Isolation of Actinobacillus seminis from the Genital Tract of Rams in Spain

J. Comp. Path. 2000, Vol. 122, 217–222 doi:10.1053/jcpa.1999.0359, available online at http://www.idealibrary.com on

SHORT PAPER

Isolation of Actinobacillus seminis from the Genital Tract of Rams in Spain V. A. de la Puente-Redondo∗, N. Garcı´a del Blanco∗, C. Pe´rez-Martı´nez†, M. C. Gonza´lez-Rodrı´guez‡, E. F. Rodrı´guez-Ferri∗ and C. B. Gutie´rrez-Martı´n∗ ∗Unidad de Microbiologı´a y Inmunologı´a and †Unidad de Histologı´a y Anatomı´a Patolo´gica, Facultad de Veterinaria, Universidad de Leo´n, Leo´n, and ‡Asociacio´n Nacional de Castellano Auto´ctono, Valladolid, Spain

Summary Actinobacillus seminis isolates were cultured from the semen (two isolates) and the left testis (one isolate) of two one-year-old rams in Leo´n, Spain. One animal showed lesions of chronic unilateral orchitis and epididymitis while the other appeared to suffer a subclinical infection and only a moderate number of pleomorphic rods and inflammatory cells were present in its semen. The isolates were biochemically similar to the A. seminis type strain NCTC 10851 and two other European A. seminis isolates, except that they produced acid from sorbitol; their identity was confirmed by arbitrarily primed polymerase chain reaction. The isolates were also tested against 30 antimicrobial agents, and only marbofloxacin was found active against all of them. As far as is known, this is the first report of A. seminis isolation from rams in southern Europe.  2000 Harcourt Publishers Ltd

Several gram-negative, pleomorphic rods are known to be associated with contagious epididymitis and infertility in rams: Actinobacillus seminis, Brucella ovis, Corynebacterium pseudotuberculosis, Haemophilus agni, Histophilus ovis, Pasteurella haemolytica, Staphylococcus spp. and Streptococcus spp. ( Jansen, 1980; Cardenas and Maki, 1986). A. seminis was first isolated in Australia from a ram with epididymitis (Baynes and Simmons, 1960). In Europe, reports of ovine genital infection with A. seminis are limited to Hungary (Hajto´s et al., 1987) and the UK (Heath et al., 1991). There are relatively few distinguishing tests for this and phenotypically similar organisms (Actinobacillus actinomycetemcomitans, H. ovis, P. haemolytica), and there have been cases of misidentification (Walker et al., 1986). Recently, polymerase chain reaction (PCR) ribotyping, repetitive extragenic palindromic element (REP)-based PCR and enterobacterial reCorrespondence to: E. F. Rodrı´guez-Ferri. 0021–9975/00/020217+06 $35.00

petitive intergenic consensus (ERIC)-based PCR techniques have been described to distinguish A. seminis from other closely related organisms (Appuhamy et al., 1998). The two latter methods are based on the use of repetitive elements (REP or ERIC) which generate DNA fingerprints that facilitate discrimination between bacterial strains (Olive and Bean, 1999). A further method for DNA-based typing of micro-organisms is the arbitrarily primed polymerase chain reaction (AP-PCR) technique, also referred to as random amplified polymorphic DNA (RAPD) assay. This technique, first described in 1990, is based on the use of short random sequence primers which hybridize so strongly with chromosomal DNA sequences at low annealing temperatures that they can be used to initiate amplification of regions of the bacterial genome (Olive and Bean, 1999). The AP form of PCR was chosen for the present study because the primer (Universal M13 primer) is less expensive than primers used in REP- or ERIC-PCR, and also  2000 Harcourt Publishers Ltd

218

V. A. de la Puente-Redondo et al.

because, to our knowledge, this PCR method has never been reported previously for A. seminis. This paper describes (1) the first isolation of A. seminis from rams with fertility disorders in Spain, and (2) confirmation of the identity of the organism by APPCR. During the development of a genetic improvement programme at the “Animal Selection and Reproduction Centre” in Leo´n (Spain), fertility disorders were detected in two Castellano rams (nos 701 and 702) of high genetic index from a farm in Valladolid province (north-western Spain). No such disorders were detected in the remaining rams in the Centre. Infection with Brucella spp. was ruled out by the complement fixation test. Semen from 11 rams, including nos 701 and 702, was collected for bacteriology. In addition, when nos 701 and 702 were killed 2 months later, their testes and epididymides were removed, frozen, and sent to our laboratory. Semen and tissue samples were cultured on 5% sheep blood agar and MacConkey agar (Biolife, Italy), and incubated under both aerobic and microaerophilic (10% CO2) conditions at 37°C for 24 h. Pure growths on the plates were subjected to biochemical identification by means of commercially available media (API 20E, API 20NE and API ZYM strips; bioMe´rieux, France), which were used according to the instructions of the manufacturers. Catalase, oxidase and motility tests were carried out by routine methods. For comparison, A. seminis NCTC 10851, A. seminis C4 (isolated in the UK by Heath et al., 1991), and A. seminis H3 (isolated in Hungary by Hatjo´s et al., 1987) were subjected to the same biochemical examination. The three clinical isolates of A. seminis (see below) were compared to the strains listed in the legend of Fig. 4 by means of AP-PCR. For DNA preparation, colonies were picked from the plates, suspended in 200 ll of Insta Gene Matrix (Biorad, California, USA), and boiled in a waterbath for 8 min. The Universal M13 primer (TTATGTAAAACGACGGCCAGT) was used. PCR reactions were performed in 100-ll volumes containing 50 mM KCl, 10 mM Tris-CIH, 1·5 mM MgCl2, Triton X100 0·1%, 1 mM (each) dATP, dGTP, dTTP and dCTP (Promega, Spain), 1 lM primer, 3·5 U of Taq polymerase (Promega) and 5 ll of genomic DNA. Amplification was performed in a GeneAmp PCR System 2400 (Perkin Elmer, Germany) thermal cycler programmed for 3 cycles of 5 min at 94°C, 5 min at 40°C, and 5 min at 72°C, followed by 35 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C. Amplification products were analysed by electrophoresis on a 2% agarose gel

and “visualized” by ethidium bromide staining of DNA. Antimicrobial susceptibility was tested with 30 antimicrobial agents (amoxicillin, ampicillin, methicillin, penicillin G, cefoxitin, ceftriaxone, cephalexin, cephalothin, apramycin, gentamicin, kanamycin, neomycin, spectinomycin, streptomycin, doxycycline, oxytetracycline, clindamycin, erythromycin, lincomycin, tylosin, difloxacin, enrofloxacin, marbofloxacin, pefloxacin, sarafloxacin, bacitracin, fusidic acid, metronidazole, trimethoprim, and trimethoprim + sulphamethoxazole) by the Kirby-Bauer disc diffusion method (NCCLS, 1983); Mueller-Hinton agar (Biolife) containing sterile horse serum (Difco, Detroit, USA) 10% was used. After incubation of the disc diffusion plates, the isolates were classified as susceptible, intermediate or resistant by the zone diameter standards of Casals and Pringler (1991). The Escherichia coli ATCC 25922 strain was used as control. Specimens for histopathological examination were taken from the testes and epididymes of rams 701 and 702. These tissues were fixed in Bouin’s solution, processed for paraffin wax embedding, sectioned, and stained with haematoxylin and eosin (HE). Isolates of A. seminis from semen were obtained only from rams 701 and 702. Number 701 was a one-year-old animal with a history of reduced fertility during its first tupping season. Unilateral epididymitis and orchitis were detected clinically on palpation, and semen samples contained numerous floccules of pus. Giemsa-stained smears showed numerous neutrophils and bacilli. A pure growth of gram-negative rods, further characterized as A. seminis, was obtained from the semen (isolate 701/ 1). The animal was killed 2 months later, oxytetracycline treatment having proved unsuccessful. A. seminis was then isolated in pure culture from the left testis (isolate 701/2). Post-mortem examination showed fibrinous to fibrous adhesions between the tunica albuginea and the tunica vaginalis lining the scrotal sac. The left testis was smaller than the right and contained an abscess (4 cm in diameter) from which a fibrinopurulent fluid exuded. The tail of the left epididymis was enlarged and firm (Fig. 1). On the cut surface, distension of segments of the epididymal duct with yellow milky material was noted, together with abscess-like structures (0·2 cm in diameter). Histological examination of the left testis of animal 701 showed diffuse periorchitis and an abscess. Adjacent to this area, the seminiferous tubules showed epithelial cell vacuolation with little evidence of spermatogenesis, and interstitial fibrosis

Actinobacillus seminis Infection in Rams

Fig. 1. Ram 701. Note the enlargement of the tail of the epididymis, testicular atrophy and thick tunica vaginalis on the left side in relation to the right.

could also be seen. In some areas, tubular atrophy, sperm stasis (Fig. 2) and spermatic granulomas were noted. The left epididymis showed sperm stasis and cystic dilatations (spermatocoele). There were also numerous spermatic granulomas, with hypertrophy of smooth muscle surrounding some segments of the epididymal duct, and interstitial

219

fibrosis (Fig. 3). No gross or microscopical lesions were seen in the right testis or epididymis of ram 701. The gross and histological lesions described in this animal appeared to be similar to those previously reported for the chronic form of the infection caused by A. seminis (Hajto´s et al., 1987; Heath et al., 1991). However, genital disorders caused by B. ovis, an organism sometimes isolated from the testes and epididymes of rams, often show similar clinical signs and lesions (Linklater and Smith, 1993). Consequently, these two infections cannot be distinguished solely on the basis of clinical or pathological examination (Hajto´s et al., 1987), and isolation and biochemical characterization of the organism isolated become essential. The testes and epididymides of ram 702, which was also a one-year-old animal, were apparently normal on palpation. However, decreased fertility during the first tupping season was observed, accompanied by motionless sperm with twisted tails in semen samples. No growth of A. seminis was obtained for the first semen sample, but a heavy growth was obtained (isolate 702) from semen collected 2 months later. Gram-stained smears showed small numbers of gram-negative rods and inflammatory cells. No gross or microscopical lesions were observed in the testes and epididymides of this ram. The absence of lesions and paucity of both inflammatory cells and A. seminis in the semen of this animal indicated the subclinical form of the infection (Heath et al., 1991). Bacteriologically, the morphological and cultural

Fig. 2. Left testis of ram 701. Tubular atrophy and sperm stasis. HE. ×34.

220

V. A. de la Puente-Redondo et al.

Fig. 3. Left epididymis of animal 701. Spermatic granulomas and sperm stasis, hypertrophy of smooth muscle of epididymal duct, and interstitial fibrosis. HE. ×34.

characteristics of isolates 701/1, 701/2 and 702 were similar to those of A. seminis strains NCTC 10851, C4 and H3. Biochemical tests made on these six cultures gave results which were identical, except that only the three Spanish isolates produced acid from sorbitol. All six cultures were non-motile gram-negative bacilli, positive for catalase, oxidase, nitrate and ornithine decarboxylase, and negative for indole, urease and b-galactosidase. These reactions placed the isolates close to the species A. seminis (Hajto´s et al., 1987), a suggestion to which the enzymatic profiles obtained with API ZYM strips gave strong support. AP-PCR profiles clearly showed that all six A. seminis genomes included in the study (Fig. 4, lanes 2 to 7) were closely related, confirming the biochemical identification of the three clinical isolates. On the other hand, lanes 8 to 17, which represented other Actinobacillus species or closely related organisms, were completely different. Only slight differences could be detected between the six A. seminis strains. Isolates 701/1 and 701/2 (lanes 3 and 4, respectively) were identical, while isolate 702 (lane 2) showed minor differences. In addition, 701/1 and 701/2 were almost identical with A. seminis H3 (lane 5), and these three isolates showed only minor differences from A. seminis C4 and NCTC 10851 (lanes 6 and 7, respectively). These two latter strains shared similar profiles, the only difference being an intense band (about 1100 bp) shown by A. seminis C4 and possibly due to a plasmid (Fig. 4). These results suggest that APPCR with the Universal M13 primer is a potentially useful method for the rapid identification of A. seminis isolates.

Only one of the 30 antimicrobial agents tested, marbofloxacin, a recently developed quinolone, was effective against the three Spanish A. seminis isolates. Penicillin G, cefoxitin, gentamicin and oxytetracycline were also effective against isolate 701/1 (recovered from the semen). As this isolate was found to be susceptible to oxytetracycline, ram 701 was treated with this antimicrobial agent; however, the infection did not resolve, and 2 months later isolate 701/2, which was resistant to oxytetracycline, was recovered from the left testis. This isolate was particularly resistant, only marbofloxacin being effective against it. In contrast, isolate 702 (recovered from the semen of the other ram) was susceptible to amoxicillin, cephalexin, gentamicin, kanamycin, spectinomycin, tetracyclines, clindamycin, erythromycin and quinolones. For the three Spanish A. seminis isolates, 13 of the 30 antimicrobial agents tested were completely ineffective. The results obtained for these isolates were quite different from those reported by Hajto´s et al. (1987) for 18 A. seminis strains isolated in Hungary, against which penicillin, oxytetracycline, erythromycin and streptomycin were highly active. A. seminis is a natural inhabitant of the preputial cavity of rams after the age of about 12 weeks, and it is possible that epididymitis results from ascending infection (Walker et al., 1986). Stress, hormonal changes during sexual maturation or feeding anomalies have been cited as predisposing factors ( Jansen, 1983). The source of the initial exposure of the rams in this report could not be ascertained. A. seminis has been extensively reported in countries in which ovine brucellosis has been

221

Actinobacillus seminis Infection in Rams

Fig. 4. Genomic fingerprints of A. seminis clinical isolates compared to different Pasteurellaceae reference strains amplified by APPCR with the Universal M13 primer. Size marker was DNA molecular weight marker K, 0·07–12·2 kbp (Boehringer Mannheim). Lanes: 1, Ladder; 2, A. seminis 702; 3, A. seminis 701/1, 4, A. seminis 701/2; 5, A. seminis strain H3; 6, A. seminis strain C4; 7, A. seminis NCTC 10851; 8, Actinobacillus actinomycetemcomitans NCTC 9710; 9, Actinobacillus equuli NCTC 8529; 10, Actinobacillus pleuropneumoniae serotype 1 ATCC 27088; 11, A. pleuropneumoniae serotype 7 WF83; 12, Actinobacillus suis CCM 5586; 13, Actinobacillus lignieresii NCTC 4189; 14, Actinobacillus rossi NCTC 10801; 15, Haemophilus parasuis serovar 2 H410; 16, Pasteurella haemolytica NCTC 9712; 17, Pasteurella multocida subsp. multocida NCTC 10322.

reduced in incidence or has disappeared, e.g., the UK (OIE, 1996b). However, in European countries such as Spain, in which ovine brucellosis is still prevalent (OIE, 1996a), genital infections caused by A. seminis in rams have not hitherto been reported. This may be because infection is sometimes mistakenly attributed to B. ovis or because A. seminis is a fastidious, slow-growing organism, or because it is often misidentified as H. ovis or as related species belonging to the genus Pasteurella. As far as is known, this is the first isolation of A. seminis from rams in Spain or southern Europe. The production of acid from sorbitol and the high resistance encountered to most of the antimicrobial agents tested clearly distinguished our isolates from other European strains (Hajto´s et al., 1987; Heath et al., 1991). Clearly, in future investigations of infertility in Spanish rams A. seminis must be borne in mind. Acknowledgments The authors are sincerely grateful to R. Parton and C. Low for supplying A. seminis isolate C4, L.

Fodor for supplying A. seminis isolate H3, and P. Kielstein for supplying H. parasuis serovar 2 H410. They also thank M. C. Ferreras Estrada and M. J. Garcı´a Iglesias, Histology and Pathological Anatomy Section of the Faculty of Veterinary Medicine of Leo´n (Spain), for advice on the preparation of this paper. References Appuhamy, S., Coote, J. G., Low, J. C. and Parton, R. (1998). PCR methods for rapid identification and characterization of Actinobacillus seminis strains. Journal of Clinical Microbiology, 36, 814–817. Baynes, I. D. and Simmons, G. C. (1960). Ovine epididymitis caused by Actinobacillus seminis n. sp. Australian Veterinary Journal, 36, 454–459. Cardenas, A. L. and Maki, L. R. (1986). Detection of antibody in rams with contagious epididymitis, using the enzyme-linked immunosorbent assay. American Journal of Veterinary Research, 47, 738–739. Casals, J. B. and Pringler, N. (1991). Antibacterial/Antifungal Sensitivity Testing using Neo-Sensitabs, 9th Edit., Rosco Diagnostica, Traastrup, p. 21. Hajto´s, I., Fodor, L., Gla´vits, R. and Varga, J. (1987). Isolation and characterization of Actinobacillus seminis

222

V. A. de la Puente-Redondo et al.

strains from ovine semen samples and epididymitis. Journal of Veterinary Medicine B, 34, 138–147. Heath, P. J., Davies, I. H., Morgan, J. H. and Aitken, I. A. (1991). Isolation of Actinobacillus seminis from rams in the United Kingdom. Veterinary Record, 129, 304–307. Jansen, B. C. (1980). The aetiology of ram epididymitis. Onderstepoort Journal of Veterinary Research, 47, 101–107. Jansen, B. C. (1983). The epidemiology of bacterial infection of the genitalia in rams. Onderstepoort Journal of Veterinary Research, 50, 275–282. Linklater, K. A. and Smith, M. C. (1993). Colour Atlas of Diseases and Disorders of the Sheep and Goat, BPCC Hazell Books, Aylesbury, England, p. 125. NCCLS (1983). Performance Standards for Antimicrobial Disc Susceptibility Tests. M2-T3, 3rd Edit., National Committee for Clinical Laboratory Standards, Villanova, PA, USA.

Office International des Epizooties (1996a). Sante´ animale mondiale en 1996, p. 136. Office International des Epizooties (1996b). Sante´ animale mondiale en 1996, p. 312. Olive, D. M. and Bean, P. (1999). Principles and applications of methods for DNA-based typing of microbial organisms. Journal of Clinical Microbiology, 37, 1661–1669. Walker, R. L., LeaMaster, B. R., Stellflug, J. N. and Biberstein, E. L. (1986). Association of age of ram with distribution of epididymal lesions and etiologic agent. Journal of the American Veterinary Medical Association, 188, 393–396.



Received, July 12th, 1999 Accepted, October 11th, 1999