Isolation of acetic, propionic and butyric acid-forming bacteria from biogas plants

Journal of Biotechnology 220 (2016) 51–63

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Isolation of acetic, propionic and butyric acid-forming bacteria from biogas plants Katharina Gabriela Cibis ∗ , Armin Gneipel, Helmut König Institute of Microbiology and Wine Research (IMW), Johannes Gutenberg-Universität of Mainz, Johann-Joachim-Becherweg 15, 55128 Mainz, Germany

a r t i c l e

i n f o

Article history: Received 22 September 2015 Received in revised form 7 January 2016 Accepted 12 January 2016 Available online 15 January 2016 Keywords: Anaerobic digestion Specific primer qPCR Defluviitoga tunisiensis Acidogenesis Acid-producing bacteria

a b s t r a c t In this study, acetic, propionic and butyric acid-forming bacteria were isolated from thermophilic and mesophilic biogas plants (BGP) located in Germany. The fermenters were fed with maize silage and cattle or swine manure. Furthermore, pressurized laboratory fermenters digesting maize silage were sampled. Enrichment cultures for the isolation of acid-forming bacteria were grown in minimal medium supplemented with one of the following carbon sources: Na+ -dl-lactate, succinate, ethanol, glycerol, glucose or a mixture of amino acids. These substrates could be converted by the isolates to acetic, propionic or butyric acid. In total, 49 isolates were obtained, which belonged to the phyla Firmicutes, Tenericutes or Thermotogae. According to 16S rRNA gene sequences, most isolates were related to Clostridium sporosphaeroides, Defluviitoga tunisiensis and Dendrosporobacter quercicolus. Acetic, propionic or butyric acid were produced in cultures of isolates affiliated to Bacillus thermoamylovorans, Clostridium aminovalericum, Clostridium cochlearium/Clostridium tetani, C. sporosphaeroides, D. quercicolus, Proteiniborus ethanoligenes, Selenomonas bovis and Tepidanaerobacter sp. Isolates related to Thermoanaerobacterium thermosaccharolyticum produced acetic, butyric and lactic acid, and isolates related to D. tunisiensis formed acetic acid. Specific primer sets targeting 16S rRNA gene sequences were designed and used for real-time quantitative PCR (qPCR). The isolates were physiologically characterized and their role in BGP discussed. © 2016 Elsevier B.V. All rights reserved.

1. Introduction In biogas plants, a complex and dynamic microbial community produce biogas by anaerobic digestion of organic biomass. The process of anaerobic digestion is divided into four steps. In the first step (hydrolysis), organic polymers, such as polysaccharides, lipids and proteins, are converted into sugars, fatty acids, amino acids, alcohols, acids, other monomeric compounds, hydrogen and carbon dioxide. The hydrolysis products formed are degraded in the next step (acidogenesis) to volatile fatty acids (VFA), alcohols, carbon dioxide and hydrogen. The VFA are converted to acetic acid, carbon dioxide and hydrogen in the third step (acetogenesis). Methanogenic Archaea produce methane and carbon dioxide in the last step (methanogenesis) (Kaiser et al., 2008; Merlin Christy et al., 2014; Stantscheff et al., 2014).

Abbreviations: BGP, biogas plant; HPLC, high-performance liquid chromatography; PCR, polymerase chain reaction; qPCR, real-time quantitative PCR; SAPD-PCR, specifically amplified polymorphic DNA-PCR; VFA, volatile fatty acids. ∗ Corresponding author. E-mail address: [email protected] (K.G. Cibis). http://dx.doi.org/10.1016/j.jbiotec.2016.01.008 0168-1656/© 2016 Elsevier B.V. All rights reserved.

Acetic, propionic and butyric acid are important VFA produced during anaerobic digestion. An accumulation of VFA often leads to a decrease of the pH value in biogas plants and causes process disturbances. To overcome this problem, stopping the supply of substrates into biogas plants can counteract the acidification, because microorganisms have time for degradation of excess acids. The upper value of acetic acid in agricultural biogas plants should be lower than 3000 mg l−1 , the value of propionic acid lower than 1000 mg l−1 , of iso-butyric acid below 500 mg l−1 and of VFA below 4000 mg l−1 (Kaiser et al., 2008). Furthermore, a process disturbance could be possible, if the ratio of propionic acid to acetic acid is higher than 1.4 (Hill et al., 1987) or higher than 1.0 (if the value of propionic acid is greater than 1000 mg l−1 ; Weiland, 2010). According to the literature, certain bacteria can convert sugars, acids, alcohols or amino acids to propionic or butyric acid under anaerobic conditions. Glucose can be oxidized to propionic acid by Propionibacterium sp. or Arachnia propionica (Allen and Linehan, 1977; Pine and George, 1969). Glucose is converted to butyric acid, carbon dioxide and hydrogen during butyric fermentation. This reaction is performed, for example, by Clostridium butyricum, Clostridium pasteurianum or Butyrivibrio fibrisolvens (Gottschalk, 1979). Furthermore, microorganisms can metabolize various alcohols to propionic acid: Propionibacterium acidipropionici (glycerol

52

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

to propionic acid; Barbirato et al., 1997), Pelobacter propionicus (ethanol and carbon dioxide to propionic and acetic acid; Schink et al., 1987). Clostridium kluyveri is able to form butyrate and caproate from ethanol and acetic acid, respectively (Seedorf et al., 2008). Propionic and butyric acid can also be produced by the conversion of acids, which can be intermediates or end-products of the previous steps of anaerobic digestion. Propionigenium modestum and Selenomonas acidaminovorans are examples of bacteria, which can decarboxylate succinate to propionic acid (Guangsheng et al., 1992; Schink and Pfennig, 1982). Gottschalk (1979) and Seeliger et al. (2002) reported on the conversion of lactic acid to propionic acid, acetic acid and carbon dioxide by Propionibacterium sp., Veillonella parvula, Clostridium propionicum, Megasphaera elsdenii and Clostridium homopropionicum. Microorganisms can also use some amino acids for the formation of the three acids mentioned. Glutamate, for example, is converted to butyric and acetic acid by Clostridium tetanomorphum, Clostridium tetani, Clostridium cochlearium and Peptococcus aerogenes (Buckel and Barker, 1974). Furthermore, butyric and acetic acid are formed with the substrate lysine by Clostridium sticklandii (Fonknechten et al., 2010). C. propionicum, C. pasteurianum and P. aerogenes are capable of the formation of propionic acid, carbon dioxide and hydrogen by the degradation of threonine (Gottschalk, 1979). Up to now, the majority of microorganisms in biogas plants have been unexplored. In the past, molecular biological methods have been applied to get an insight into the diversity of microbiota. Metagenome analyses have revealed that many microorganisms have not yet been classified (Kröber et al., 2009). Because of the small number of isolates from biogas plants, there is a lack of microbial reference data about the physiology of these bacteria involved in the conversion of biomass to methane. Recently, a few isolates were obtained from biogas plants or laboratory biogas reactors: Koeck et al. (2014) identified isolated strains of Clostridium thermocellum, Hahnke et al. (2014), the new species Clostridium bornimense, and Stantscheff et al. (2014) methanogenic Archaea. Since bacteria, especially those which form acetic, propionic and butyric acid in biogas plants, have been weakly characterized in detail so far, we focused on the investigation of acid-forming bacteria in the present paper. Therefore, bacteria were isolated from four biogas plants and two pressurized laboratory biogas fermenters and were characterized physiologically. 2. Methods 2.1. Microorganisms The bacterial reference strains C. kluyveri (DSM-555), Clostridium sporosphaeroides (DSM-1294), Defluviitoga tunisiensis (DSM23805), Dendrosporobacter quercicolus (DSM-1736), Proteiniborus ethanoligenes (DSM-21650), Selenomonas bovis (DSM-23594) and Tepidanaerobacter acetatoxydans (DSM-21804) were purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). Selected acid-forming isolates from biogas plants used for physiological characterization were deposited in the culture collection of the Institute of Microbiology and Wine Research (IMW, Mainz, Germany). Additionally, isolate D. tunisiensis L3 was deposited with the DSMZ (DSM-29926). 2.2. Sampling In this study, three mesophilic (40 ◦ C) biogas plants were sampled: BGP Glahn (Zweibrücken, Germany), BGP Gebel (Oberthal, Germany) and BGP Wagner (Steinweiler, Germany). Furthermore, one thermophilic (54 ◦ C) biogas plant (BGP Butschen; Viersen, Germany) and two mesophilic (39 ◦ C) laboratory biogas fer-

menters (University of Hohenheim, Germany) were sampled. The mesophilic biogas plants were fed with the renewable resources maize silage and grass silage, and were partly supplemented with swine or cattle manure. The substrates in the thermophilic biogas plant were maize silage, barley, solid cattle manure and liquid swine manure. Further information about the biogas plants sampled are given in Table S1. In addition, two laboratory biogas fermenters pressurized to 5000 or 10,000 kPa were investigated. These fermenters were designed for investigating of the direct supply of purified biogas into the natural gas grid. They were fed with maize silage.

2.3. Isolation of acid-forming bacteria In order to isolate acid-forming bacteria, a 500 mg sludge sample of the corresponding biogas plants was added to 9 ml minimal medium (modified DSMZ medium 287; Stantscheff et al., 2014), supplemented with one carbon source (Na+ -dl-lactate, glucose, glycerol, succinate, ethanol or a mixture of the six amino acids: l-alanine, l-serine, l-threonine, l-cysteine, l-glutamic acid and lmethionine). The DSMZ medium 287 mentioned was modified to contain 5 ml trace element solution, 5 ml vitamin solution (DSMZ 141; DSMZ, 2012a), 6 g l−1 of one of the carbon sources mentioned and 1.5% (w/v) agar (if required). Sodium acetate were not added. Cultures vessels were pressurized to 50–100 kPa with a gas mixture (80:20; N2 /CO2 ). Preparation of nutrition media and isolation procedures were performed in an anaerobic chamber (Coy Laboratory Products, Michigan, USA). The mesophilic and thermophilic enrichment cultures were incubated at 39 ◦ C or 54 ◦ C, respectively. Different methods were used to achieve pure cultures of acidforming bacteria. At first, the enrichment cultures were diluted in a decadical serial dilution (10−1 –10−6 ). These bacterial cultures were plated onto Petri dishes, which were incubated in a special anaerobic stainless steel cylinder. For the deep agar shake method, 5 ml minimal medium with one carbon source and 1.5% agar were put into short culture tubes, which were covered with caps and placed into a gas-tight bottle of 1 l volume. This gas-tight bottle served as an anaerobic vessel and was pressurized to 50 kPa with N2 . After autoclaving for 20 min at 121 ◦ C, the media were cooled down to 50 ◦ C and inoculated and mixed with 0.1 ml enrichment culture or a bacterial culture with the aid of a sterile syringe. Then the agar shake was put into an ice-water bath for fast cooling. The cultures were incubated upside down in the gas-tight bottle at 39 ◦ C or 54 ◦ C. Colonies grown in the agar shake were withdrawn with a sterile needle and transferred into liquid media. This procedure was repeated at least three times for the preparation of pure cultures. Finally, the cultures were microscopically controlled. Further cultivations of the isolates obtained were performed in DSMZ medium 104b (DSMZ, 2014), DSMZ medium 1328 (DSMZ, 2012b) or modified DSMZ medium 287 with the respective carbon source.

2.4. Detection of acids in bacterial cultures Acids in enrichment and pure cultures were detected by high performance liquid chromatography (HPLC; Shimadzu, Kyoto, Japan). Samples were separated with the column Hpx87 (size: 300 × 7.8 mm, 9 ␮m particle size; BioRad, Munich, Germany) and analysed with the RI-Detector RID-10A (Shimadzu, Duisburg, Germany). Sulphuric acid (0.005 M) was used as a mobile phase. The injection volume was 10 ␮l, the flow rate was 0.6 ml min−1 and the temperature of the column oven amounted to 65 ◦ C. The measurement samples were previously centrifuged at 14,300 × g for 2 min and then filtered (filter 0.2 ␮m pore size; Macherey-Nagel, Düren, Germany).

Table 1 Isolates of acid-forming bacteria obtained from thermophilic BGP Butschen. Substrate

Acids formed

Fragment length [bp]a

Match [%]a

Next relative (based on 16S rRNA gene sequence)a

Family

Order

Phylum

D1 [KT274718] L14 [KT274713]

Glucoseb Lactic acid

A A

814 1375 1375

99 99 98

Clostridiaceae Peptococcaceae Peptococcaceae

Clostridiales Clostridiales Clostridiales

Firmicutes Firmicutes Firmicutes

AS34 [KT274714]

Amino acidsc

A, P

AS46 [KT274715]

Amino acidsc

A, P

Gluc2 [KT274716]

Glucose

A, B, L

1045 1045 1289 1289 1003

96 96 96 96 100

Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes

Glucose

A, B, L

1090

100

Thermoanaerobacterales

Firmicutes

L2 [KT274705] L3 [KT274706] L5 [KT274707] V5 AS22 [KT274708] AS30 [KT274709] ASV2 [KT274710] Succ20 [KT274711] Succ22 [KT274712]

Lactic acid Lactic acid Lactic acid Lactic acid Amino acidsc Amino acidsc Amino acidsc Succinate Succinate

A A A A A A A A A

459 1499 1253 – 1241 556 1242 791 600

100 100 100

Thermoanaerobacteraceae Thermoanaerobacteraceae Thermoanaerobacteraceae Thermoanaerobacteraceae Thermoanaero-bacterales Family III. Incertae Sedis Thermoanaero-bacterales Family III. Incertae Sedis Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae Petrotogaceae

Thermoanaerobacterales Thermoanaerobacterales Thermoanaerobacterales Thermoanaerobacterales Thermoanaerobacterales

Gluc4 [KT274717]

Tepidimicrobium xylanilyticum CS-3-1 Desulfotomaculum australicum AB33 Desulfotomaculum thermoscisternum DSM-10259 Tepidanaerobacter acetatoxydans Re2 Tepidanaerobacter syntrophicus JL Tepidanaerobacter syntrophicus JL Tepidanaerobacter acetatoxydans Re1 Thermoanaerobacterium thermosaccharolyticum DSM-571 Thermoanaerobacterium thermosaccharolyticum DSM-571 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1 Defluviitoga tunisiensis SulfLac1

Petrotogales Petrotogales Petrotogales Petrotogales Petrotogales Petrotogales Petrotogales Petrotogales Petrotogales

Thermotogae Thermotogae Thermotogae Thermotogae Thermotogae Thermotogae Thermotogae Thermotogae Thermotogae

d

100 99 100 100 100

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Strain [16S rDNA GenBank accession no.]

A = acetic acid, B = butyric acid, L = lactic acid, P = propionic acid. a Fragment length of 16S rRNA gene sequence and comparison with databases BLAST and EzTaxon. b Formation of acetic acid in medium DSMZ 1328 with 0.5 % (w/v) glucose (DSMZ, 2012b). c Minimal medium (modified DSMZ 287) containing the amino acids alanine, threonine, serine, glutamic acid,cysteine and methionine. d Identification with the aim of finding the fingerprint pattern of restriction digestion in comparison with sequenced isolates (Fig. S1A).

53

54

Table 2 Isolates of acid-forming bacteria obtained from mesophilic BGP Glahn, BGP Gebel and BGP Wagner. Substrate

Acids formed

Fragment length bp]a

Match [%]a

Next relative (based on 16S rRNA gene sequence)a

Family

Order

Phylum

SG1.4 [KT274739] ASG1.4B [KT274730]

Succinate Glucosec

A A, B, P

LW3.3B [KT274725] LG2.2 LG2.3 [KT274719] SG1.1 [KT274738]

Glucoseb Lactic acid Lactic acid Succinate

A A, P A, P A

100 99 99 99

EG2.4 [KT274742] SG1.4B [KT274740] ASG2.1A ASG2.1B ASG2.2 ASG2.3 [KT274731] ASW3.1 ASW3.2 [KT274732] ASW3.3 [KT274733] ASW3.5 [KT274734] ASW3.6 [KT274735] ASG1.4 [KT274729] LG2.4 [KT274720] LW3.1B LW3.2 LW3.4 [KT274721] LW3.5 [KT274722] LW3.6 [KT274723] GlyW3.4 [KT274741] LW3.3 [KT274724]

Ethanol Glucosec Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Amino acidsd Lactic acid Lactic acid Lactic acid Lactic acid Lactic acid Lactic acid Glycerol Lactic acid

A A A, B A, B, P A, A, B, P A A A, B A A A, B, P A, P A, P A, P A, P A, P A, P L, P, S A

1181 990 990 783 – 743 1278 1278 1278 981 1183 – – – 1255 – 1312 1239 1287 918 1288 981 – – 906 1011 663 1353 718

Clostridium kluyveri DSM-555 Clostridium cochlearium JCM 1396 Clostridium tetani E88 Sporanaerobacter acetigenes DSM-13106 Clostridium aminovalericum Clostridium aminovalericum JCM 11016 Desulfotomaculum guttoideum DSM-4024 Clostridium celerecrescens DSM-5628 Clostridium sphenoides DSM-632 Desulfotomaculum halophilum SEBR 3139 Gallicola barnesae DSM-3244 Clostridium sporosphaeroides Clostridium sporosphaeroides Clostridium sporosphaeroides Clostridium sporosphaeroides DSM-1294 Clostridium sporosphaeroides Clostridium sporosphaeroides DSM-1294 Clostridium sporosphaeroides DSM-1294 Clostridium sporosphaeroides DSM-1294 Clostridium sporosphaeroides DSM-1294 Proteiniborus ethanoligenes GW Dendrosporobacter quercicolus DSM-1736 Dendrosporobacter quercicolus Dendrosporobacter quercicolus Dendrosporobacter quercicolus DSM-1736 Dendrosporobacter quercicolus DSM-1736 Dendrosporobacter quercicolus DSM-1736 Selenomonas bovis WG Defluviitoga tunisiensis SulfLac1

Clostridiaceae Clostridiaceae Clostridiaceae Clostridiales Family XI. Incertae Sedis Lachnospiraceae Lachnospiraceae Lachnospiraceae Lachnospiraceae Lachnospiraceae Peptococcaceae Peptoniphilaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Ruminococcaceae Unclassified Clostridiales Veilonellaceae Veilonellaceae Veilonellaceae Veilonellaceae Veilonellaceae Veilonellaceae Veilonellaceae Petrotogaceae

Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Clostridiales Petrotogales

Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Firmicutes Thermotogae

e

99 100 100 100 93 89 e e e

99 e

98 99 99 98 96 99 e e

96 95 97 97 99

A = acetic acid, B = butyric acid, L = lactic acid, S = succinate, P = propionic acid. a Fragment length of 16S rRNA gene sequence and comparison with databases BLAST and EzTaxon. b Formation of acetic acid in medium DSMZ 1328 with 0.5 % (w/v) glucose (DSMZ, 2012b). c Formation of acetic acid in medium DSMZ 104b (DSMZ, 2014). d Minimal medium (modified DSMZ 287) containing the amino acids alanine, threonine, serine, glutamic acid, cysteine and methionine. e Identification with the aim of finding the fingerprint pattern of SAPD-PCR in comparison with sequenced isolates (Fig. S1B, C). f Numbers in strain labels indicate source of isolates: BGP Glahn (1.x), BGP Gebel (2.x) or BGP Wagner (3.x).

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Strain [16S rDNA GenBank accession no.]f

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

2.5. DNA isolation DNA isolation from bacterial strains was performed using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), following the protocol for gram positive bacteria. For DNA isolation, 600–1000 ␮l of a culture was centrifuged at 7500 × g for 5 min. The final elution volume was 180 ␮l. DNA from biogas plants was isolated using the Gene matrix stool DNA Purification Kit Eurx (Roboklon, Berlin, Germany). A total of 200 mg of sludge sample from each biogas plant was centrifuged at 13,000 × g for 10 min. The resulting pellet was washed twice in a sterile 0.9% (w/v) NaCl solution and then incorporated into the buffer of the “bead tubes” of the DNA isolation kit. DNA was eluted in 120 ␮l elution buffer. 2.6. Identification of isolated acid-forming bacteria The 16S rRNA genes were amplified using a polymerase chain reaction (PCR) for the identification of isolated bacteria. The PCRs were performed in a Thermal Cycler (PCR cycler S1000TM ; Bio-Rad, Munich, Germany) using the PCR programme described to Reuss et al. (2015). The PCR programme was modified in respect to the initial denaturation (95 ◦ C, 15 min) and the extension step (72 ◦ C, 1.5 min). The amplification of 16S rRNA genes was conducted using 1 ␮l forward primer (PurEubak5, 5 GAGTTTGATCMTGGCT-3 ; 10 ␮M), 1 ␮l reverse primer (PurEubak3 5 - AGAAAGGAGGTGATCC-3 ; 10 ␮M), 1 ␮l dNTPs (10 mM), 2 ␮l MgCl2 (25 mM), 5 ␮l PCR buffer (10×), 5 ␮l Enhancer solution, 32.6 ␮l sterile PCR water (Roth, St. Leon, Germany), 0.4 ␮l Taq-DNAPolymerase (5 U ␮l−1 ) and 2 ␮l template DNA. The final volume was 50 ␮l. All PCR ingredients were acquired from Peqlab (Erlangen, Germany). The PCR fragments were analysed with agarose gel electrophoresis (Sub-Cell® Model 96, BioRad, Munich, Germany) in a 1.5% (w/v) agarose gel for 45 min at 120 mV. The amplified 16S rRNA genes of isolated bacteria were cleaned up with USB® ExoSAP-IT® PCR Product Cleanup (affymetrix, Santa Clara, USA): 10 ␮l PCR product and 2 ␮l ExoSAP-IT reagent were incubated for 20 min at 37 ◦ C and then 25 min at 80 ◦ C. The PCR fragments were sequenced by LGC Genomics GmbH (Berlin, Germany). Sequences of the 16S rDNA fragment were determined with FinchTV (version 1.4.0, Geospiza Inc, Seattle, USA) and compared with the GenBank database using BLAST (Altschul et al., 1990) or EzTaxon server (Kim et al., 2012). 2.7. Specifically amplified polymorphic DNA (SAPD)-PCR and restriction enzyme digestion Strains were compared by molecular fingerprint methods, such as SAPD-PCR or restriction enzyme digestion. The SAPD-PCR was performed in accordance with Pfannebecker and Fröhlich (2008) using primer A-Not (5 -AGCGGCCGCA-3 ) (Sigma–Aldrich, Steinheim, Germany). The 16S rRNA gene was initially amplified, as described in Section 2.6, for restriction enzyme digestion. Then, the generated PCR products were digested with restriction enzymes  ) or HpaII (interface 5 -CCGG-3  ). The ˆ ˆ BsuRI (interface 5 -GGCC-3 restriction enzymes and corresponding buffer were purchased from Thermo Fisher Scientific (Waltham, USA). The PCR product (8.7 ␮l), restriction enzyme (0.3 ␮l) and respective buffer (1 ␮l) were incubated at 30 ◦ C overnight. The enzymes were then inactivated at 65 ◦ C for 15 min. Analyses of the restriction pattern were performed by 2.5% (w/v) agarose gel electrophoresis at 60 mV for 3 h. 2.8. Development of isolate-specific primer Primer sets were developed using the primer design tool PrimerBlast (Ye et al., 2012) for the detection of selected isolates in

55

biogas plants as soon as the isolates were quantified by using qPCR. Primer pairs were derived from 16S rDNA sequences of selected strains GlyW3.4, ASG2.3, ASG1.4, SG1.4, LG2.4, AS34 and L3, as well as the nearest relatives of other isolates with the accession numbers of the GenBank: Desulfotomaculum australicum (M96665.1), P. ethanoligenes (NR 044093.1), Thermoanaerobacterium thermosaccharolyticum (EU563362.1) and Tepidanaerobacter syntrophicus (NR 040966.1). At first, primer pairs were proofed for specificity using the databases “nucleotide collection (nt)” and “nucleotide collection (nt) (organism limited to bacteria)” within Primer-Blast. The generation of predicted length for PCR products was tested in PCR amplifications using the specific primer sets and DNA of corresponding isolates, biogas plants and reference strains. Furthermore, possible unspecific PCR products should be detected using DNA of the biogas plants. All primers were purchased from Eurofins MWG Operon, Ebersberg (Germany). The PCR programme was performed as follows: initial denaturation at 95 ◦ C; 5 min, 1 cycle; 35 cycles of denaturation at 94 ◦ C for 1 min, annealing at 59 ◦ C for 0.5 min, elongation at 72 ◦ C for 0.5 min; and final elongation at 72 ◦ C for 10 min. The PCR amplification was conducted using a 50 ␮l mixture as described in Section 2.6 for the amplification of the 16S rRNA gene (including 1 ␮l forward primer and 1 ␮l reverse primer of a specific primer set). Information about primer pairs is summarized in Table 4. 2.9. Real-time quantitative PCR The titre of the isolates was determined using qPCR. Therefore, a synthetic DNA fragment (796 bp) containing the primer binding sites of the primers used (Table 4) was constructed as a standard, according to May et al. (2015), for quantification. The qPCR was performed after May et al. (2015). Sludge samples were measured in duplicate or triplicate, and standard dilution series in quadruplicate. Serial dilution from 1011 to 104 copies ml−1 were produced in nuclease free water for the preparation of a qPCR standard. 2.10. Physiological characterization of selected isolates Further investigation of six isolates (L3, L14, Gluc4, SG1.4B, GlyW3.4 and ASG2.3; Table 5) were performed with different physiological tests. The substrate utilisation was carried out in the modified medium DSMZ 287 mentioned with one of the following substrates (0.3–0.5% (w/v)): acetic acid, arabinose, butyric acid, cellobiose, cellulose, fructose, galactose, glucose, glycerol, H2 /CO2 , lactic acid, lactose, maltose, mannitol, mannose, poly-galacturonic acid, propionic acid, rhamnose, ribose, starch, sucrose, trehalose, xylan or xylose. The utilisation of substrates and formation of intermediates or end-products were detected by HPLC after five to eight weeks. Tests were performed in duplicate. Microscopic examinations were carried out using the microscopes Zeiss Axiophot2 (Zeiss, Oberkochen, Germany) or Keyence Biozero 8000 (Keyence, Neu-Isenburg, Germany). The latter possessed a filter set for 4 ,6-Diamidin-2-phenylindol (DAPI) (adsorption,max = 359 nm, emission,max = 461 nm). In order to stain the cells with DAPI, 100–300 ␮l of a liquid culture was centrifuged at 9600 × g for 2 min and then washed in 300 ␮l sterile 0.9% (w/v) NaCl. The pellets were incorporated in 300 ␮l sterile 0.9% (w/v) NaCl mixed with 1 ␮l DAPI solution (1 mg ml−1 ). After an incubation time of 5 min, 30–50 ␮l were pipetted onto a microscopic slide. After airdrying in the dark, the cells were inspected with the microscopes mentioned. Cells were air-dried on a microscopic slide and then fixed by heating for gram-staining. The cells were covered with a crystal violet solution for 3 min and then washed with a potassium iodide solution. Thereafter, the microscopic slide was covered for 4 min with potassium iodide solution and then dunked in 96%

Tenericutes

Firmicutes

Firmicutes Firmicutes

Firmicutes Clostridiales

Firmicutes

Firmicutes Clostridiales

Phylum

(v/v) ethanol. After washing with water, the cells were counterstained with a carbol fuchsin solution for 10 s. All reagents for gram-staining were purchased from Merck (Darmstadt, Germany).

Firmicutes Firmicutes Firmicutes Firmicutes

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Firmicutes

56

Acholeplasmatales Acholeplasmataceae

Thermoanaerobacterales Thermoanaerobacteraceae

92 A Amino acidsc ASSH51 [KT274736]

596

100 780 A Lactic acid LakSH101 [KT274728]

A = acetic acid, P = propionic acid. a Fragment length of 16S rRNA gene sequence and comparison with databases BLAST and EzTaxon. b Formation of acetic acid in medium DSMZ 104b (DSMZ, 2014). c Minimal medium (modified DSMZ 287) containing the amino acids alanine, threonine, serine, glutamic acid, cysteine and methionine.

Lactobacillales Thermoanaerobacterales 99 100 A Glucoseb LakSH53B [KT274727]

738 741

Enterococcus casseliflavus RTCLI14 Enterococcus gallinarum RTCL13 Tepidanaerobacter syntrophicus JL Tepidanaerobacter acetatoxydans Re1 Acholeplasma morum 72-043 A Glucose GlucSH51 [KT274743]

99

97 586

738

Tissierella praecuta E064

97 586 Amino acids

ASSH103 [KT274737]

A

Lactic acid LakSH53A [KT274726]

c

Glucose GlucSH101 [KT274745]

A

Enterococcaceae Thermoanaerobacteraceae

Lactobacillales

Bacillales Bacillales Bacillales Clostridiales

Bacillaceae Bacillaceae Bacillaceae Clostridiales Family XI. Incertae Sedis Clostridiales Family XI. Incertae Sedis Clostridiales Family XI. Incertae Sedis Enterococcaceae 776 776 776 801

99 99 99 99

Bacillus thermoamylovorans BHK67 Bacillus firmus SS3 Bacillus siralis 171544 Bacillus circulans WRB-10 Soehngenia saccharolytica DSM-12858 Tissierella creatinini DSM-9508 100 753 A, P Glucose GlucSH52 [KT274744]

Acids formed Substrate Strain [16S rDNA GenBank accession no.]

A higher number of bacterial isolates was obtained from the sludge of mesophilic BGPs. Twenty-six isolates belonged to 12 different species of the phyla Firmicutes and Thermotogae (Table 2). Families of the mesophilic isolates represented were Clostridiaceae, Clostridiales Family XI. Incertae Sedis, Lachnospiraceae, Peptococcaceae, Peptoniphilaceae, Petrotogaceae, Ruminococcaceae, unclassified Clostridiales and Veilonellaceae. Eight isolates converted lactic acid to propionic and acetic acid. Two strains (LG2.2, LG2.3) from the BGP Gebel could be identified as Clostridium aminovalericum according to 16S rRNA gene sequence and by SAPD-PCR (Fig. S1B). The next relative of the six other propionic acid-forming bacteria were D. quercicolus (95–99%). Nine strains affiliated to C. sporosphaeroides were isolated from the BGP Gebel and BGP Wagner and formed acetic, propionic or butyric acid according to 16S rRNA sequence or SAPD-PCR pattern (Fig. S1C), respectively. Strain GlyW3.4 (isolated from BGP Wagner) converted glycerol to propionic acid. The highest sequence similarity of its 16S rDNA was to S. bovis. Further strains, which were able to form propionic and butyric acid, were ASG1.4 (96% P. ethanoligenes) and ASG1.4B (99% C. cochlearium, 99% C. tetani). Acetic acid-forming strains from BGP Glahn and BGP Wagner could be assigned to the species D. tunisiensis (LW3.3), Sporanaerobacter acetigenes (LW3.3B) and C. kluyveri (SG1.4). Strain SG1.1 had a similarity of 99% to Desulfotomaculum guttoideum, Clostridium celerecrescens and Clostridium sphenoides. Strain SG1.4B showed a similarity of 89% to Gallicola barnesae and strain EG2.4, isolated from an enrichment culture with

Table 3 Isolates of acid-forming bacteria obtained from high-pressure laboratory biogas fermenter.

3.2. Isolates of acid-forming bacteria in the mesophilic BGP Glahn, BGP Gebel and BGP Wagner

Fragment length [bp]a

Match [%]a

Next relative (based on 16S rRNA gene sequence)a

Family

A total of 15 isolates (Table 1) were obtained from the thermophilic biogas plant. They belonged to the phyla Firmicutes and Thermotogae, including the families Clostridiaceae, Peptococcaceae, Thermoanaerobacteraceae, Thermoanaerobacterales Family III. Incertae Sedis and Petrotogaceae, respectively. Nine isolates could be assigned to D. tunisiensis. They were able to form acetic acid from lactic acid, succinate or the aforementioned amino acid mixture. Strain L14 converted lactic acid to acetic acid. The next relative was the sulphate-reducing bacterium D. australicum. Two strains (AS34 and AS46), which formed acetic and propionic acid, were isolated from the enrichment culture containing the mixture of six amino acids. They were related to the genus Tepidanaerobacter (96%). The strains Gluc2 and Gluc4 converted glucose to butyric acid and lactic acid, respectively, and were identified as T. thermosaccharolyticum. Strain D1 (99% sequence similarity of 16S rRNA gene with Tepidimicrobium xylanilyticum) formed acetic acid from glucose.

Bacillaceae

3.1. Isolates of acid-forming bacteria from BGA Butschen

A

Order

A total of 34 mesophilic and 13 thermophilic isolates were obtained using the deep agar shake method. In addition, two thermophilic strains (Gluc2 and Gluc4) were isolated by anaerobic plating. Tables 1–3 contain the isolates of acid-forming bacteria obtained from the thermophilic and mesophilic biogas plants, and the pressurized laboratory biogas fermenters. The isolates were identified by comparison of their 16S rDNA sequence with sequences of reference strains in the databases of EzTaxon and BLAST, or by molecular biological comparison of isolates using SAPD-PCR or restriction enzyme digestion.

Bacillales

3. Results

Table 4 Characteristics of oligonucleotides specific for isolates or reference strains. Primer

Primer sequence (5 3 )

Length [bp]

Tm [◦ C]

Amplicon size [bp]

PCR amplicon with reference strainb

Strains with predicted PCR ampliconsc

Reference

Bacteria

Bac338F Bac805R Desausfw Desausrev GlyW34fw GlyW34rev

ACTCCTACGGGAGGCAG GACTACCAGGGTATCTAATCC TCCCTGGTTCGCATGGACTG TGAGCTGCGGTATTTCACCA AATGTTGTGTCACATTCGCATGAA AACATTCGTCCCCGACAACA

17 20 20 20 24 20

63.4 60.7 61.4 57.3 57.6 57.3

468

+ (isolate L3)

+

Yu et al. (2005)

419

N.D.

Desulfotomaculum australicum

This study

297

+ (DSM-23594)

Selenomonas bovis

This study

Pr.eth.fw Pr.eth.rev ASG2.3fw

CTTGACATCCCTCTGCCGTA TTCGCAGCCTCGCTACC ATGCATTAGGTGCCCTTCGG

20 17 20

59.4 57.6 59.4

284

+ (DSM-21650)

Proteiniborus ethanoligenes

This study

282

+ (DSM-1294)

DSM-1294 is not deposited in databases

This study

ASG2.3rev Tpf Tpr

CTGAGATCGCTTTTGGGGGT AGGTAGTAGAGAGCGGAAAC TGTCGCCCAGACCATAAA

20 20 18

59.4 57.3 53.7

237

+ (DSM-21804)

Tepidanaerobacter acetatoxydans

ASG1.4fw ASG1.4rev Thesacfw

GAGTGCTAGGTGTTGGTGGG TCTGTCTCCGAAGAGAAAGGACTA TGCATGAAGACGGAGTTGCT

20 24 20

61.4 61.0 57.3

220

− (DSM-21650)

Only isolate

Westerholm et al. (2011) This study

198

N.D.

d

This study

Thesacrev SG14fw SG14rev LakG2.4fw LakG2.4rev AS34fw AS34rev L3fw L3rev Tepsynfw Tepsynrev

CACCTTCCGATACGGCTACC AGGTAAAAATCGCATGATAAATGCC TCAGTTCCAATGTGGCCGTT AGATACATGCCTTCCCCTTTG GTTCCCGACCTTACTCGCTG GCGACCCGAGGTTATCCGAG TAGAGTGCCCACCCAAAGTG CCGCAGATACGGGTAGGAAC AGTGAGCATCGTTTACGGCT GACACGGGGATAGCTTCGG CGCTTTCTTTACACACCATTGGA

20 28 20 21 20 20 20 20 20 19 23

61.4 58.1 57.3 57.9 61.4 63.5 59.4 61.4 57.3 61.0 58.9

146

+ (DSM-555)

Clostridium kluyveri

This study

138

− (DSM-1736)

Only isolate

This study

137

− (DSM-21804)

Only isolate

This study

130

+ (DSM-23805)

Defluviitoga tunisiensis

This study

75

N.D.

Tepidanaerobacter syntrophicus

This study

Desulfotomaculum australicum [M96665.1] GlyW3.4 (97% Selenomonas bovis) [KT274741] Proteiniborus ethanoligenes [NR 044093.1] ASG2.3 (99% Clostridium sporosphaeroides) [KT274731] Tepidanaerobacter acetatoxydans

ASG1.4 (96% Proteiniborus ethanoligenes) [KT274729] Thermoanaerobacterium thermosaccharolyticum [EU563362.1] SG1.4 (99% Clostridium kluyveri) [KT274739] LG2.4 (99% Dendrosporobacter quercicolus) [KT274720] AS34 (96% Tepidanaerobacter sp.) [KT274714] L3 (100% Defluviitoga tunisiensis) [KT274706] Tepidanaerobacter syntrophicus [NR 040966.1]

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Target organisma [16S rDNA GenBank accession no.]

N.D. not determined, + PCR amplicon, - no PCR amplicon. a In brackets: next relatives to the strains according to 16S rRNA gene sequence. b Reference strains: Clostridium kluyveri (DSM-555), Clostridium sporosphaeroides (DSM-1294), Defluviitoga tunisiensis (DSM-23805), Dendrosporobacter quercicolus (DSM-1736), Proteiniborus ethanoligenes (DSM-21650), Selenomonas bovis (DSM-23594) and Tepidanaerobacter acetatoxydans (DSM-21804). c Comparison to databases “nucleotide collection (nt)” and “nucleotide collection (nt) (organism limited to bacteria)” within Primer-Blast. d Primer set binds 100% to DNA of Clostridium difficile, Clostridium sordellii, Clostridium thermoamylolyticum, Thermoanaerobacterium aotearoense, Thermoanaerobacterium saccharolyticum, Thermoanaerobacterium thermosaccharolyticum, Thermoanaerobacterium thermosulfurigenes, Thermoanaerobacterium xylanolyticum, Thermoanaerobium lactoethylicum and Thermohydrogenium kirishiense.

57

58

Table 5 Physiological characterization of isolates compared with their next relatives. Carbon source Polymers

Oligosaccharides

Pentoses

Alcohols Acids

Gases Gram-stainingc Morphology

Strain L3

1

Strain L14

2

3

Strain Gluc4

4

5

6

Strain SG1.4B

7

Strain GlyW3.4

8

Strain ASG2.3

9

− − + − + + + + − + + + − + + + + + − − (+) + (+) −

+a NR NR + + + + NR + + + + + NR + + + NR − − NR − NR −

− − − − + − + − − − + + − − + + − + − − (+) + + +

NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR + − + − NR

NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR NR − + + + +

− − + + + + + + + + + + + − + + + − + − − − − −

NR −b + + + + + + + + + + + − + NR + − − NR NR NR NR NR

NR −b + + + + + NR + + NR + NR NR + NR + − − NR NR NR NR NR

+ −b + + + + + + + + + + + + + NR + − − NR NR NR NR NR

− − − − + − − + − − + + − − + + − + + − − − − (+)

NR NR NR NR NR − NR NR NR NR NR − − NR NR − NR NR NR NR NR NR NR NR

− − + − + + + − + − + + + + + + − + − − − − − −

NR NR − NR + + NR + + NR NR + + NR + NR − − − NR NR − NR NR

− − − − + − + + − − + − − + + + − + − − − − − −

NR NR − NR − − − − − − NR + NR NR NR − − − NR NR NR + NR NR

− R

+/− R

+ R

+ R

+ R

+ R

+ R

+ R

+ R

+ C

+ C

+ CR

− CR

+ R

+ R

Reference strains: 1 = Defluviitoga tunisiensis SulfLac1 (Ben Hania et al., 2012), 2 = Desulfotomaculum australicum, 3 = Desulfotomaculum thermocisternum (Nilsen et al., 1996), 4 = Thermoanaerobacterium thermosaccharolyticum DSM-571, 5 = Thermoanaerobacterium thermosaccharolyticum FH1, 6 = Thermoanaerobacterium thermosaccharolyticum PSU-2 (O-Thong et al., 2008), 7 = Gallicola barnesae (Ezaki et al., 2001), 8 = Selenomonas bovis WG (Zhang and Dong, 2009), 9 = Clostridium sporosphaeroides DSM-1496a (Vos et al., 2009). C = cocci, forming irregular clusters, CR = curved rods, NR = not reported, R = rod-shaped, + = degradation, (+) = minor degradation, − = no degradation. a Utilisation of carboxymethyl cellulose. b Pectin was tested. c Gram-staining positive (+) or negative (−).

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Hexoses

Cellulose Poly-galacturonic acid Starch Xylan Cellobiose Lactose Maltose Trehalose Sucrose Fructose Galactose Glucose Mannose Rhamnose Arabinose Ribose Xylose Glycerol Mannitol Acetic acid Butyric acid Lactic acid Propionic acid H2 /CO2

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

ethanol as the carbon source, a similarity of 93% to Desulfotomaculum halophilum. 3.3. Isolates of acid-forming bacteria in high-pressure laboratory biogas fermenters Eight isolates were obtained by the deep agar shake method from two high-pressure laboratory biogas fermenters (Table 3). They were affiliated to Bacillaceae, Clostridiales Family XI. Incertae Sedis, Enterococcaceae, Thermoanaerobacteraceae (phylum Firmicutes) and Acholeplasmataceae (phylum Tenericutes). Strain GlucSH52 was able to form acetic and propionic acid by conversion of glucose. It was identified as Bacillus thermoamylovorans (100% sequence similarity of 16S rDNA). Acetic acid could be detected as a metabolic product during degradation of lactic acid, glucose or amino acids in the cultures of the other isolates. Isolate GlucSH101 showed a 99% similarity to Bacillus firmus, Bacillus siralis and Bacillus circulans. The remaining isolates showed an affiliation to the following species based on the 16S rDNA sequence: LakSH53B (100% T. syntrophicus), LakSH101 (100% T. acetatoxydans), LakSH53A (99% Soehngenia saccharolytica), ASSH103 (97% Tissierella creatinini, 97% Tissierella praecuta), GlucSH51 (99% Enterococcus casseliflavus, 99% Enterococcus gallinarum) and ASSH51 (92% Acholeplasma morum). 3.4. Validation of primer sets designed for qPCR So far, some specific primer sets detecting 16S rRNA gene sequences of selected isolates or of their next relatives were designed. They are listed in Table 4. Furthermore, PCR amplification with these primer pairs were performed in order to validate the predicted length of amplicons with genomic DNA of corresponding isolates, their next relatives (if DNA was available) and extracted DNA of the biogas plants (Fig. S2). A PCR product with DNA of the sludge samples of BGPs was visible after staining the gel with ethidium bromide in only five out of eleven PCR amplifications. Possibly, the amount of the PCR product with the other six primer pairs were below the detection limit for visualisation the DNA stained with ethidium bromide. Corresponding PCR products were generated with the DNA of the isolates and their next relatives with the primer sets Desausfw/Desausrev, GlyW34fw/GlyW34rev, ASG2.3fw/ASG2.3rev, SG14fw/SG14rev, L3fw/L3rev and Tepsynfw/Tepsynrev. Primer pair Thesacfw/Thesacrev was a groupspecific primer. Some strains of the genera Thermoanaerobacterium, Thermohydrogenium and Clostridium (Table 4) could generate a PCR product with this primer set, according to Primer-Blast (100% accordance of primer sequence to target DNA). Detection of other genera cannot be ruled out at this point. Primer set Pr.eth.fw/Pr.eth.rev is only specific for P. ethanoligenes GW. No PCR products were obtained from isolate ASG1.4 (96% P. ethanoligenes). Three primer sets (ASG1.4fw/ASG1.4rev, LakG2.4fw/LakG2.4rec and AS34fw/AS34rev) were specific for the respective isolates. Polymerase chain reaction products with their next relatives were not generated. Concerning the primers Tpf/Tpr, a part of the 16S rRNA gene was amplified with DNA of T. acetatoxydans DSM-21804 and isolate LakSH101, but not with the isolates AS34 and AS46, which are related to the genus Tepidanaerobacter. 3.5. Quantification of selected isolates with specific primer sets Real-time quantitative PCR with specific primer sets was performed to gain an insight of the titre in the biogas plants sampled (Fig. 1, Table S2). All numbers of 16S rDNA amplificates determined refer to 1 g sludge samples of a BGP. Values of 3.45 × 109 to 8.15 × 109 copies of 16S rDNA of total bacteria were detected in the biogas plants sampled with the primer set Bac338F/Bac805R (Yu et al., 2005). D. australicum (isolate L14), P. ethanoligenes, C.

59

kluyveri (isolate SG1.4) and T. syntrophicus showed similar values in the range of ca. 103 copies in all four BGP. T. acetatoxydans was detected in BGP Butschen and BGP Glahn with 103 copies of 16S rDNA, and in the other biogas plants in smaller amounts (101 to 102 copies). Contrarily, the isolate AS34 (96% Tepidanaerobacter sp.) exhibited distinctly higher values in all four biogas plants (ca. 107 copies of 16S rDNA). Isolate ASG1.4 was detected more often in the BGP examined (ca. 105 copies) compared to the next relative, P. ethanoligenes (ca. 103 copies). Values between 6.55 × 107 and 1.07 × 109 copies were determined with group-specific primer Thesacfw/rev (target at least ten species). There are variations between the four biogas plants for the strains GlyW3.4 (S. bovis), ASG2.3 (C. sporosphaeroides) and L3 (D. tunisiensis). S. bovis dominated in mesophilic BGP Glahn and Wagner (5.35 × 104 and 1.42 × 105 copies, respectively). C. sporosphaeroides was least abundant in the thermophilic BGP Butschen and most abundant in BGA Wagner (8.08 × 106 copies). The thermophilic species D. tunisiensis was detected in all BGP probed about 104 copies. D. tunisiensis showed an amount of 1.72 × 108 copies in the thermophilic BGP Butschen. 3.6. Physiological characterization of selected isolates Six isolates were selected for further characterisation: strain L3 (D. tunisiensis), strain L14 (D. australicum), strain Gluc4 (T. thermosaccharolyticum), strain SG1.4B (89% G. barnesae), strain GlyW3.4 (S. bovis) and strain ASG2.3 (C. sporosphaeroides). These strains showed best growth in the minimal medium used in comparison to the other isolates. Cell morphology of the isolates tested is shown in Fig. 2. Strain L3 was a rod-shaped bacterium and featured a sheathlike outer structure (toga). Cells of strain L3 occurred singly, in pairs or as long chains, and exhibited a length of 2–10 ␮m. Single rodshaped bacteria were observed in cultures of strain L14 (2–3 ␮m) and Gluc4 (3–5 ␮m). Strain ASG2.3 formed single rods or rods in pairs (1–2 ␮m). Strain GlyW3.4 revealed curved rod-shaped cells (ca., 4 ␮m) occurring single or in pairs. The isolate SG1.4B showed an irregular coccoid cell morphology. The coccal cells occurred singly or in cell packages. The diameter of cell packages amounted to 15–20 ␮m. Gram-staining for strain L3 was negative and was positive for the other five strains. The investigations of substrate utilisation in minimal medium are summarized in Table 5, and revealed that strain L3 was able to degrade the polymer starch, the oligosaccharides cellobiose, lactose, maltose and trehalose, as well as the monosaccharides arabinose, fructose, galactose, glucose, ribose and xylose. Differences to strain D. tunisiensis SulfLac1 were obtained in the utilisation of cellulose, mannose and sucrose. The substrate utilisation of strain Gluc4 agreed mostly with that of reference strains T. thermosaccharolyticum DSM-571, FH1 and PSU-2. In contrast to the reference strains, Gluc4 utilised mannitol, but not cellulose or rhamnose. The formation of butyric acid was found in cultures of strain Gluc4 with the following substrates: arabinose, cellobiose, fructose, galactose, glucose, lactose, maltose, mannose, ribose, sucrose, xylose and xylan. Further products in these reactions were acetic acid, lactic acid or ethanol. Strain GlyW3.4 was able to degrade starch, some oligosaccharides and monosaccharides, as well as glycerol, but not acids or gases. Formation of propionic acid was found by degradation of arabinose, mannose, rhamnose and starch. Contrary to the reference strain, S. bovis WG GlyW3.4 utilised starch and glycerol, but not trehalose. Strain L14 converted the following substrates to acetate: H2 /CO2 , propionic acid, lactic acid, cellobiose, glucose and glycerol. Additionally, a degradation of butyric acid, arabinose, galactose, maltose und ribose were determined. Strain L14 was similar to reference strains D. australicum and Desulfotomaculum thermocisternum in the utilisation of acids. The utilisation of the following substrates was detected in experiments with SG1.4B: arabinose, cellobiose, galactose, glucose, glycerol, mannitol, ribose

60

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Fig. 1. Quantification of different species targeting the 16S rRNA gene. DNA samples of BGP Butschen, BGP Glahn, BGP Gebel and BGP Wagner with the aim of finding the qPCR were investigated. Primer sets used are listed in Table 4. Error bars represent the minimal and maximal values of two or three qPCR reactions. Data are given in Table S2.

Fig. 2. Light micrographs of different isolates. A–D = phase contrast; E–I = staining preparations with DAPI. (A–D) strain Defluviitoga tunisiensis L3, (E) strain Desulfotomaculum australicum L14, (F) strain Thermoanaerobacterium thermosaccharolyticum Gluc4, (G), strain Gallicola sp. SG1.4B, (H) strain Selenomonas bovis GlyW3.4, and (I) strain Clostridium sporosphaeroides ASG2.4. Scale bar: 5 ␮m.

and trehalose. The next relative of this strain (89% G. barnesae) is not able to ferment glucose and ribose. Slight degradation of arabinose, cellobiose, galactose, glycerol, maltose, rhamnose, ribose

and trehalose was found in cultures of isolate ASG2.3. Any utilisation of sugars by the next relative C. sporosphaeroides has not been reported (Vos et al., 2009).

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

4. Discussion In this study, 49 acid-forming isolates were obtained from biogas plants and laboratory biogas fermenters fed with maize and grass silage, as well as cattle or swine manure. In the past, a lot of investigations regarding the anaerobic digestion of organic biomass to biogas in laboratory fermenters and biogas plants have been performed. Most studies were concerned with cultureindependent approaches, such as molecular biological analyses, e.g., 454-pyrosequencing technology, clone libraries based on 16S rDNA sequences and DGGE (denaturing gradient gel electrophoresis) analyses (Klocke et al., 2007; Kröber et al., 2009; Röske et al., 2014; Schlüter et al., 2008). However, there are only a few reports about culture-dependent studies, especially about the isolation of bacteria from agricultural biogas plants (Hahnke et al., 2014; Koeck et al., 2014), whereas a lot of sequences of molecular methods cannot be assigned to organisms because of missing reference data. For this reason, in this study, acid-forming bacteria were investigated. Acetic acid is an important substrate for methanogenesis, and propionic and butyric acid are augmented in reactors with disturbances (Kaiser et al., 2008). Lins and Illmer (2012) described an inhibition of methanogenesis due to high concentrations of propionate. Furthermore, Nielsen et al. (2007) proposed propionate and Ahring et al. (1995) butyrate and iso-butyrate as reliable indicators for process imbalance. Up to now, insufficient data about microbial communities and bacteria participation in biogas plants with disturbances due to propionic or butyric acid have been reported. Therefore, it is difficult to access the importance of the isolates obtained in the degradation of organic mass to biogas in such fermenters. Different isolates were obtained from the thermophilic BGP in comparison with the mesophilic BGPs. Possibly, the higher temperature (54 ◦ C) and the shorter hydraulic retention time of the thermophilic BGP (28 days; Table S1) could be one reason for the differences regarding the mesophilic and thermophilic isolates obtained. Results of substrate utilisation showed the formation of acetic, propionic or butyric acid from polymers such as starch and xylan, oligosaccharides, monosaccharides, acids, alcohols, amino acids and H2 /CO2 . Based on different substrate utilisation, isolates could be assigned to the following groups: 1 Utilisation of carbohydrates (polymers and oligosaccharides) and primary fermentation products; 2 utilisation of carbohydrates (polymers and oligosaccharides); 3 utilisation of oligosaccharides and monosaccharides, as well as primary fermentation products; 4 utilisation of amino acids; and 5 utilisation of acids and H2 /CO2 . An example of the first group is D. tunisiensis. This acetic acidforming bacterium could be detected in the biogas plants up to 108 copies of 16S rDNA per g sludge sample. High abundances of D. tunisiensis were also detected in a thermophilic laboratory fermenter (Guo et al., 2014; Lebuhn et al., 2014; Röske et al., 2014; Sasaki et al., 2013). The comprehensive substrate spectrum (polymers, oligosaccharide, acids and alcohols) shown in this study and described by Maus et al. (2015) could be an evidence for its high abundance and its important role in anaerobic digestion. Microscopic analyses of strain L3 revealed a sheath-like toga structure, previously described for Thermotoga maritima, which increases the cell membrane and facilitating nutrient uptake (Huber et al., 1986; Jiang et al., 2006). Perhaps the toga structure observed is also beneficial for D. tunisiensis in biogas plants. Another example of the first group is strain S. bovis GlyW3.4, which was able to produce propionic acid from starch, mannose, rhamnose, arabinose and the alcohol, glycerol. S. bovis could be detected with the specific primer set GlyW34fw/GlyW34rev with titres between 102 copies of 16S rDNA per g sludge sample in the thermophilic BGP Butschen and 105 copies in mesophilic BGP Wagner. S. bovis has only been detected using

61

DGGE analyses in a laboratory fermenter up to now (Ohnishi et al., 2010). T. thermosaccharolyticum (strain Gluc2 and Gluc4) is an example of the second group, which ferments only carbohydrates. Substrate utilisation revealed that strain Gluc4 could convert only polymers, such as starch and xylan, and a lot of oligosaccharides and monosaccharides to butyric, lactic and acetic acid, but it could not convert primary fermentation products. T. thermosaccharolyticum could be important in thermophilic anaerobic digestion, because Luo et al. (2011) and Lebuhn et al. (2014) detected this species in high abundances in laboratory fermenters. Isolates related to D. quercicolus or C. aminovalericum converted lactic acid to propionic acid in this study and belong to the third group. Vos et al. (2009) showed that these species utilise no polymers, such as starch, but only fructose or glucose, respectively. Another example of this group is strain Gallicola sp. SG1.4B, which was able to form acetic acid from some oligo- and monosaccharides and alcohols (Table 5). This strain is probably a new species of the genus Gallicola because of its 89% similarity based on the 16S rDNA sequence. This strain has not been described in biogas plants up to now. Protein and amino acid-degrading bacteria, such as strain C. sporosphaeroides ASG2.3, belong to the fourth group. This strain converted the mixture of amino acids (alanine, serine, threonine, glutamic acid, cysteine and methionine) to acetic acid, propionic acid or butyric acid. Growth on different sugars (Table 5) was weak. Therefore, it could be possible that C. sporosphaeroides is more important in the degradation of amino acids or, probably, proteins. Furthermore, qPCR analyses with the primer set ASG2.3fw/ASG2.3rev showed that C. sporosphaeroides is more abundant in all mesophilic biogas plants sampled (105 - 106 copies of 16S rDNA per g sludge sample), as in the thermophilic BGP Butschen (104 copies of 16S rDNA). An example of the last group (utilisation of acids and H2 /CO2 ) is the thermophilic strain D. australicum L14, which could degrade lactic, propionic and butyric acid and only a few sugars (Table 5). The ability to degrade short fatty acids, such as propionate, butyrate, lactate or acetate, by sulphate-reducing genus Desulfotomaculum was reported by Nilsen et al. (1996). Bacteria of this group are important during anaerobic digestion, because they form acetic acid, the substrate for methanogenesis, and could degrade propionic and butyric acid, which can lead to an acidification of the fermenter. Furthermore, species of the genus Desulfotomaculum produce undesired toxic H2 S.

5. Conclusions These investigations provide novel insights into the second stage of anaerobic microbial degradation of plant material in biogas plants. In this study, a broad range of acid-forming bacteria were isolated from well-operating mesophilic and thermophilic biogas plants as well as laboratory biogas fermenters belonging to the phyla Firmicutes, Tenericutes and Thermotogae. During these investigations classified and not classified species have been isolated (for example unclassified Clostridiales). Physiological characterization revealed the ability of the isolates to form acetic, propionic or butyric acid by conversion of important polymers and metabolites during anaerobic microbial degradation (polysaccharides, oligosaccharides, monosaccharides, acids, alcohols, amino acids, H2 /CO2 ). With the design of isolate-specific primer sets, several isolates could be detected and quantified in biogas plants, mainly in the range between 103 and 108 copies of 16S rDNA per g sludge sample. Furthermore, 16S rDNA sequences of isolates compared with databases and isolate-specific primer sets exhibited, that several isolates seem to be new species (e.g., strain

62

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63

Tepidanaerobacter sp. AS34, strain Proteiniborus sp. ASG1.4, strain Dendrosporobacter sp. LG2.4, strain Desulfotomaculum sp. EG2.4, strain Gallicola sp. SG1.4B and strain Acholeplasma sp. ASSH51). In following studies, the role of obtained isolates should be explored in biogas plants with process disturbances due to propionic and butyric acid accumulation. Because of its high abundances in biogas plants and its broad substrate spectrum, the importance of D. tunisiensis for anaerobic digestion should be further investigated. Acknowledgements We thank the German Federal Ministry of Food and Agriculture (BMEL) for financial support via the Fachagentur für Nachwachsende Rohstoffe e.V. (FNR; BIOGAS-CORE, grant number 22006812). We also thank F-J. Butschen (BGP Butschen), C. Glahn (BGP Glahn), H-H. Gebel (BGP Gebel) and H. Wagner (BGP Wagner) for providing samples from their biogas plants, and Dr. Andreas Lemmer (University Hohenheim) for providing samples of the high-pressure laboratory biogas fermenter, which were obtained from Tanja Türkes (Institute for Microbiology and Wine Research, University Mainz). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jbiotec.2016.01. 008. References Ahring, B.K., Sandberg, M., Angelidaki, I., 1995. Volatile fatty acids as indicators of process imbalance in anaerobic digestors. Appl. Microbiol. Biotechnol. 43, 559–565. Allen, S.H.G., Linehan, B.A., 1977. Presence of transcarboxylase in Arachnia propionica. Int. J. Syst. Bacteriol. 27, 291–292. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Barbirato, F., Chedaille, D., Bories, A., 1997. Propionic acid fermentation from glycerol: comparison with conventional substrates. Appl. Microbiol. Biotechnol. 47, 441–446. Ben Hania, W., Godbane, R., Postec, A., Hamdi, M., Ollivier, B., Fardeau, M.L., 2012. Defluviitoga tunisiensis gen. nov. sp. nov., a thermophilic bacterium isolated from a mesothermic and anaerobic whey digester. Int. J. Syst. Evol. Microbiol. 62, 1377–1382. Buckel, W., Barker, H.A., 1974. Two pathways of glutamate fermentation by anaerobic bacteria. J. Bacteriol. 117, 1248–1260. DSMZ, 2012a. Medium number 141: Methanogenium medium (H2 /CO2 ) medium. In Deutsche Stammsammlung von Mikroorganismen und Zellkulturen GmbH. List of recommended media for microorganisms. http://www.dsmz.de/ microorganisms/medium/pdf/DSMZ Medium141.pdf. accessed (28.04.13.). DSMZ, 2012b. Medium number 1328: Defluviitoga medium. In Deutsche Stammsammlung von Mikroorganismen und Zellkulturen GmbH. List of recommended media for microorganisms. http://www.dsmz.de/ microorganisms/medium/pdf/DSMZ Medium1328.pdf. accessed (08.11.13.). DSMZ, 2014. Medium number 104b: PY + X medium. In Deutsche Stammsammlung von Mikroorganismen und Zellkulturen GmbH. List of recommended media for microorganisms. http://www.dsmz.de/ microorganisms/medium/pdf/DSMZ Medium104b.pdf. accessed (21.05.14.). Ezaki, T., Kawamura, Y., Li, N., Li, Z.Y., Zhao, L., Shu, S., 2001. Proposal of the genera Anaerococcus gen. nov.: Peptoniphilus gen. nov. and Gallicola gen. nov. for members of the genus Peptostreptococcus. Int. J. Syst. Evol. Microbiol. 51, 1521–1528. Fonknechten, N., Chaussonnerie, S., Tricot, S., Lajus, A., Andreesen, J.R., Perchat, N., Pelletier, E., Gouyvenoux, M., Barbe, V., Salanoubat, M., Le Paslier, D., Weissenbach, J., Cohen, G.N., Kreimeyer, A., 2010. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence. BMC Genomics 11, 1–12. Gottschalk, G., 1979. Bacterial Metabolism, 1st ed. Springer-Verlag, New York. Guangsheng, C., Plugge, C.M., Roelofsen, W., Houwen, F.P., Stams, A.J.M., 1992. Selenomonas acidaminovorans sp. nov.: a versatile thermophilic proton-reducing anaerobe able to grow by decarboxylation of succinate to propionate. Arch. Microbiol. 157, 169–175. Guo, X., Wang, C., Sun, F., Zhu, W., Wu, W., 2014. A comparison of microbial characteristics between the thermophilic and mesophilic anaerobic digesters exposed to elevated food waste loadings. Bioresour. Technol. 152, 420–428.

Hahnke, S., Striesow, J., Elvert, M., Mollar, X.P., Klocke, M., 2014. Clostridium bornimense sp. nov. isolated from a mesophilic, two-phase, laboratory-scale biogas reactor. Int. J. Syst. Evol. Microbiol. 64, 2792–2797. Hill, D.T., Cobb, S.A., Bolte, J.P., 1987. Using volatile fatty acids relationships to predict anaerobic digester failure. Trans. ASEA 30, 496–501. Huber, R., Langworthy, T.A., König, H., Thomm, M., Woese, C.R., Sleytr, U.B., Stetter, K.O., 1986. Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubacteria growing up to 90 ◦ C. Arch. Microbiol. 144, 324–333. Jiang, Y., Zhou, Q., Wu, K., Li, X.Q., Shao, W.L., 2006. A highly efficient method for liquid and solid cultivation of the anaerobic hyperthermophilic eubacterium Thermotoga maritima. FEMS Microbiol. Lett. 259, 254–259. Kaiser, F., Metzner, T., Effenberger, M., Gronauer, A., 2008. Sicherung der Prozessstabilität in landwirtschaftlichen Biogasanlagen. In LfL-Information, pp. 6-14. Edited by Bayerische Landesanstalt für Landwirtschaft (LfL). Freising-Weihenstephan, Germany: Lerchl-Druck, Freising. Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., Park, S.C., Jeon, Y.S., Lee, J.H., Yi, H., Won, S., Chun, J., 2012. Introducing EzTaxon: a prokaryotic 16S rRNA Gene sequence database with phylotypes that represent uncultured species. Int. J. Syst. Evol. Microbiol. 62, 716–721. Klocke, M., Mähnert, P., Mundt, K., Souidi, K., Linke, B., 2007. Microbial community analysis of a biogas-producing completely stirred tank reactor fed continuously with fodder beet silage as mono-substrate. Syst. Appl. Microbiol. 30, 139–151. Koeck, D.E., Zverlov, V.V., Liebl, W., Schwarz, W.H., 2014. Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential. Syst. Appl. Microbiol. 37, 311–319. Kröber, M., Bekel, T., Diaz, N.N., Goesmann, A., Jaenicke, S., Krause, L., Miller, D., Runte, K.J., Viehöver, P., Pühler, A., Schlüter, A., 2009. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing. J. Bacteriol. 142, 38–49. Lebuhn, M., Hanreich, A., Klocke, M., Schlüter, A., Bauer, C., Pérez, C.M., 2014. Towards molecular biomarkers for biogas production from lignocellulose-rich substrates. Anaerobe 29, 10–21. Lins, P., Illmer, P., 2012. Effects of volatile fatty acids, ammonium and agitation on thermophilic methane production from biogas plant sludge in lab-scale experiments. Folia Microbiol. 57, 313–316. Luo, G., Xie, L., Zhou, Q., Angelidaki, I., 2011. Enhancement of bioenergy production from organic wastes by two-stage anaerobic hydrogen and methane production process. Bioresour. Technol. 102, 8700–8706. Maus, I., Cibis, K.G., Wibberg, D., Winkler, A., Stolze, Y., König, H., Pühler, A., Schlüter, A., 2015. Complete genome sequence of the strain Defluviitoga tunisiensis L3, isolated from a thermophilic, production-scale biogas plant. J. Biotechnol. 3, 17–18. May, T., Koch-Singenstreu, M., Ebling, J., Stantscheff, R., Müller, L., Jakobi, F., Polag, D., Keppler, F., König, H., 2015. Design and application of a synthetic DNA standard for real-time PCR analyses of microbial communities in anaerobic biogas digesters. Appl. Microbiol. Biotechnol. 99, 6855–6863. Merlin Christy, P., Gopinath, L.R., Divya, D., 2014. A review on anaerobic decomposition and enhancement of biogas production through enzymes and microorganisms. Renew. Sust. Energy Rev. 34, 167–173. Nilsen, R.K., Torsvik, T., Lien, T., 1996. Desulfotomaculum thermocisternum sp. nov.: a sulfate reducer isolated from a hot north sea oil reservoir. Int. J. Syst. Bacterio. 46, 397–402. Nielsen, H.B., Uellendahl, H., Ahring, B.K., 2007. Regulation and optimization of the biogas process: propionate as a key parameter. Biomass Bioenergy 31, 820–830. Ohnishi, A., Bando, Y., Fujimoto, N., Suzuki, M., 2010. Development of a simple bio-hydrogen production system through dark fermentation by using unique microflora. Int. J. Hydrog. Energy 35, 8544–8553. O-Thong, S., Prasertsan, P., Karakasheva, D., Angelidaki, I., 2008. Thermophilic fermentative hydrogen production by the newly isolated Thermoanaerobacterium thermosaccharolyticum PSU-2. Int. J. Hydrog. Energy 33, 1204–1214. Pfannebecker, J., Fröhlich, J., 2008. Use of a species-specific multiplex PCR for the identification of pediococci. Int. J. Food Microbiol. 128, 288–296. Pine, L., George, L.K., 1969. Reclassification of Actinomyces propionicus. Int. J. Syst. Evol. Microbiol. 19, 267–272. Reuss, J., Rachel, R., Kämpfer, P., Rabenstein, A., Küver, J., Dröge, S., König, H., 2015. Isolation of methanotrophic bacteria from termite gut. Microbiol. Res. 179, 29–37. Röske, I., Sabra, W., Nacke, H., Daniel, R., Zeng, A.P., Antranikian, G., Sahm, K., 2014. Microbial community composition and dynamics in high-temperature biogas reactors using industrial bioethanol waste as substrate. Appl. Microbiol. Biotechnol. 98, 9095–9106. Sasaki, D., Sasaki, K., Watanabe, A., Morita, M., Igarashi, Y., Ohmura, N., 2013. Efficient production of methane from artificial garbage waste by a cylindrical bioelectrochemical reactor containing carbon fiber textiles. AMB Express 3, 1–9. Schink, B., Pfennig, N., 1982. Propionigenium modestum gen. nov. sp. nov. a new strictly anaerobic: nonsporing bacterium growing on succinate. Arch Microbiol 133, 209–216. Schink, B., Kremer, D.R., Hansen, T.A., 1987. Pathway of propionate formation from ethanol in Pelobacter propionicus. Arch. Microbiol. 147, 321–327.

K.G. Cibis et al. / Journal of Biotechnology 220 (2016) 51–63 Schlüter, A., Bekel, T., Diaz, N.N., Dondrup, M., Eichenlaub, R., Gartemann, K.H., Krahn, I., Krause, L., Krömeke, H., Kruse, O., Mussgnug, J.H., Neuweger, H., Niehaus, K., Pühler, A., Runte, K.J., Szczepanowski, R., Tauch, A., Tilker, A., Viehöver, P., Goesmann, A., 2008. The metagenome of a biogas-producing microbial community of a production-scale biogas plant fermenter analysed by the 454-pyrosequencing technology. J. Biotechnol. 136, 77–90. Seedorf, H., Fricke, W.F., Veith, B., Brüggemann, H., Liesegang, H., Strittmatter, A., Miethke, M., Buckel, W., Hinderberger, J., Li, F., Hagemeier, C., Thauer, R.K., Gottschalk, G., 2008. The genome of Clostridium kluyveri, a strict anaerobe with unique metabolic features. Proc. Natl. Acad. Sci. U. S. A. 105, 2128–2133. Seeliger, S., Janssen, P.H., Schink, B., 2002. Energetics and kinetics of lactate fermentation to acetate and propionate via methylmalonyl-CoA or acrylyl-CoA. FEMS Microbiol. Lett. 211, 65–70. Stantscheff, R., Kuever, J., Rabenstein, A., Seyfarth, K., Dröge, S., König, H., 2014. Isolation and differentiation of methanogenic Archaea from mesophilic

corn-fed on-farm biogas plants with special emphasis on the genus Methanobacterium. Appl. Microbiol. Biotechnol. 98, 5719–5735. Vos, P., Garrity, G., Jones, D., Krieg, N.R., Ludwig, W., Rainey, F.A., Schleifer, K.H., Whitman, W., 2009. Bergey’s Manual of Systematic Bacteriology, Volume 3: The Firmicutes, 2nd ed. Springer Verlag, New York, USA. Weiland, P., 2010. Biogas production: current state and perspectives. Appl. Microbiol. Biotechnol. 85, 849–860. Westerholm, M., Dolfing, J., Sherry, A., Gray, N.D., Head, I.M., Schnürer, A., 2011. Quantification of syntrophic acetate-oxidizing microbial communities in biogas processes. Environ. Microbiol. Rep. 3, 500–505. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T.L., 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinf. 13, 134. Yu, Y., Lee, C., Kim, J., Hwang, S., 2005. Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol. Bioeng. 89, 670–679.

63