- Email: [email protected]
Isolation of carbapenem-resistant Pseudomonas spp. from food
G Model
JGAR-146; No. of Pages 6 Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Global Antimicrobial Resistance journal homepage: www.elsevier.com/locate/jgar
Isolation of carbapenem-resistant Pseudomonas spp. from food Marcus Ho-yin Wong a,b, Edward Wai chi Chan a,b, Sheng Chen a,b,* a
Shenzhen Key Laboratory for Food Biological Safety Control, Food Safety and Technology Research Centre, The Hong Kong Polytechnic University Shenzhen Research Institute, Shenzhen, PR China b State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong
A R T I C L E I N F O
A B S T R A C T
Article history: Received 8 January 2015 Received in revised form 10 March 2015 Accepted 13 March 2015
Pseudomonas spp. are ubiquitous in nature. Carbapenem resistance in environmental isolates of members of this genus is thought to be rare but the exact resistance rate is unknown. In this study, carbapenem-resistant Pseudomonas spp. were isolated from chicken and pork samples and the mechanisms underlying the carbapenem resistance in these strains were investigated. A total of 16 carbapenem-resistant Pseudomonas aeruginosa, Pseudomonas putida and Pseudomonas otitidis isolates were recovered from eight samples of chicken and pork. The isolates exhibited meropenem minimum inhibitory concentrations (MICs) of 8 to 32 mg/L and imipenem MICs of <0.5–16 mg/L yet did not harbour any acquired carbapenemase genes. Meropenem resistance in various strains was found to be mediated by efflux systems only, whereas overexpression of MexAB–OprM efflux pump and lack of OprD porin were responsible for carbapenem resistance in P. aeruginosa. The intrinsic metallo-b-lactamase gene blaPOM in P. otitidis and overexpression of the TtgABC efflux system in P. putida were also responsible for carbapenem resistance in these organisms. In conclusion, this study reports for the first time the isolation of carbapenem-resistant P. aeruginosa, P. otitidis and P. putida strains from food. The resistance mechanisms of these strains are rarely due to production of carbapenemases. Further selection of such carbapenem-resistant Pseudomonas spp. in the environment and the risk by which they are transmitted to clinical settings are of great public health concern. ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Keywords: Carbapenem Pseudomonas aeruginosa Pseudomonas putida Pseudomonas otitidis Food
1. Introduction Pseudomonas spp. are ubiquitous in the environment, with Pseudomonas aeruginosa being the most common opportunistic pathogen in this genus. This organism is a common causative agent of various opportunistic infections, especially among cystic fibrosis and burns patients as well as immunocompromised people [1]. Similarly, Pseudomonas putida may cause urinary tract infections in immunocompromised patients as well as bacteraemia in neonatal and cancer patients [2,3]. In contrast, Pseudomonas otitidis is a relatively novel micro-organism identified in 2006 and is responsible for causing otic infections [4]. Multidrug resistance, including resistance to b-lactams, fluoroquinolones and aminoglycosides, is frequently observed among P. aeruginosa [5]. Resistance has also emerged in P. putida and P. otitidis, rendering
* Corresponding author at: State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong. Tel.: +852 3400 8795; fax: +852 2364 9932. E-mail address: [email protected] (S. Chen).
treatment of infections caused by such pathogens exceedingly difficult [2,6]. Carbapenem antimicrobials are considered the last resort for treatment of infections caused by multidrug-resistant pathogens. However, carbapenem resistance in different bacterial species is increasingly common worldwide and has become a major public health problem. In most cases, bacteria developed carbapenem resistance by means of taking up exogenous carbapenemase genes; however, P. aeruginosa is capable of establishing intrinsic carbapenem resistance through self-regulated physiological changes instead of acquisition of resistance elements. Common resistance mechanisms include overexpression of efflux systems and AmpC b-lactamase as well as mutational inactivation of the outer membrane protein OprD [7]. It remains to be seen whether other Pseudomonas spp. possess the ability to become carbapenemresistant by such physiological and genetic changes. To date, it is known that carbapenem resistance in P. putida and P. otitidis, respectively, is associated with acquisition of metallo-b-lactamases (MBLs) and the production of an intrinsic MBL POM-1, which to some extent confers carbapenemase activities [3,4].
http://dx.doi.org/10.1016/j.jgar.2015.03.006 2213-7165/ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
2
The incidence of carbapenem resistance in foodborne isolates is estimated to be low as carbapenems are not used in animal farming. However, carbapenem-resistant micro-organisms in food production animals have become detectable recently [8,9]. Dissemination of this category of potential pathogens between environmental and nosocomial settings is of particular concern. This study describes the isolation of carbapenem-resistant Pseudomonas spp. from retail meat products in Hong Kong as well as an analysis of the genetic and physiological basis of their resistance phenotypes.
2. Materials and methods 2.1. Bacterial isolation and confirmation A total of 16 chicken and pork meat samples (8 of each) were purchased from two different supermarkets on four separate sampling dates in Hong Kong during the summer of 2011. The samples were homogenised and enriched in Peptone Water (Oxoid Ltd., Basingstoke, UK) for 24 h at 37 8C with shaking, followed by direct spreading on MacConkey agar (Oxoid Ltd.) containing 2 mg/ L meropenem (Santa Cruz Biotech, Dallas, TX). Two colonies were recovered from each plate and were purified and identified by API20E (bioMe´ rieux, Craponne, France) and 16S rRNA sequencing. Isolates whose 16S rRNA sequencing results were ambiguous were further subjected to confirmation by the VITEK1 2 system (bioMe´rieux). Multilocus sequence typing (MLST) was performed and interpreted on P. aeruginosa isolates according to the PubMLST scheme (http://pubmlst.org/paeruginosa/). 16S rRNA sequences of P. putida isolates were aligned by the ClusterW2 algorithm and a phylogenetic tree was compiled by the maximum-likelihood algorithm approach using BioEdit software (http://www.mbio. ncsu.edu/bioedit/bioedit.html). Pulsed-field gel electrophoresis (PFGE) was performed as described previously [10]. Briefly, agarose-embedded DNA was digested with XbaI (New England Bio-Labs, Ipswich, UK) at 37 8C for 1.5 h. The restriction fragments were separated by electrophoresis in 0.5 TBE [Tris–borate– ethylene diamine tetra-acetic acid (EDTA)] buffer at 14 8C for
18 h using a CHEF-DR1 II Electrophoresis System (Bio-Rad, Hercules, CA) with pulse times of 0.5–30 s. The gels were stained with GelRedTM (Biotium, Hayward, CA) and DNA bands were visualised with ultraviolet transillumination (Bio-Rad). Fragment patterns were interpreted as described previously [11]. 2.2. Antimicrobial susceptibility and carbapenemase activity testing Antimicrobial susceptibility testing was carried out by the agar dilution method with the antimicrobials listed in Table 1. Results were interpreted following Clinical and Laboratory Standards Institute (CLSI) guidelines [12]. Escherichia coli ATCC 25922 and ATCC 35218 and P. aeruginosa ATCC 27853 were used as quality control strains. The minimum inhibitory concentrations (MICs) of the efflux pump inhibitor phenylalanine–arginine b-naphthylamide (PAbN) for the isolates was determined by the broth microdilution method. Involvement of efflux systems in reduced carbapenem susceptibility was tested by determining the meropenem MIC in the presence and absence of PAbN at a concentration of 40 mg/mL [13]. The carbapenemase activity of all isolates was tested by the Modified Hodge test (MHT) against meropenem and imipenem using E. coli ATCC 25922 as the indicator organism as described previously [12]. The Carba NP test was performed on the four P. otitidis isolates as described previously [14]. A P. aeruginosa clinical strain carrying blaIMP was used in all tests as a positive control. 2.3. PCR screening and real-time PCR Carbapenemase genes that can be acquired by horizontal transfer, including blaIMP, blaVIM, blaOXA, blaSIM, blaKPC, blaSPM, blaDIM, blaGIM and blaNDM, were screened by PCR as described previously [15]. The intrinsic MBL blaPOM in P. otitidis was detected by PCR and the corresponding nucleotide sequence was determined as described previously [4]. Total RNA was extracted using an RNeasy Protect Bacteria Mini Kit (QIAGEN, Hilden, Germany), followed by DNase treatment. The quality and quantity of RNA was examined using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Hemel Hempstead, UK). Then, 1 mg of RNA was
Table 1 Isolation source and minimum inhibitory concentrations (MICs) of Pseudomonas spp. isolates in this study. Strain ID
E1-6 E1-7 E1-8 E1-9 E1-12 E1-13 E1-14 E1-15 E1-16 E1-17 E1-18 E1-19 E1-21 E1-23 E3-17 E3-19
Species
POTI POTI PPUT POTI PPUT PPUT PPUT PPUT PPUT PAER PPUT PPUT PPUT PPUT PPUT POTI
Source
C1 C1 P1 P1 C2 C2 C3 C3 P2 P2 P2 P2 P3 P3 C4 C5
a
PFGE type
J K A M C B2 B2 E1 B1 – B1 B1 B3 B3 E2 D
b
MIC (mg/L)c PIP [128]
FEP [32]
CTZ [32]
CIP [4]
LEV [8]
PMB [8]
AMK [64]
CHL [32]
IPM [8]
IPM/ PAbN
MEM [8]
MEM/ PAbN
<8 <8 16 <8 64 32 16 16 16 <8 <8 16 32 16 <8 <8
<2 <2 <2 <2 4 <2 <2 <2 <2 4 <2 <2 <2 <2 <2 <2
<4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4
0.5 0.5 0.5 0.5 2 1 0.5 1 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
<0.1 <0.1 <0.1 <0.1 2 2 0.5 2 <0.1 0.5 <0.1 <0.1 2 <0.1 <0.1 <0.1
1 1 <0.5 1 1 <0.5 <0.5 <0.5 <0.5 1 1 <0.5 <0.5 <0.5 <0.5 1
8 8 8 8 8 32 8 8 8 8 8 8 8 8 8 8
8 32 128 8 128 64 64 128 128 64 128 64 128 64 64 16
2 2 1 2 1 4 1 1 1 16 1 1 1 1 1 1
1 2 <0.5 1 <0.5 <0.5 <0.5 <0.5 <0.5 4 <0.5 <0.5 <0.5 <0.5 <0.5 1
16 32 8 16 8 16 8 8 8 16 8 8 16 8 8 32
2 1 2 2 4 2 2 2 2 1 4 2 0.5 0.5 2 2
POTI, Pseudomonas otitidis; PPUT, Pseudomonas putida; PAER, Pseudomonas aeruginosa; PFGE, pulsed-field gel electrophoresis; PIP, piperacillin; FEP, cefepime; CTZ, ceftazidime; CIP, ciprofloxacin; LEV, levofloxacin; PMB, polymyxin B; AMK, amikacin; CHL, chloramphenicol; IPM, imipenem; PAbN, phenylalanine–arginine b-naphthylamide; MEM, meropenem. a C1–C5, chicken samples 1–5; P1–P3, pork samples 1–3. b Fragment patterns differing by six or more bands were regarded as different clones. Each clone is designated with a letter (e.g. A, B, C). Subtypes of each clone (difference less than six bands) were shown as a letter with a number (e.g. B1, B2). c Numbers in brackets represent the Clinical and Laboratory Standards Institute (CLSI) breakpoint of the antimicrobials [12].
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
subjected to reverse transcription using a Life Technologies High Capacity cDNA Kit (Life Technologies, Grand Island, NY). Quantitative reverse transcription PCR (qRT-PCR) was conducted on an iQ5 iCycler (Bio-Rad) using SYBR Select Master Mix (Life Technologies). Expression of mexB, mexD, mexE and ampC was normalised with the rpsL gene using primers described elsewhere and was compared with P. aeruginosa PAO1 type strain [16]. Expression of ttgA was normalised with the 16S rRNA gene and was compared with P. putida ATCC 12633 type strain. Data were analysed by the comparative CT method [17]. The full length of the oprD gene in P. aeruginosa and P. putida isolates was amplified by PCR using primers oprD-F (50 -CGCCGACAAGAAGAATAGC) and oprD-R (50 GTCGATTACAGGATCGACAG) for P. aeruginosa, and oprD-PT-FL1 (50 -GTTAGCCGTGTCGATTGCCT) and oprD-PT-FL2 (50 -CGCAGCGGTACTCTTCCTA) for P. putida. 2.4. Nucleotide accession The oprD sequences obtained from this study can be accessed on GenBank with the following accession nos.: P. aeruginosa E1-17, KP262046; P. aeruginosa LESB58, CAW29111.1; P. putida ATCC 12633, KP025954; P. putida E1-8, KP025955; and P. putida E1-21, KP025956. 3. Results and discussion For this analysis, pork and chicken samples (eight of each) were purchased from supermarkets in Hong Kong. A total of 16 isolates were recovered from eight of the sixteen samples. The isolation rates for chicken and pork were 63% (5/8) and 38% (3/8), respectively. 16S rRNA sequencing confirmed that these isolates were P. putida (n = 11), P. otitidis (n = 4) and P. aeruginosa (n = 1) (Table 1). P. aeruginosa isolate E1-17 was found to be ST1756 by MLST. This type has not been reported in P. aeruginosa of clinical origin. Phylogenetic analysis was performed on 16S rRNA sequences obtained from the 11 P. putida isolates in this study and was compared with the type strain P. putida ATCC 12633 and P. putida KT2440 (Fig. 1). It was found that 8 of the 11 isolates showed 99.7–99.9% identity with KT2440 and 99.1–99.2% identity with ATCC 12633. One isolate (E3-17) had 99.9% identity with ATCC 12633, whereas the two remaining isolates (E1-13 and E1-15) shared a slightly lower level of identity (97%) with the two P. putida type strains. These two isolates were confirmed to be P. putida by VITEK1 2. XbaI-PFGE typing revealed that the P. otitidis isolates belonged to different clones, whereas seven clones among 11
3
P. putida isolates were observable (Table 1). The identical PFGE patterns (type B1 and B3) may be due to duplicate isolates, except E1-13 and E1-14 which share the same PFGHE pattern (B2) that were isolated from independent samples. Antimicrobial susceptibility testing showed that the isolates were susceptible to all antimicrobials tested except imipenem and meropenem; interestingly, all of the tested isolates were resistant to meropenem (MIC 8 mg/L), yet only P. aeruginosa E1-17 was resistant to imipenem (MIC = 16 mg/L). The MIC of imipenem for other isolates ranged from 1 mg/L to 4 mg/L. An MIC 512 mg/L of the efflux pump inhibitor PAbN for all isolates was observed, and addition of PAbN abolished the meropenem resistance phenotype in all isolates with a 2–32-fold reduction in the MIC. Although it is believed that drug efflux was not the major mechanism of imipenem resistance, PAbN was found to attenuate imipenem resistance in P. aeruginosa E1-17 by four-fold (16–4 mg/L). In contrast, attenuation of imipenem resistance with the efflux pump inhibitor was not obvious (0–2-fold reduction in MIC) in P. putida and P. otitidis. These results suggested that efflux systems played a major role in carbapenem resistance in all Pseudomonas spp. (Table 1). Production of carbapenemases against meropenem was tested by the MHT using E. coli ATCC 25922 as the indicator strain, with the results being negative for all isolates. Consistently, all isolates were negative in PCR screening of carbapenemase genes. Expression of multiple efflux systems (mexAB, mexCD and mexEF), ampC and oprD was tested by qRT-PCR for the P. aeruginosa E1-17 isolate in this study (Fig. 2). Expression of mexB, mexD, mexE and mexX was found to be 3.08 0.6, 0.53 0.07, 0.83 0.1 and 0.11 0.03-fold that of P. aeruginosa PAO1, respectively. Expression of ampC in E1-17 was comparable with that of PAO1 (1.21 0.2-fold). Although it is believed that ampC is a major contributing factor in carbapenem susceptibility, absence of ampC overexpression in carbapenem-resistant P. aeruginosa has been reported previously [18]. Expression of oprD was not detectable in E1-17. The full length sequence of the oprD gene was obtained by PCR and no inactivation mutations or insertion sequences were found. BLASTn analysis revealed that the OprD protein was almost identical (with one amino acid substitution) to that of P. aeruginosa strain LESB58. Other than nonfunctional porin resulting from mutational events, absence of wildtype OprD expression in carbapenem-resistant P. aeruginosa isolates is not uncommon. This may be due to a shift of regulatory pathways or disruption of promoter sequences [19]. Overall, this finding showed that the carbapenem resistance mechanisms in P. aeruginosa were mainly due to physiological changes and was consistent with what has been observed among carbapenem-resistant P. aeruginosa strains
Fig. 1. 16S rRNA phylogenetic tree depicting the relative genetic relatedness of 11 Pseudomonas putida isolates in this study as well as two P. putida type strains (ATCC 12633 and KT2440).
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 4
M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 2. Expression levels of mexB, mexD, mexE, mexX and ampC genes in Pseudomonas aeruginosa E1-17. Data were normalised and compared with those of P. aeruginosa PAO1 type strain.
isolated in clinical settings [7,20]. Importantly, the isolation of carbapenem-resistant P. aeruginosa strains in food that exhibited the same resistance mechanisms as those of clinical origin indicates that environmental P. aeruginosa strains can also develop such changes, presumably due to induction and selection pressures exerted by
antibiotics used in the treatment and growth promotion of food animals. The MBL gene blaPOM was detected in all four P. otitidis isolates. Full-length sequences of the gene were obtained and aligned with blaPOM-1 of P. otitidis type strain MCC10330 to investigate sequence variability of the gene. The blaPOM genes were highly conserved in the four P. otitidis isolates, with only one or two amino acid differences compared with MCC10330 (Fig. 3). There was no correlation between blaPOM amino acid substitutions and carbapenem susceptibility, and the mutations found in these isolates were not previously identified. It has been described that P. otitidis constitutively expresses its intrinsic MBL, yet such expression had no clear correlation with carbapenem susceptibility of the host strain [4]. In this study, the carbapenem-hydrolysing activity of blaPOM was evaluated by MHT and Carba NP test. Hydrolysis of imipenem was observed in all P. otitidis isolates in a slower fashion compared with a P. aeruginosa strain carrying blaIMP, although the MHT produced a negative result, which may be attributed to the low sensitivity of the assay. Furthermore, addition of PAbN was capable of reducing the meropenem MIC. The results suggested that the major contributors to carbapenem resistance in P. otitidis may be both efflux systems and MBL blaPOM. Carbapenem-resistant clinical P. putida strains have been previously identified and characterised. The MIC for meropenem
Fig. 3. Metallo-b-lactamase blaPOM sequences of Pseudomonas otitidis. E1-6, E1-7, E1-9 and E3-19 are P. otitidis isolates collected in this study and MCC10330 is a P. otitidis type strain.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 4. Expression level of the ttgA gene of Pseudomonas putida E1-21 and E1-8. Data were normalised by comparison with the P. putida ATCC 12633 type strain.
in these isolates can reach as high as 256 mg/L [2]. The underlying mechanism of such resistance is mainly due to acquisition of exogenous carbapenemase genes, including blaIMP and blaVIM [21]. The P. putida isolates in this study did not contain any external carbapenemase genes, and addition of PAbN was able to suppress the meropenem MIC by 2–32-fold. Efflux systems in P. putida that cause carbapenem resistance have not been identified previously. Nevertheless, a multidrug resistance–nodulation–cell division (RND)-type efflux system (TtgABC) has been shown to reduce susceptibility to chloramphenicol and meropenem [22,23] Expression of ttgA in two randomly selected P. putida isolates (E1-8 and E1-21) was compared with that of P. putida ATCC 12633. The result
5
showed that both isolates exhibited an ca. 500–2000-fold overexpression of TtgA (E1-21, 444.67 64.92 and E1-8, 1942.13 345.31) suggesting that, in addition to other antimicrobials, this pump may also be able to extrude carbapenems (Fig. 4). A previous study suggested that oprD in P. putida may also play a role in reducing carbapenem susceptibility via mechanisms similar to those observable in P. aeruginosa [7]. Examination of the oprD expression level by qRT-PCR produced negative results owing to sequence variation between the test strains and the control strain. Full-length sequencing of oprD of E1-8 and E1-21 revealed that the sequences were different from that of ATCC 12633. OprD amino acid sequences of E1-8 and E1-21 share 99% identity with another P. putida type strain KT2440, yet only 83% homology with P. putida ATCC 12633 (Fig. 5). These findings corroborate with the result of 16S rRNA sequence analysis [24]. The diversity of oprD sequences in P. putida has been described, but a clear correlation between this phenomenon and imipenem susceptibility could not be established [25]. As we were not able to perform expression analysis owing to the lack of P. putida type strain KT2440, the actual role of oprD in P. putida remains unclear. It has been suggested that the use of antimicrobials as growth promoters in animal farming would lead to selection of resistant bacteria. However, carbapenems are not adopted in farming practices. The isolation of carbapenem-resistant Pseudomonas spp. from food indicates that members of this genus are able to become resistant to carbapenems even in an environment with little carbapenem selective pressure. One possible explanation is that application of antimicrobials in farming would result in selection of bacteria that are prone to develop cross-resistance, particularly in Pseudomonas spp. in which carbapenem resistance is usually attributable to self-induced physiological changes. Nevertheless, the actual process by which such organisms are selected needs to be determined.
Fig. 5. Alignment of OprD amino acid sequences of four Pseudomonas putida isolates. E1-8 and E1-21 are P. putida food isolates collected in this study and ATCC 12633 and KT2440 are P. putida type strains.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
6
4. Conclusion This study reports for the first time the isolation of carbapenemresistant P. aeruginosa, P. otitidis and P. putida from food. Further selection and potential transmission of such organisms into clinical settings may lead to the emergence of multidrug/pandrug resistance, which may pose a serious public health threat. Contributions Marcus Ho Yin Wong contributed for conception and design of study, acquisition of laboratory data, analysis of data, drafting the manuscript, and final approval of manuscript. Edward Wai chi Chan contributed for conception and design of study, analysis of data, drafting the manuscript and final approval of manuscript. Sheng Chen contributed for conception and design of study, analysis of data, critical revision, and final approval of manuscript. Funding This work was supported by the Chinese National Key Basic Research and Development (973) Program [2013CB127200] and the Health and Medical Research Fund of the Food and Health Bureau, Government of Hong Kong [12111612 to SC]. Conflict of interests None declared. Ethical approval Not required. References [1] Morita Y, Tomida J, Kawamura Y. Responses of Pseudomonas aeruginosa to antimicrobials. Front Microbiol 2014;4:422. [2] Kumita W, Saito R, Sato K, Ode T, Moriya K, Koike K, et al. Molecular characterizations of carbapenem and ciprofloxacin resistance in clinical isolates of Pseudomonas putida. J Infect Chemother 2009;15:6–12. [3] Horii T, Muramatsu H, Iinuma Y. Mechanisms of resistance to fluoroquinolones and carbapenems in Pseudomonas putida. J Antimicrob Chemother 2005;56:643–7. [4] Thaller MC, Borgianni L, Di Lallo G, Chong Y, Lee K, Dajcs J, et al. Metallo-blactamase production by Pseudomonas otitidis: a species-related trait. Antimicrob Agents Chemother 2011;55:118–23. [5] Pai H, Kim J, Kim J, Lee JH, Choe KW, Gotoh N. Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2001;45:480–4. [6] Lee K, Kim CK, Yong D, Yum JH, Chung MH, Chong Y, et al. POM-1 metallo-blactamase-producing Pseudomonas otitidis isolate from a patient with chronic otitis media. Diagn Microbiol Infect Dis 2012;72:295–6.
[7] Rodrı´guez-Martı´nez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009;53:4783–8. [8] Woodford N, Wareham DW, Guerra B, Teale C. Carbapenemase-producing Enterobacteriaceae and non-Enterobacteriaceae from animals and the environment: an emerging public health risk of our own making? J Antimicrob Chemother 2014;69:287–91. [9] Rubin JE, Ekanayake S, Fernando C. Carbapenemase-producing organism in food, 2014. Emerg Infect Dis 2014;20:1264–5. [10] Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. blaVIM-2 cassettecontaining novel integrons in metallo-b-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46:1053–8. [11] Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. [12] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. Document M100-S23. Wayne, PA: CLSI; 2013. [13] Szabo´ D, Silveira F, Hujer AM, Bonomo RA, Hujer KM, Marsh JW, et al. Outer membrane protein changes and efflux pump expression together may confer resistance to ertapenem in Enterobacter cloacae. Antimicrob Agents Chemother 2006;50:2833–5. [14] Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2012;18:1503–7. [15] Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70: 119–23. [16] Dumas JL, van Delden C, Perron K, Kohler T. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett 2006;254:217–25. [17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using DD real-time quantitative PCR and the 2 CT method. Methods 2001;25: 402–8. [18] Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2006;50:1633–41. [19] Fournier D, Richardot C, Mu¨ller E, Robert-Nicoud M, Llanes C, Ple´siat P, et al. Complexity of resistance mechanisms to imipenem in intensive care unit strains of Pseudomonas aeruginosa. J Antimicrob Chemother 2013;68: 1772–80. [20] Hammami S, Ghozzi R, Burghoffer B, Arlet G, Redjeb S. Mechanisms of carbapenem resistance in non-metallo-b-lactamase-producing clinical isolates of Pseudomonas aeruginosa from a Tunisian hospital. Pathol Biol (Paris) 2009;57:530–5. ˜ o M, Moldes L, Herna´ndez M, Martı´nez-Lamas L, Garcı´a-Riestra C, [21] Trevin Regueiro BJ. Nosocomial infection by VIM-2 metallo-b-lactamase-producing Pseudomonas putida. J Med Microbiol 2010;59:853–5. [22] Martı´nez-Garcı´a E, de Lorenzo V. Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440. Environ Microbiol 2011;13:2702–16. [23] Ferna´ndez M, Conde S, de la Torre J, Molina-Santiago C, Ramos JL, Duque E. Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440. Antimicrob Agents Chemother 2012;56:1001–9. [24] Nelson KE, Weinel C, Paulsen IT, Dodson RJ, Hilbert H, Martins dos Santos VA, et al. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 2002;4:799– 808. [25] Chevalier S, Bodilis J, Jaouen T, Barray S, Feuilloley MG, Orange N. Sequence diversity of the OprD protein of environmental Pseudomonas strains. Environ Microbiol 2007;9:824–35.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
JGAR-146; No. of Pages 6 Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Global Antimicrobial Resistance journal homepage: www.elsevier.com/locate/jgar
Isolation of carbapenem-resistant Pseudomonas spp. from food Marcus Ho-yin Wong a,b, Edward Wai chi Chan a,b, Sheng Chen a,b,* a
Shenzhen Key Laboratory for Food Biological Safety Control, Food Safety and Technology Research Centre, The Hong Kong Polytechnic University Shenzhen Research Institute, Shenzhen, PR China b State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong
A R T I C L E I N F O
A B S T R A C T
Article history: Received 8 January 2015 Received in revised form 10 March 2015 Accepted 13 March 2015
Pseudomonas spp. are ubiquitous in nature. Carbapenem resistance in environmental isolates of members of this genus is thought to be rare but the exact resistance rate is unknown. In this study, carbapenem-resistant Pseudomonas spp. were isolated from chicken and pork samples and the mechanisms underlying the carbapenem resistance in these strains were investigated. A total of 16 carbapenem-resistant Pseudomonas aeruginosa, Pseudomonas putida and Pseudomonas otitidis isolates were recovered from eight samples of chicken and pork. The isolates exhibited meropenem minimum inhibitory concentrations (MICs) of 8 to 32 mg/L and imipenem MICs of <0.5–16 mg/L yet did not harbour any acquired carbapenemase genes. Meropenem resistance in various strains was found to be mediated by efflux systems only, whereas overexpression of MexAB–OprM efflux pump and lack of OprD porin were responsible for carbapenem resistance in P. aeruginosa. The intrinsic metallo-b-lactamase gene blaPOM in P. otitidis and overexpression of the TtgABC efflux system in P. putida were also responsible for carbapenem resistance in these organisms. In conclusion, this study reports for the first time the isolation of carbapenem-resistant P. aeruginosa, P. otitidis and P. putida strains from food. The resistance mechanisms of these strains are rarely due to production of carbapenemases. Further selection of such carbapenem-resistant Pseudomonas spp. in the environment and the risk by which they are transmitted to clinical settings are of great public health concern. ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Keywords: Carbapenem Pseudomonas aeruginosa Pseudomonas putida Pseudomonas otitidis Food
1. Introduction Pseudomonas spp. are ubiquitous in the environment, with Pseudomonas aeruginosa being the most common opportunistic pathogen in this genus. This organism is a common causative agent of various opportunistic infections, especially among cystic fibrosis and burns patients as well as immunocompromised people [1]. Similarly, Pseudomonas putida may cause urinary tract infections in immunocompromised patients as well as bacteraemia in neonatal and cancer patients [2,3]. In contrast, Pseudomonas otitidis is a relatively novel micro-organism identified in 2006 and is responsible for causing otic infections [4]. Multidrug resistance, including resistance to b-lactams, fluoroquinolones and aminoglycosides, is frequently observed among P. aeruginosa [5]. Resistance has also emerged in P. putida and P. otitidis, rendering
* Corresponding author at: State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong. Tel.: +852 3400 8795; fax: +852 2364 9932. E-mail address: [email protected] (S. Chen).
treatment of infections caused by such pathogens exceedingly difficult [2,6]. Carbapenem antimicrobials are considered the last resort for treatment of infections caused by multidrug-resistant pathogens. However, carbapenem resistance in different bacterial species is increasingly common worldwide and has become a major public health problem. In most cases, bacteria developed carbapenem resistance by means of taking up exogenous carbapenemase genes; however, P. aeruginosa is capable of establishing intrinsic carbapenem resistance through self-regulated physiological changes instead of acquisition of resistance elements. Common resistance mechanisms include overexpression of efflux systems and AmpC b-lactamase as well as mutational inactivation of the outer membrane protein OprD [7]. It remains to be seen whether other Pseudomonas spp. possess the ability to become carbapenemresistant by such physiological and genetic changes. To date, it is known that carbapenem resistance in P. putida and P. otitidis, respectively, is associated with acquisition of metallo-b-lactamases (MBLs) and the production of an intrinsic MBL POM-1, which to some extent confers carbapenemase activities [3,4].
http://dx.doi.org/10.1016/j.jgar.2015.03.006 2213-7165/ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
2
The incidence of carbapenem resistance in foodborne isolates is estimated to be low as carbapenems are not used in animal farming. However, carbapenem-resistant micro-organisms in food production animals have become detectable recently [8,9]. Dissemination of this category of potential pathogens between environmental and nosocomial settings is of particular concern. This study describes the isolation of carbapenem-resistant Pseudomonas spp. from retail meat products in Hong Kong as well as an analysis of the genetic and physiological basis of their resistance phenotypes.
2. Materials and methods 2.1. Bacterial isolation and confirmation A total of 16 chicken and pork meat samples (8 of each) were purchased from two different supermarkets on four separate sampling dates in Hong Kong during the summer of 2011. The samples were homogenised and enriched in Peptone Water (Oxoid Ltd., Basingstoke, UK) for 24 h at 37 8C with shaking, followed by direct spreading on MacConkey agar (Oxoid Ltd.) containing 2 mg/ L meropenem (Santa Cruz Biotech, Dallas, TX). Two colonies were recovered from each plate and were purified and identified by API20E (bioMe´ rieux, Craponne, France) and 16S rRNA sequencing. Isolates whose 16S rRNA sequencing results were ambiguous were further subjected to confirmation by the VITEK1 2 system (bioMe´rieux). Multilocus sequence typing (MLST) was performed and interpreted on P. aeruginosa isolates according to the PubMLST scheme (http://pubmlst.org/paeruginosa/). 16S rRNA sequences of P. putida isolates were aligned by the ClusterW2 algorithm and a phylogenetic tree was compiled by the maximum-likelihood algorithm approach using BioEdit software (http://www.mbio. ncsu.edu/bioedit/bioedit.html). Pulsed-field gel electrophoresis (PFGE) was performed as described previously [10]. Briefly, agarose-embedded DNA was digested with XbaI (New England Bio-Labs, Ipswich, UK) at 37 8C for 1.5 h. The restriction fragments were separated by electrophoresis in 0.5 TBE [Tris–borate– ethylene diamine tetra-acetic acid (EDTA)] buffer at 14 8C for
18 h using a CHEF-DR1 II Electrophoresis System (Bio-Rad, Hercules, CA) with pulse times of 0.5–30 s. The gels were stained with GelRedTM (Biotium, Hayward, CA) and DNA bands were visualised with ultraviolet transillumination (Bio-Rad). Fragment patterns were interpreted as described previously [11]. 2.2. Antimicrobial susceptibility and carbapenemase activity testing Antimicrobial susceptibility testing was carried out by the agar dilution method with the antimicrobials listed in Table 1. Results were interpreted following Clinical and Laboratory Standards Institute (CLSI) guidelines [12]. Escherichia coli ATCC 25922 and ATCC 35218 and P. aeruginosa ATCC 27853 were used as quality control strains. The minimum inhibitory concentrations (MICs) of the efflux pump inhibitor phenylalanine–arginine b-naphthylamide (PAbN) for the isolates was determined by the broth microdilution method. Involvement of efflux systems in reduced carbapenem susceptibility was tested by determining the meropenem MIC in the presence and absence of PAbN at a concentration of 40 mg/mL [13]. The carbapenemase activity of all isolates was tested by the Modified Hodge test (MHT) against meropenem and imipenem using E. coli ATCC 25922 as the indicator organism as described previously [12]. The Carba NP test was performed on the four P. otitidis isolates as described previously [14]. A P. aeruginosa clinical strain carrying blaIMP was used in all tests as a positive control. 2.3. PCR screening and real-time PCR Carbapenemase genes that can be acquired by horizontal transfer, including blaIMP, blaVIM, blaOXA, blaSIM, blaKPC, blaSPM, blaDIM, blaGIM and blaNDM, were screened by PCR as described previously [15]. The intrinsic MBL blaPOM in P. otitidis was detected by PCR and the corresponding nucleotide sequence was determined as described previously [4]. Total RNA was extracted using an RNeasy Protect Bacteria Mini Kit (QIAGEN, Hilden, Germany), followed by DNase treatment. The quality and quantity of RNA was examined using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Hemel Hempstead, UK). Then, 1 mg of RNA was
Table 1 Isolation source and minimum inhibitory concentrations (MICs) of Pseudomonas spp. isolates in this study. Strain ID
E1-6 E1-7 E1-8 E1-9 E1-12 E1-13 E1-14 E1-15 E1-16 E1-17 E1-18 E1-19 E1-21 E1-23 E3-17 E3-19
Species
POTI POTI PPUT POTI PPUT PPUT PPUT PPUT PPUT PAER PPUT PPUT PPUT PPUT PPUT POTI
Source
C1 C1 P1 P1 C2 C2 C3 C3 P2 P2 P2 P2 P3 P3 C4 C5
a
PFGE type
J K A M C B2 B2 E1 B1 – B1 B1 B3 B3 E2 D
b
MIC (mg/L)c PIP [128]
FEP [32]
CTZ [32]
CIP [4]
LEV [8]
PMB [8]
AMK [64]
CHL [32]
IPM [8]
IPM/ PAbN
MEM [8]
MEM/ PAbN
<8 <8 16 <8 64 32 16 16 16 <8 <8 16 32 16 <8 <8
<2 <2 <2 <2 4 <2 <2 <2 <2 4 <2 <2 <2 <2 <2 <2
<4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4 <4
0.5 0.5 0.5 0.5 2 1 0.5 1 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
<0.1 <0.1 <0.1 <0.1 2 2 0.5 2 <0.1 0.5 <0.1 <0.1 2 <0.1 <0.1 <0.1
1 1 <0.5 1 1 <0.5 <0.5 <0.5 <0.5 1 1 <0.5 <0.5 <0.5 <0.5 1
8 8 8 8 8 32 8 8 8 8 8 8 8 8 8 8
8 32 128 8 128 64 64 128 128 64 128 64 128 64 64 16
2 2 1 2 1 4 1 1 1 16 1 1 1 1 1 1
1 2 <0.5 1 <0.5 <0.5 <0.5 <0.5 <0.5 4 <0.5 <0.5 <0.5 <0.5 <0.5 1
16 32 8 16 8 16 8 8 8 16 8 8 16 8 8 32
2 1 2 2 4 2 2 2 2 1 4 2 0.5 0.5 2 2
POTI, Pseudomonas otitidis; PPUT, Pseudomonas putida; PAER, Pseudomonas aeruginosa; PFGE, pulsed-field gel electrophoresis; PIP, piperacillin; FEP, cefepime; CTZ, ceftazidime; CIP, ciprofloxacin; LEV, levofloxacin; PMB, polymyxin B; AMK, amikacin; CHL, chloramphenicol; IPM, imipenem; PAbN, phenylalanine–arginine b-naphthylamide; MEM, meropenem. a C1–C5, chicken samples 1–5; P1–P3, pork samples 1–3. b Fragment patterns differing by six or more bands were regarded as different clones. Each clone is designated with a letter (e.g. A, B, C). Subtypes of each clone (difference less than six bands) were shown as a letter with a number (e.g. B1, B2). c Numbers in brackets represent the Clinical and Laboratory Standards Institute (CLSI) breakpoint of the antimicrobials [12].
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
subjected to reverse transcription using a Life Technologies High Capacity cDNA Kit (Life Technologies, Grand Island, NY). Quantitative reverse transcription PCR (qRT-PCR) was conducted on an iQ5 iCycler (Bio-Rad) using SYBR Select Master Mix (Life Technologies). Expression of mexB, mexD, mexE and ampC was normalised with the rpsL gene using primers described elsewhere and was compared with P. aeruginosa PAO1 type strain [16]. Expression of ttgA was normalised with the 16S rRNA gene and was compared with P. putida ATCC 12633 type strain. Data were analysed by the comparative CT method [17]. The full length of the oprD gene in P. aeruginosa and P. putida isolates was amplified by PCR using primers oprD-F (50 -CGCCGACAAGAAGAATAGC) and oprD-R (50 GTCGATTACAGGATCGACAG) for P. aeruginosa, and oprD-PT-FL1 (50 -GTTAGCCGTGTCGATTGCCT) and oprD-PT-FL2 (50 -CGCAGCGGTACTCTTCCTA) for P. putida. 2.4. Nucleotide accession The oprD sequences obtained from this study can be accessed on GenBank with the following accession nos.: P. aeruginosa E1-17, KP262046; P. aeruginosa LESB58, CAW29111.1; P. putida ATCC 12633, KP025954; P. putida E1-8, KP025955; and P. putida E1-21, KP025956. 3. Results and discussion For this analysis, pork and chicken samples (eight of each) were purchased from supermarkets in Hong Kong. A total of 16 isolates were recovered from eight of the sixteen samples. The isolation rates for chicken and pork were 63% (5/8) and 38% (3/8), respectively. 16S rRNA sequencing confirmed that these isolates were P. putida (n = 11), P. otitidis (n = 4) and P. aeruginosa (n = 1) (Table 1). P. aeruginosa isolate E1-17 was found to be ST1756 by MLST. This type has not been reported in P. aeruginosa of clinical origin. Phylogenetic analysis was performed on 16S rRNA sequences obtained from the 11 P. putida isolates in this study and was compared with the type strain P. putida ATCC 12633 and P. putida KT2440 (Fig. 1). It was found that 8 of the 11 isolates showed 99.7–99.9% identity with KT2440 and 99.1–99.2% identity with ATCC 12633. One isolate (E3-17) had 99.9% identity with ATCC 12633, whereas the two remaining isolates (E1-13 and E1-15) shared a slightly lower level of identity (97%) with the two P. putida type strains. These two isolates were confirmed to be P. putida by VITEK1 2. XbaI-PFGE typing revealed that the P. otitidis isolates belonged to different clones, whereas seven clones among 11
3
P. putida isolates were observable (Table 1). The identical PFGE patterns (type B1 and B3) may be due to duplicate isolates, except E1-13 and E1-14 which share the same PFGHE pattern (B2) that were isolated from independent samples. Antimicrobial susceptibility testing showed that the isolates were susceptible to all antimicrobials tested except imipenem and meropenem; interestingly, all of the tested isolates were resistant to meropenem (MIC 8 mg/L), yet only P. aeruginosa E1-17 was resistant to imipenem (MIC = 16 mg/L). The MIC of imipenem for other isolates ranged from 1 mg/L to 4 mg/L. An MIC 512 mg/L of the efflux pump inhibitor PAbN for all isolates was observed, and addition of PAbN abolished the meropenem resistance phenotype in all isolates with a 2–32-fold reduction in the MIC. Although it is believed that drug efflux was not the major mechanism of imipenem resistance, PAbN was found to attenuate imipenem resistance in P. aeruginosa E1-17 by four-fold (16–4 mg/L). In contrast, attenuation of imipenem resistance with the efflux pump inhibitor was not obvious (0–2-fold reduction in MIC) in P. putida and P. otitidis. These results suggested that efflux systems played a major role in carbapenem resistance in all Pseudomonas spp. (Table 1). Production of carbapenemases against meropenem was tested by the MHT using E. coli ATCC 25922 as the indicator strain, with the results being negative for all isolates. Consistently, all isolates were negative in PCR screening of carbapenemase genes. Expression of multiple efflux systems (mexAB, mexCD and mexEF), ampC and oprD was tested by qRT-PCR for the P. aeruginosa E1-17 isolate in this study (Fig. 2). Expression of mexB, mexD, mexE and mexX was found to be 3.08 0.6, 0.53 0.07, 0.83 0.1 and 0.11 0.03-fold that of P. aeruginosa PAO1, respectively. Expression of ampC in E1-17 was comparable with that of PAO1 (1.21 0.2-fold). Although it is believed that ampC is a major contributing factor in carbapenem susceptibility, absence of ampC overexpression in carbapenem-resistant P. aeruginosa has been reported previously [18]. Expression of oprD was not detectable in E1-17. The full length sequence of the oprD gene was obtained by PCR and no inactivation mutations or insertion sequences were found. BLASTn analysis revealed that the OprD protein was almost identical (with one amino acid substitution) to that of P. aeruginosa strain LESB58. Other than nonfunctional porin resulting from mutational events, absence of wildtype OprD expression in carbapenem-resistant P. aeruginosa isolates is not uncommon. This may be due to a shift of regulatory pathways or disruption of promoter sequences [19]. Overall, this finding showed that the carbapenem resistance mechanisms in P. aeruginosa were mainly due to physiological changes and was consistent with what has been observed among carbapenem-resistant P. aeruginosa strains
Fig. 1. 16S rRNA phylogenetic tree depicting the relative genetic relatedness of 11 Pseudomonas putida isolates in this study as well as two P. putida type strains (ATCC 12633 and KT2440).
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 4
M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 2. Expression levels of mexB, mexD, mexE, mexX and ampC genes in Pseudomonas aeruginosa E1-17. Data were normalised and compared with those of P. aeruginosa PAO1 type strain.
isolated in clinical settings [7,20]. Importantly, the isolation of carbapenem-resistant P. aeruginosa strains in food that exhibited the same resistance mechanisms as those of clinical origin indicates that environmental P. aeruginosa strains can also develop such changes, presumably due to induction and selection pressures exerted by
antibiotics used in the treatment and growth promotion of food animals. The MBL gene blaPOM was detected in all four P. otitidis isolates. Full-length sequences of the gene were obtained and aligned with blaPOM-1 of P. otitidis type strain MCC10330 to investigate sequence variability of the gene. The blaPOM genes were highly conserved in the four P. otitidis isolates, with only one or two amino acid differences compared with MCC10330 (Fig. 3). There was no correlation between blaPOM amino acid substitutions and carbapenem susceptibility, and the mutations found in these isolates were not previously identified. It has been described that P. otitidis constitutively expresses its intrinsic MBL, yet such expression had no clear correlation with carbapenem susceptibility of the host strain [4]. In this study, the carbapenem-hydrolysing activity of blaPOM was evaluated by MHT and Carba NP test. Hydrolysis of imipenem was observed in all P. otitidis isolates in a slower fashion compared with a P. aeruginosa strain carrying blaIMP, although the MHT produced a negative result, which may be attributed to the low sensitivity of the assay. Furthermore, addition of PAbN was capable of reducing the meropenem MIC. The results suggested that the major contributors to carbapenem resistance in P. otitidis may be both efflux systems and MBL blaPOM. Carbapenem-resistant clinical P. putida strains have been previously identified and characterised. The MIC for meropenem
Fig. 3. Metallo-b-lactamase blaPOM sequences of Pseudomonas otitidis. E1-6, E1-7, E1-9 and E3-19 are P. otitidis isolates collected in this study and MCC10330 is a P. otitidis type strain.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 4. Expression level of the ttgA gene of Pseudomonas putida E1-21 and E1-8. Data were normalised by comparison with the P. putida ATCC 12633 type strain.
in these isolates can reach as high as 256 mg/L [2]. The underlying mechanism of such resistance is mainly due to acquisition of exogenous carbapenemase genes, including blaIMP and blaVIM [21]. The P. putida isolates in this study did not contain any external carbapenemase genes, and addition of PAbN was able to suppress the meropenem MIC by 2–32-fold. Efflux systems in P. putida that cause carbapenem resistance have not been identified previously. Nevertheless, a multidrug resistance–nodulation–cell division (RND)-type efflux system (TtgABC) has been shown to reduce susceptibility to chloramphenicol and meropenem [22,23] Expression of ttgA in two randomly selected P. putida isolates (E1-8 and E1-21) was compared with that of P. putida ATCC 12633. The result
5
showed that both isolates exhibited an ca. 500–2000-fold overexpression of TtgA (E1-21, 444.67 64.92 and E1-8, 1942.13 345.31) suggesting that, in addition to other antimicrobials, this pump may also be able to extrude carbapenems (Fig. 4). A previous study suggested that oprD in P. putida may also play a role in reducing carbapenem susceptibility via mechanisms similar to those observable in P. aeruginosa [7]. Examination of the oprD expression level by qRT-PCR produced negative results owing to sequence variation between the test strains and the control strain. Full-length sequencing of oprD of E1-8 and E1-21 revealed that the sequences were different from that of ATCC 12633. OprD amino acid sequences of E1-8 and E1-21 share 99% identity with another P. putida type strain KT2440, yet only 83% homology with P. putida ATCC 12633 (Fig. 5). These findings corroborate with the result of 16S rRNA sequence analysis [24]. The diversity of oprD sequences in P. putida has been described, but a clear correlation between this phenomenon and imipenem susceptibility could not be established [25]. As we were not able to perform expression analysis owing to the lack of P. putida type strain KT2440, the actual role of oprD in P. putida remains unclear. It has been suggested that the use of antimicrobials as growth promoters in animal farming would lead to selection of resistant bacteria. However, carbapenems are not adopted in farming practices. The isolation of carbapenem-resistant Pseudomonas spp. from food indicates that members of this genus are able to become resistant to carbapenems even in an environment with little carbapenem selective pressure. One possible explanation is that application of antimicrobials in farming would result in selection of bacteria that are prone to develop cross-resistance, particularly in Pseudomonas spp. in which carbapenem resistance is usually attributable to self-induced physiological changes. Nevertheless, the actual process by which such organisms are selected needs to be determined.
Fig. 5. Alignment of OprD amino acid sequences of four Pseudomonas putida isolates. E1-8 and E1-21 are P. putida food isolates collected in this study and ATCC 12633 and KT2440 are P. putida type strains.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
6
4. Conclusion This study reports for the first time the isolation of carbapenemresistant P. aeruginosa, P. otitidis and P. putida from food. Further selection and potential transmission of such organisms into clinical settings may lead to the emergence of multidrug/pandrug resistance, which may pose a serious public health threat. Contributions Marcus Ho Yin Wong contributed for conception and design of study, acquisition of laboratory data, analysis of data, drafting the manuscript, and final approval of manuscript. Edward Wai chi Chan contributed for conception and design of study, analysis of data, drafting the manuscript and final approval of manuscript. Sheng Chen contributed for conception and design of study, analysis of data, critical revision, and final approval of manuscript. Funding This work was supported by the Chinese National Key Basic Research and Development (973) Program [2013CB127200] and the Health and Medical Research Fund of the Food and Health Bureau, Government of Hong Kong [12111612 to SC]. Conflict of interests None declared. Ethical approval Not required. References [1] Morita Y, Tomida J, Kawamura Y. Responses of Pseudomonas aeruginosa to antimicrobials. Front Microbiol 2014;4:422. [2] Kumita W, Saito R, Sato K, Ode T, Moriya K, Koike K, et al. Molecular characterizations of carbapenem and ciprofloxacin resistance in clinical isolates of Pseudomonas putida. J Infect Chemother 2009;15:6–12. [3] Horii T, Muramatsu H, Iinuma Y. Mechanisms of resistance to fluoroquinolones and carbapenems in Pseudomonas putida. J Antimicrob Chemother 2005;56:643–7. [4] Thaller MC, Borgianni L, Di Lallo G, Chong Y, Lee K, Dajcs J, et al. Metallo-blactamase production by Pseudomonas otitidis: a species-related trait. Antimicrob Agents Chemother 2011;55:118–23. [5] Pai H, Kim J, Kim J, Lee JH, Choe KW, Gotoh N. Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2001;45:480–4. [6] Lee K, Kim CK, Yong D, Yum JH, Chung MH, Chong Y, et al. POM-1 metallo-blactamase-producing Pseudomonas otitidis isolate from a patient with chronic otitis media. Diagn Microbiol Infect Dis 2012;72:295–6.
[7] Rodrı´guez-Martı´nez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009;53:4783–8. [8] Woodford N, Wareham DW, Guerra B, Teale C. Carbapenemase-producing Enterobacteriaceae and non-Enterobacteriaceae from animals and the environment: an emerging public health risk of our own making? J Antimicrob Chemother 2014;69:287–91. [9] Rubin JE, Ekanayake S, Fernando C. Carbapenemase-producing organism in food, 2014. Emerg Infect Dis 2014;20:1264–5. [10] Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. blaVIM-2 cassettecontaining novel integrons in metallo-b-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46:1053–8. [11] Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. [12] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. Document M100-S23. Wayne, PA: CLSI; 2013. [13] Szabo´ D, Silveira F, Hujer AM, Bonomo RA, Hujer KM, Marsh JW, et al. Outer membrane protein changes and efflux pump expression together may confer resistance to ertapenem in Enterobacter cloacae. Antimicrob Agents Chemother 2006;50:2833–5. [14] Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2012;18:1503–7. [15] Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70: 119–23. [16] Dumas JL, van Delden C, Perron K, Kohler T. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett 2006;254:217–25. [17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using DD real-time quantitative PCR and the 2 CT method. Methods 2001;25: 402–8. [18] Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 2006;50:1633–41. [19] Fournier D, Richardot C, Mu¨ller E, Robert-Nicoud M, Llanes C, Ple´siat P, et al. Complexity of resistance mechanisms to imipenem in intensive care unit strains of Pseudomonas aeruginosa. J Antimicrob Chemother 2013;68: 1772–80. [20] Hammami S, Ghozzi R, Burghoffer B, Arlet G, Redjeb S. Mechanisms of carbapenem resistance in non-metallo-b-lactamase-producing clinical isolates of Pseudomonas aeruginosa from a Tunisian hospital. Pathol Biol (Paris) 2009;57:530–5. ˜ o M, Moldes L, Herna´ndez M, Martı´nez-Lamas L, Garcı´a-Riestra C, [21] Trevin Regueiro BJ. Nosocomial infection by VIM-2 metallo-b-lactamase-producing Pseudomonas putida. J Med Microbiol 2010;59:853–5. [22] Martı´nez-Garcı´a E, de Lorenzo V. Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440. Environ Microbiol 2011;13:2702–16. [23] Ferna´ndez M, Conde S, de la Torre J, Molina-Santiago C, Ramos JL, Duque E. Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440. Antimicrob Agents Chemother 2012;56:1001–9. [24] Nelson KE, Weinel C, Paulsen IT, Dodson RJ, Hilbert H, Martins dos Santos VA, et al. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 2002;4:799– 808. [25] Chevalier S, Bodilis J, Jaouen T, Barray S, Feuilloley MG, Orange N. Sequence diversity of the OprD protein of environmental Pseudomonas strains. Environ Microbiol 2007;9:824–35.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006