally active enzyme. In addition, both these cathepsin enzymes were expressed as fusion proteins with a-factor pre- or pre-pro regions. In contrast, functional expression of

172

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

cathepsin L2 in S. cere6isiae was obtained without the need to use a fusion protein. Therefore, the information necessary for processing and secretion in yeast is contained within the F. hepatica cathepsin L molecule. Moreover, NH2-terminal sequencing revealed that the processing of the cathepsin L2 proteinase in yeast involved cleavage at the precise position as that observed for the native enzyme. This observation raises an interesting point with regard to the mechanism by which this cathepsin L is processed. The F. hepatica cathepsin L2 differs from mammalian cathepsin Ls in that the mature enzymes have an additional amino acid, Ala, at the NH2-terminus [9,10]. Since processing in yeast also produced a mature enzyme with an additional Ala, it follows that this mechanism is not only dictated by the specificity of the processing enzymes but also by the structure of the molecule being processed. Processing in yeast involves endoproteinases, such as KEX2 and STE13, that cleave at susceptible peptide bonds within the pro-region [27]. It is possible that the final processing steps are performed by exopeptidases that clip only as far as the molecular conformation of the mature enzyme will allow. Other members of the Fasciola hepatica cathepsin L family have been reported to have no additional Ala [20], an additional Asp [32] or an Arg-Ala extension [7] at the NH2-terminal. These difference at the NH2-terminal end of the cathepsin L supports our proposal for an exopeptidase activity in the final stages of processing rather than a specific endopeptidase. Recently, the determination of the 3-dimensional structure of rat pro-cathepsin B and human procathepsin L revealed that in the region where the pro-peptides are cleaved the structure is very mobile making it more susceptible to proteolytic attack [33,34]. Asparaginyl residues were shown to occur near the cleavage site between the pro-peptide and mature enzymes of cathepsin L, cathepsin B, cathepsin C and cathepsin D proteinases of schistosomes, but were absent from their mammalian homologues [3,35]. This observation led Dalton and Brindley [35] to propose that a novel cysteine proteinase, an asparaginyl endopeptidase

recently characterised in schistosomes [36], was the endoproteolytic activity involved in the initial cleavage of the pro-peptide of these proteinases. We have found that asparaginyl residues are also present in the vicinity of the cleavage point between the pro-region and mature protein of the cathepsin L2 described in this study, and in cathepsin L1 (Roche and Dalton, accession no. U62288). Moreover, F. hepatica also expresses an asparaginyl endopeptidase ([32] Dowd and Dalton, unpublished). These observations suggest that trematodes possess a common mechanism, involving asparaginyl endopeptidases, for the processing and activation of cathepsin proteinases. A recent entry into the public databases (GenBank™ accession number U32517, PID g914991) revealed that S. cere6isiae possesses a putative asparaginyl endopeptidase; if this enzyme is involved in the maturation of secreted proteins it may explain why the F. hepatica cathepsin L is processed in yeast in a similar manner to that of the native protein. The liver fluke cathepsin L2 shows interesting physiochemical properties that differ from its mammalian homologues, including a higher pH optimum for activity, substrate specificity and a markedly increased structural stability [3,10,12]. The production of functionally active cathepsin L2 in yeast will now allow mutagenesis studies to explore structural/functional relationships. Furthermore, this system of enzyme expression could be employed in the study of other cathepsin L proteinases which are known to be involved in crucial biological functions of several important animal and human pathogens, such as schistosomes [37], hookworms [38] and malaria [39].

Acknowledgements This work was funded by grants received from Dublin City University and Mallinckrodt Veterinary Inc. Dr Leda Roche was a recipient of a Marie Curie Fellowship awarded by the Commission of the European Communities. Jose Tort received a scholarship from the Irish Council for Overseas Students.

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

References [1] Chapman CB, Mitchell GF. Proteolytic cleavage of immunoglobulin by enzymes released by Fasciola hepatica. Vet Parasitol 1982;11:165–78. [2] Dalton JP, Heffernan M. Thiol proteases released in vitro by Fasciola hepatica. Mol Biochem Parasitol 1989;35:161 – 6. [3] Dalton JP, Brindley PJ. Proteases of Trematodes. In: Fried B, Graczyk TK, editors. Advances in Trematode Biology. Boca Raton (FL): CRC Press, 1997. [4] McGinty A, Moore M, Halton DW, Walker B. Characterisation of the cysteine proteinases of the common liver fluke Fasciola hepatica using novel, active site directed affinity labels. Parasitology 1993;106:487–93. [5] Rege AA, Herrerea PR, Lopez M, Dresden MH. Isolation of a cysteine proteinase from Fasciola hepatica adult worms. Mol Biochem Parasitol 1989;35:89–96. [6] Yamasaki H, Aoki T, Oya H. A cysteine proteinase from the liver fluke Fasciola spp.: Purification, characterisation, localisation and application to immunodiagnosis. Jpn J Parasitol 1989;38:373–84. [7] Yamasaki H, Aoki T. Cloning and sequence analysis of the major cysteine proteases expressed in the trematode parasite Fasciola spp. Biochem Mol Biol Int 1993;31:537– 42. [8] Wijffels GL, Panaccio M, Salvatore L, Dosen M, Waddington J, Wilson L, Thompson C, Campbell N, Sexton J, Wicker J, Bowen F, Friedel T, Spithill T. Vaccination of sheep with purified cysteine proteinases of Fasciola hepatica decreases worm fecundity. Exp Parasitol 1994;78:132 – 48. [9] Smith AM, Dowd AJ, McGonigle S, Keegan PS, Brennan G, Trudgett A, Dalton JP. Purification of a cathepsin L-like proteinase secreted by adult Fasciola hepatica. Mol Biochem Parasitol 1993;62:1–8. [10] Dowd AJ, Smith AM, McGonigle S, Dalton JP. Purificaton of a second cathepsin L proteinase secreted by the parasitic trematode Fasciola hepatica. Eur J Biochem 1994;223:91 – 8. [11] Lottenberg R, Christensen U, Jackson CM, Coleman PM. Assay of coagulation proteases using chromogenic and fluorogenic substrates. Methods Enzymol 1981;80:341 – 61. [12] Dowd AJ, McGonigle S, Dalton JP. Fasciola hepatica cathepsin L proteinase cleaves fibrinogen and produces a novel type of fibrinogen clot. Eur J Biochem 1995;232:241 – 6. [13] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9. [14] Ammerer G. Expression of genes in yeast using the ADCI promoter. Methods Enzymol 1983;101:192–201. [15] Carter BLA, Irani M, Mackay VL, Seale RL, Sledziewski AV, Smith RA. In: Glover, DM, editor. DNA Cloning vol III. Oxford, UK: IRL Press, 1987.

173

[16] Leatherbarrow RJ. Enzfitter. Cambridge (UK): Elsevier Biosoft, 1987. [17] Barrett AJ, Kembhavi AA, Brown MA, Kirschke H, Knight CG, Tamai M, Hanada K. l-transepoxysuccinylleucylamino (4-guanido) butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsin B, H and L.. Biochem J 1982;201:189 – 98. [18] Biggs R. Human Blood Coagulation. In: Biggs R. editor. Haemostatis and Thrombosis. Philadelphia (PA): Blackwell, 1978, p. 722. [19] Heussler VT, Dobbelaere DAE. Cloning of a protease gene family of Fasciola hepatica by the polymerase chain reaction. Mol Biochem Parasitol 1994;64:11 – 23. [20] Wijffels GL, Panaccio M, Salvatore L, Wilson LR, Walker ID, Spithill TW. The secreted cathepsin L-like proteinases of the trematode, Fasciola hepatica, contain 3-hydroxyproline residues. Biochem J 1994;299:781 – 90. [21] Doolittle RF. Fibrinogen and fibrin. In: Bloom AL, Thomas DP, editors. Haemostasis and Thrombosis. London (UK): Churchill Livingstone, 1981, pp. 163 – 169. [22] Carmona C, Dowd AJ, Smith AM, Dalton JP. Cathepsin L proteinase secreted by Fasciola hepatica in vitro prevents antibody-mediated eosinophil attachment to newly excysted juveniles. Mol Biochem Parasitol 1993;62:9 – 18. [23] Smith AM, Dowd AJ, Heffernan M, Robertson CD, Dalton JP. Fasciola hepatica: A secreted cathepsin L-like proteinase cleaves host immunoglobulin. Int J Parasitol 1993;23:977 – 83. [24] Smith AM, Carmona C, Dowd AJ, McGonigle S, Acosta D, Dalton JP. Neutralization of the activity of a Fasciola hepatica cathepsin L proteinase by anti-cathepsin L antibodies. Parasite Immunol 1994;16:325 – 8. [25] Beresain P, Goni F, McGonigle S, Dowd AJ, Dalton JP, Frangione B, Carmona C. Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components. J Parasitol 1997;83:1 – 5. [26] Dalton JP, McGonigle S, Rolph TP, Andrews SJ. Induction of protective immunity in cattle against infection with Fasciola hepatica by vaccination with cathepsin L proteinases and with hemoglobin. Infect Immun 1996;64:5066 – 74. [27] Moir DT, Davidow LS. Production of proteins by secretion from yeast. Methods Enzymol 1991;194:491 – 507. [28] Bozas SE, Spithill TW. Identification of 3-hydroxyproline residues in several proteins of Fasciola hepatica. Exp Parasitol 1996;82:69 – 72. [29] Tkalcevic J, Brandon MR, Meussen ENT. Fasciola hepatica: Rapid switching of stage-specific antigen expression after infection. Parasite Immunol 1996;18:125 – 32. [30] Bromme D, Bonneau PR, Lachance P, Wiederanders B, Kirschke H, Peters C, Thomas DY, Storer AC, Vernet T. Functional expression of human cathepsin S in Saccharomyces cere6isiae. J Biol Chem 1993;268:4832 – 8. [31] Lipps G, Fullkrug R, Beck E. Cathepsin B of Schistosoma mansoni; purification and activation of the recombinant proenzyme secreted by Saccharomyces cere6isiae. J Biol Chem 1996;271:1717 – 25.

A.J. Dowd et al. / Molecular and Biochemical Parasitology 88 (1997) 163–174

174

[32] Tkalcevic J, Ashman K, Meeusen E. Fasciola hepatica: Rapid identification of newly excysted juvenile proteins. Biochem Biophys Res Comm 1995;213:169–74. [33] Cygler M, Sivaraman J, Grochulski P, Coulombe R, Storer AC, Mort JS. Structure of rat procathepsin B. Model for inhibition of cysteine protease activity by the proregion. Structure 1996;4:405–16. [34] Coulombe R, Grochulski P, Sivaraman J, Menard R, Mort JS, Cygler M. Structure of human procathepsin L reveals the molecular basis of inhibition by the prosegment. EMBO J 1996;15:5492–503. [35] Dalton JP, Brindley PJ. Schistosome asparaginyl endopeptidase Sm32 in hemoglobin digestion. Parasitol Today 1996;12:125.

.

[36] Dalton JP, Hola-Jamriska L, Brindley PJ. Asparaginyl endopeptidase activity in adult Schistosoma mansoni. Parasitology 1996;111:575 – 80. [37] Dalton JP, Clough KA, Jones MK, Brindley PJ. Characterisation of the cathepsin-like cysteine proteinases of Schistosoma mansoni. Infect Immun 1996;64:1328 – 34. [38] Dowd AJ, Dalton JP, Loukas AC, Prociv P, Brindley PJ. Secretion of cysteine proteinase activity by the zoonotic hookworm Ancylostoma caninum. Am J Trop Med Hyg 1994;51:341 – 7. [39] Salas F, Fichmann J, Lee GK, Scott MD, Rosenthal PJ. Functional expression of falcipain, a Plasmodium falciparum cysteine proteinase, supports its role as amalarial hemoglobinase. Infect Immun 1995;63:2120 – 5.

.