Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene

Gene 502 (2012) 60–68

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Short Communication

Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene Erick M. Ramos-Martínez, Alejandra C. Herrera-Ramírez, Jesús Agustín Badillo-Corona, Claudio Garibay-Orijel, Nuria González-Rábade, María del Carmen Oliver-Salvador ⁎ Unidad Profesional Interdisciplinaria de Biotecnología, Instituto Politécnico Nacional, México DF, Mexico

a r t i c l e

i n f o

Article history: Accepted 9 April 2012 Available online 14 April 2012 Keywords: Cysteine protease Jacaratia mexicana Mexicain Papain

a b s t r a c t Cysteine proteases (CPs) from the C1 family, which are similar to papain, can be found in animals and plants, as well as some viruses and prokaryotes. These enzymes have diverse physiological functions and are thus very attractive for science and industry. Jacaratia mexicana, a member of the Caricaceae plant family, contains several CPs, the principal being mexicain, found to favorably compete against papain for many industrial applications due to its high stability and specific activity. In this study, leaves of J. mexicana were used to isolate a CPcoding gene, similar to those that code for mexicain and chymomexicain. By using rapid amplification of cDNA ends (RACE) as well as oligonucleotide design from papain-like conserved amino acids (aa), a sequence of 1404 bp consisting of a 5′ terminal untranslated region (UTR) of 153 bp, a 3′ terminal UTR of 131 bp, with a polyadenylation (poly(A)) signal sequence and a poly(A) tail, and an open reading frame (ORF) of 1046 bp, was obtained by overlapping three partial sequences. Two full-length cDNA sequences that encode for mexicainlike proteases were cloned from mRNA (JmCP4 and JmCP5). JmCP4 is predicted to have an ORF of 1044 bp, which codifies for polypeptides that have a 26 aa signal peptide region, a 108 aa propeptide region and a mature enzyme of 214 aa. A 969 bp fragment (JmCP5) encodes for a partial sequence of a CP gene, without the signal peptide region but with a full-length propeptide region. The sequence analysis showed that this protease presented a high similarity to other plant CPs from J. mexicana, Vasconcellea cundinamarcensis, Vasconcellea stipulata, and Carica papaya, among others, mainly at the conserved catalytic site. Obtaining the sequence of this CP gene from J. mexicana provides an alternative for production in a standard system and could be an initial step towards the commercialization of this enzyme. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Plants from the Caricaceae family are known to produce large amounts of proteases. Jacaratia mexicana belongs to this family and is found in the subtropical regions of Mexico. J. mexicana, previously known as Pileus mexicanus, bears an annual fruit similar to the commercial papaya (Carica papaya) and produces a large amount of proteases in its latex. The crude extract from the latex of J. mexicana was first described as mexicain, a cysteine protease (CP), by Castañeda-Agulló et al. (1942), and later characterized as a mixture of different proteases. Oliver-Salvador et al. (2004) demonstrated the presence of at least five proteases in the latex of J. mexicana. According to the elution order of these proteases, when separated by cation-exchange chromatography,

Abbreviations: aa, amino acids; CP, cysteine protease; DPE, downstream promoter elements; ER, endoplasmic reticulum; IPTG, isopropyl-a-d-thiogalactopyranoside; INR, transcription initiation; LB, Luria–Bertani; ORF, open reading frame. ⁎ Corresponding author. Tel.: +52 55 57296000x56471; fax: +52 55 57296000x56305. E-mail address: [email protected] (M.C. Oliver-Salvador). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.04.018

these enzymes were identified as P-I, P-II, P-III, P-IV and P-V; with P-IV present in the highest quantity, thus denominating it mexicain. Protease P-V and mexicain have been characterized and found to have greater stability and higher specific activity, on similar substrates, than papain (Gavira et al., 2007; Oliver-Salvador et al., 2011). Furthermore, some studies have demonstrated that the enzymes obtained from the latex of J. mexicana can be used in industrial processes such as meat tenderization, colloidal stabilization of beer, fish and vegetable protein hydrolysis, and modification of functional properties of proteins (BrionesMartínez et al., 1997). The food industry generally prefers the use of plant-derived proteolytic enzymes since the Food and Drug Administration (FDA) considers them very safe as they come from edible sources. CPs have a wide distribution since they are not only found in animals and plants but also in viruses and prokaryotes. It has been shown that these proteases are involved in the treatment of various illnesses (reviewed in Chapman et al., 1997) like tumors (Turk et al., 2000), arthritis and inflammation (Muller-Ladner et al., 1996), Alzheimer (Lemere et al., 1995), and some types of cancer (Elliot and Sloane, 1996; Saleh et al., 2003). It is considered very important to know the tridimensional structure of these enzymes for the design of pharmaceuticals and specific

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

non-toxic inhibitors for the treatment of these diseases. This supports the experimental approach of isolating the gene from its natural source in order to achieve expression in a system that could allow for the production of great quantities of the enzyme. The majority of plant-derived proteases are CPs (Barrett and Rawlings, 2004), which participate in various processes in plants, including the activation of protein precursors (Shimada et al., 1994), protein folding (Palma et al., 2002), stress-induced protein degradation (Forsthoefel et al., 1998), changes associated with temperature and salt concentration fluctuations (Forsthoefel et al., 1998; Schaffer and Fischer, 1988), and wounding (Kruger et al., 2001; Hao et al., 2006; Ueda et al., 2000). CPs are also involved in processing and degradation of seed storage proteins (Shimada et al., 1994; Toyooka et al., 2000), fruit ripening (Alonso and Granell, 1995), nodule development (Naito et al., 2000) and responses to stresses such as wounding, cold, and drought (Harrak et al., 2001; Koizumi et al., 1993; Linthorst et al., 1993; Schaffer and Fischer, 1988), as well as in programmed cell death (Solomon et al., 1999; Xu and Chye, 1999). Some plantderived CPs like papain, ficin, bromelain, mexicain and actinidine are members of a structurally homologous family and have some characteristic amino acid residues in their active site: Cis25, His159 and Asp158 (Gavira et al., 2007; Oliver-Salvador, 1999). To date, these enzymes are not used for commercial purposes nor extracted regularly from the latex of J. mexicana other than for research purposes. We believe that there is huge potential for the industrial use of this natural resource, especially given the biochemical properties of the enzymes described. It is, thus, highly important to find alternative means of large-scale production for these proteases, one of which is the identification of the correct gene or genes and their over-expression in a known system (e.g. Escherichia coli), as previously mentioned. Several studies have focused on the identification of CP genes from C. papaya and their expression in E. coli and yeast (Brömme et al., 2004; Koizumi et al., 1993, 2001; Revell et al., 1993; Taylor et al., 1992; Ueda et al., 2000). CP gene identification has occurred in several plant sources, such as Mesembryanthemum crystallinum (Forsthoefel et al., 1998), Daucus carota (Mitsuhashi et al., 2004), and C. candamarcensis (Pereira et al., 2001). Over-expression of CP genes from plant sources, like C. papaya (Taylor et al., 1999), Ipomoea batatas (Chen et al., 2009; 2010), Nicotiana tabacum (Beyene et al., 2006; Zhang et al., 2009), and C. candamarcensis (Corrêa et al., 2011), has also been reported and shown to be encouraging examples of the aims presented in this study. The main objective of this research was to identify the gene sequences coding for the proteases that comprise the latex of J. mexicana. Finding other proteases, apart from mexicain and chymomexicain, that could potentially be more active and/or stable, would be very important for industrial and commercial purposes. 2. Materials and methods 2.1. Plant materials and germination J. mexicana seeds were obtained from the Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional (CEPROBI-IPN, Morelos, México) and surface-sterilized by incubating them in 15% hypochlorite for 15 min, followed by 90% ethanol for 1 min and subsequent extensive washing with sterile distilled water. Seeds (3 per tube) were then grown in 5 mL Knop medium (0.2 M MgSO4·7H2O, 0.2 M KNO3, 0.2 M KH2PO4, 0.8 M Ca(NO3)·4H2O, 0.5% agar, pH 5.5) under aseptic conditions. They were left in the dark until the coleoptile appeared and then grown with a photoperiod of natural light (13 h light, 11 h dark) until the plantlet was 15–18 cm long. 2.2. Isolation of RNA and DNA from J. mexicana leaves Total RNA and genomic DNA were extracted from J. mexicana leaves (200 mg leaf tissue for RNA and 235 mg leaf tissue for DNA)

61

using the PureLink micro-to-midi Total RNA Purification System Kit (Invitrogen, USA) and the Charge Switch gDNA Plant Kit (Invitrogen, USA), respectively, according to the manufacturer's instructions. The yield and purity of the RNA and DNA extracted were estimated by spectrophotometry and by electrophoresis.

2.3. Amplification of CP partial gene by RT-RACE-PCR In order to amplify the partial gene fragment of the J. mexicana CP of interest, degenerate oligonucleotides were designed based on the amino acid sequence alignment of mexicain and chymomexicain (Gavira et al., 2007), and other CPs such as papain (Mitchel et al., 1970) and chymopapain (Watson et al., 1990), with conserved regions at the N- and C-terminal regions (CGSCWA and KNSWGP), characteristic of the C1 family of papain-like CPs (Barrett and Rawlings, 2004; Joo et al., 2007; Portnoy et al., 1986). A reverse transcription was performed using 10 μg of total RNA, Oligo (dT)12–18 with Poly(A) RNA for priming, and the SuperScript First-Strand system for RT-PCR kit, according to the manufacturer's instructions (Invitrogen, USA). Single-stranded cDNA was used as a template and PCR was performed using the 1 U Advantage Genomic LA Polymerase Mix (Clontech, USA) and primers were designed based on the sequences previously mentioned. The sequences of the primers used (JmCys25 and JmAsn175) can be found in Table 1. PCR was carried out as follows: pre-denaturation at 95 °C, 5 min; 30 cycles of denaturation at 95 °C, 1 min; annealing at 55 °C, 30 s; extension at 72 °C, 1 min; and final extension at 72 °C, 15 min. The 3′ cDNA was amplified according to the 3′ RACE PCR protocol (Sambrook et al. 1989), using 10 μg RNA, a Poly(T)18 primer for the Poly(A) tail, and 200 U MMLV reverse transcriptase (Fermentas, USA), for 1 h at 37 °C. The 3′ cDNA was subjected to PCR amplification using 1 U of Platinum Pfx Polymerase (Invitrogen, USA), and a forward primer GSP1, which is based on the cloned internal conserved fragment, and a reverse primer, Poly(T)18. PCR was carried out as follows: pre-denaturation at 95 °C, 5 min; 30 cycles of denaturation at 95 °C, 30 s; annealing at 45 °C, 30 s; extension at 72 °C, 1 min; and final extension at 72 °C, 15 min. The DNA fragment coding for a putative pre-propeptide was synthesized by 5′ RACE using the SMART RACE cDNA Amplification kit (Clontech, USA). Ten micrograms of total RNA was reversely transcribed with 5′-CDS primer A, a SMART II A oligonucleotide (provided by the kit), and 200 U MMLV reverse transcriptase (Clontech, USA). The first strain synthesized was used for 5′-RACE PCR, using the UPM primer (provided by the kit) and a gene specific primer (JmAsn175, see Table 1) designed from the previously analyzed sequence, in a total volume of 50 μL. For PCR amplification the Advantage 2 PCR Enzyme System (Clontech, USA), with an Advantage Polymerase Mix (Titanium Taq DNA, TaqStart Antibody, activity corrector), was used and the reaction was carried out as follows: pre-denaturation at 95 °C, 1 min; 30 cycles of denaturation at 95 °C, 30 s; annealing from 68 °C to 65 °C, 30 s; extension at 70 °C, 1.5 min; and final extension at 72 °C, 10 min.

Table 1 Primers used for cDNA and gDNA cloning of JmCPs. Primer

Orientation

Sequence (5′→3′)

JmCys25 JmAsn175 GSP1 GSP2 GSP3 GSP4

Forward Reverse Forward Forward Forward Reverse

CTTGTGGTAGTTGTTGGGCAT TGGR(A/G)CCCCATGAATTCTT CCTGTGAGTGTCGTTCGTTTGA AGAGGATCCGATGACTACGATCTGTTCAAT AGAGGATCCGGATTTTTCTATTGTGGG AGAGGATCCTTAGTACTTATAACCTTTGG

Underlined sequences show restriction sites.

62

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

2.4. Primer design and full-length cDNA and gDNA amplification After performing the alignment analysis and constructing the partial internal sequence of the CP gene, the full-length cDNA sequences were obtained by designing oligonucleotides and primers to amplify the whole gene. The primer used to amplify the gene from the initial translation site was GSP2. The primers used for amplification of the gene without the 26 aa residues corresponding to the signal peptide (78 bp), in which GAT is the first codon of the pre-domain (Taylor et al., 1992), were GSP3 and GSP4, with an additional stop TAA codon. All the primers also contained a restriction enzyme site (BamHI). Primer sequences can be found in Table 1. Amplification of the gene from genomic DNA was performed by PCR using Buffer 10 ×, 25 mM MgSO4, 2 mM dNTPS, 100 ng genomic DNA, 1 mM GSP2 and GSP4 oligonucleotides, and DNA KOD Hot Star Polymerase (Novagen, USA), in a volume of 50 μL. The amplification was carried out as follows: activation of polymerase at 95 °C, 10 min; 35 cycles of denaturation at 95 °C, 45 s; annealing at 55 °C, 45 s; extension at 72 °C, 1 min; and final extension at 72 °C, 10 min. For amplification of the gene from cDNA, total RNA was extracted from J. mexicana leaves and cDNA was synthesized using the First Strand cDNA Synthesis Kit (Fermentas, USA), according to the manufacturer's instructions and using 5 μg RNA. The second strain was synthesized by PCR using KOD Hot Star DNA Polymerase, Buffer 10 ×, 25 mM MgSO4, 2 mM dNTPS, in a volume of 50 μL, and either GSP2 or GSP3 as forward primers, and GSP4 as a reverse primer in both. The amplification was carried out following the previously stated parameters, except that the polymerase activation was done for 5 min. 2.5. Cloning and expression of J. mexicana CP gene in E. coli During the first amplification phase all amplified products were purified from a 1% agarose gel, linked to the vector pCR®2.1-TOPO (Invitrogen, USA) and transformed into Top10 F′ competent cells, according to the manufacturer's instructions. The PCR products from the second amplification phase (complete gene) were cloned into the vector pBluescript II KS (+/−) (Fermentas, Canada). Resistance to ampicillin was used for selection of all the clones and plasmid DNA was isolated using the PureLink™ Quick Plasmid Miniprep Kit (Invitrogen, USA). Plasmid DNA was then sequenced using M13 forward and reverse primers, the BigDye® Terminator Cycle Sequencing FS Ready Reaction kit, and an ABI PRISM® 3100 automatic DNA sequencer (Applied Biosystems, USA). For the construction of expression vectors, pET28b was linearized using 10 U BamHI, the ends dephosphorylated using alkaline phosphatase from shrimp (SAP, Fermentas, Canada), and the insert ligated using T4 DNA Ligase, at an insert:vector ratio of 1:3. E. coli DH5α Ca 2 + competent cells were then transformed with this vector and grown on selective LB media (Sambrook et al., 1989). The expression of the J. mexicana's CP gene was induced by adding isopropyl-a-d-thiogalactopyranoside (IPTG). Specifically, single colonies from successfully transformed E. coli cells were picked and grown overnight at 37 °C in Luria–Bertani (LB) medium, supplemented with 30 mg/L kanamycin, at 200 rpm. The grown culture was then transferred to fresh LB medium (1:50 dilution) supplemented with 30 mg/L of kanamycin and grown at 37 °C, at 250 rpm, until the optical density at 600 nm was 0.4, when IPTG was added to a final concentration of 1 mM. Aliquots of the induced culture were withdrawn at 1, 2, 3, 4 and 6 h intervals and the expression levels were assessed by SDS-PAGE. 2.6. Immunoblotting Immunological identification of JmCP4 (40 kDa) recombinant protein was carried out by SDS-PAGE under denaturing conditions followed by electro-transfer to a PVDF membrane and immunoblotting with anti-mexicain antibodies produced in rabbits. After incubation

with anti-IgG antibody conjugated with peroxidase, the membrane was visualized by adding a mixture of 0.068% (w/v) 4-cloro-1-naftol and 0.0025% (v/v) hydrogen peroxide for 10 min in the dark. 2.7. Sequence analyses Sequences were analyzed using the Vector NTI Suite 6.0 software (Invitrogen, USA), which helped to obtain a full-length cDNA by overlapping the three amplified sequences during the first amplification phase. The algorithm BLAST (Altschul et al., 1990) was used to obtain homologies with other sequences. The program Signal PV3.0 was used to determine the location of the signal peptide (Nielsen et al., 1997). Physico-chemical properties were deduced using ProtParam program (Gasteiger et al., 2005). The multiple alignment analysis of CP amino acid sequences was done using the ClustalW2 program (Larkin et al., 2007). This program also helped determine the limit between the pro-peptide and the mature protein. 2.8. 3D protein structure modeling The tertiary structure of the proteins deduced from amplified cDNA was predicted using the automated protein structure homologymodeling server Swiss Model (Arnold et al., 2006). The preliminary models obtained were evaluated using the QMEAN score (Benkert et al., 2011). The images were produced by PyMOL (DeLano Scientific LLC, USA) and the predicted models were compared to other selected 3D protease structures using the Protein structure comparison service (Fold) provided by the European Bioinformatics Institute (http:// www.ebi.ac.uk/msd-srv/ssm) (Krissinel and Henrick, 2004). 3. Results and discussion 3.1. RNA extraction and cDNA synthesis Total RNA (~10.5 μg) extracted from 20-day-old J. mexicana plantlets showed a yield of 11.4 μg per 100 mg leaf tissue. After electrophoresis, bands that corresponded to mRNA were used for cDNA synthesis (Urmenyi et al., 1999). Ten micrograms of RNA was then used for cDNA synthesis, with an added poly(T) tag. Primers were designed based on the conserved region of CPs (CGSCW at the N-terminus and KNSW at the C-terminus), according to Kiyosaki et al. (2009), and the amino acid sequence of mexicain, which had already been crystallized and its structure elucidated (Gavira et al., 2007). 3.2. Amplification and sequence analysis of partial J. mexicana CP sequences In order to amplify the CP gene from J. mexicana, RT-PCR was performed using the JmCyS25 [CGSCWA] and JmAsn175 [KNSWGP] primers. Their design was based on the conserved catalytic domain sequences from the C1 family of papain-like CPs (Eakin et al., 1990; Joo et al., 2007). Using 16 different primer pairs, a partial sequence of 474 bp, belonging to an internal gene region, was amplified. This partial sequence was subjected to a BLAST analysis, which showed that the ORF was lacking the 5′ and 3′ ends. A gene specific primer based on this sequence was designed for 3′-PCR-RACE, generating a 466 bp fragment and found to contain a region coding for 87 aa at the carboxyl end of the CP, a 3′ UTR of 131 nucleotides with a Poly(A) signal sequence (AATAAA) and a Poly(A) tail of 18 residues. A 932 bp sequence was cloned and sequenced by 5′-PCR-RACE using the primer JmAsn175, with a 5′ ATG sequence at the beginning and 153 bp of a 5′ UTR. A BLAST analysis showed that the three sequences are highly similar to other CPs of the papain family. Using Vector NTI for multiple alignments, a full-length sequence of 1404 bp was obtained by overlapping the three partial sequences (data not shown). A 1044 bp ORF from this sequence corresponds to

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

63

Fig. 1. Full-length cDNA sequences and deduced amino acid sequences of JmCP4 and JmCP5. The predicted signal peptide is highlighted with a gray background, the pro-region is denoted by flanking arrows and the mature peptide is localized by flanking black squares. The start codon is shown in bold, the ERFNIN motif is shown in bold and underlined, and the catalytic triad (Cys, His and Asn) is shown in bold with a gray background.

64

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

348 aa, with 26 residues corresponding to the signal peptide, 108 to the pro-peptide and 214 to the mature enzyme.

The DNA sequences for JmCP4 and JmCP5 were deposited in GenBank and their accession numbers are as follows: JmCP4 (BankIt1516559 Seq1 JQ693558) and JmCP5 (BankIt1516559 Seq2 JQ693559).

3.3. Amplification and sequence analysis of the full-length J. mexicana CP gene

3.4. Genomic organization of J. mexicana CP gene

In order to amplify the full-length CP gene, three specific primers were designed based on an overlapping technique of the ORF from the first phase of amplification. In this way, the complete gene sequences were obtained and their sequence was analyzed. Proteases from the papain family are considered to have three parts: the N-terminal region (1–20 aa), the pro-sequence (38–250 aa) and the mature enzyme (220–260 aa), with exceptional cases also having a pro-peptide (9 aa) (Wiederanders et al., 2003). Two full-length cDNA sequences were obtained by RT-PCR from J. mexicana leaves and subsequently named JmCP4 and JmCP5 (Fig. 1). JmCP4 has an ORF of 1044 bp, which encodes for a prepro-papain-like protease with 348 aa (~40 kDa). It has a predicted 26 aa putative signal peptide followed by a pro-region of 108 aa and a mature peptide that consists of 214 aa (~24 kDa). The 969 bp JmCP5 gene (Fig. 1) lacks the 26-aa signal peptide, and starts with a 108 aa pro-region, followed by a mature peptide of 215 aa (~24 kDa). The two CP sequences obtained here showed a conserved catalytic region (Cys/His/Asn) characteristic of the papain CP family. Also, the regions associated with transcription initiation (INR) and downstream promoter elements (DPE) were identified. As seen in Fig. 1, there are 26 aa that correspond to the peptide signal (highlighted by flanking arrows), which has been proposed to serve as a means to retain the protein in the endoplasmic reticulum (ER) or mobilize it within the plant during germination for the degradation of proteins (Chen et al., 2006). However, the specific role of this sequence has not been completely defined and further studies are required to provide any conclusive remarks (Shindo and van der Hoorn, 2008). In Fig. 1, the region delimited by arrows corresponds to the pro-region of 108 aa and the pro-enzyme or zymogen, as has been reported for other sequences of CPs (Forsthoefel et al., 1998). Pro-regions act mainly as inhibitors since they avoid the formation of a mature, correctly-folded CP, as reported by Taylor et al. (1995) for papain and PP-IV, expressed in E. coli, as well as Vernet et al. (1991) for papain and the pro-region named propapain. A conserved sequence (ERFNIN) was found at the N-terminus of the pro-region of the isolated CP (Karrer et al., 1993) (Fig. 1), which is characteristic of some CPs and cathepsin proteases (L and B), involved in the folding of alpha helices found in the pro-region and the interaction with the adjoining beta-chain (Wiederanders et al., 2003; Ghosh et al., 2007). The region flanked by squares in Fig. 1 corresponds to the mature protein of JmCP4 (214 aa) and JmCP5 (215 aa). For some CPs like chymopapain III and cathepsins, a 9 aa long pro-peptide at the C-terminal has been reported and thought to be involved in the folding of the mature protein (Ghosh et al., 2007). This sequence, however, was not found here.

mRNA

5’-UTR 153 bp

Signal peptide 26 aa

A 1414 bp sequence was amplified from genomic DNA using the GSP2 and GSP4 oligonucleotides. The BLAST algorithm revealed high similarity between this sequence and other papain-like proteases. Alignment of JmCP4 and JmCP5 showed the presence of four exons and three putative introns in the CP gene. The four exons are 469 bp, 233 bp, 138 bp and 207 bp, while the three introns are 113 bp, 168 bp and 86 bp. Exon 1 encodes for 26 aa associated with a signal peptide and pro-domain (108 aa), as well as a 60 bp region encoding for part of the mature enzyme. The rest of the mature enzyme is encoded by exons 2, 3 and 4 (Fig. 2). Pereira et al. (2001) cloned a CP genomic sequence from C. candamarcensis (AY035986.1) with three introns, I1, I2 and I3 (123 bp, 169 bp and 74 bp, respectively), which were not detected in any database. We found that three J. mexicana introns (named I1, I2 and I3) had a unique similarity to the three reported for C. candamarcensis CP sequence: I1 (81.8%), I2 (84.7%) and I3 (93.2%). Even though there are some reports of plant CPs without introns (Kato et al., 1999; Mikkonen et al., 1996), the high percentage of similarity between the analyzed introns could show that the Caricaceae family might share the sequences I1–I3 (Pereira et al., 2001). However, there is not enough information in databases of plant CP genomic sequences to conclude that such a homology exists. 3.5. Comparison between J. mexicana CP sequences and other reported CPs The deduced amino acid sequences of the isolated CPs (JmCP4 and JmCP5) were aligned with other papain-like CPs and were shown to have a similar active site region to that of other CPs from the papain family (Cys25, Asn175, His159). Some of the small changes observed were between basic, acidic or neutral residues (R-K; D-E; A-G; Y-F), as seen in Fig. 3. The changes in the amino acid sequence of JmCP5 do not have a significant impact in the tertiary structure of the CP, when compared to mexicain (Gavira et al., 2007; Oliver-Salvador et al., 2000). Furthermore, this level of homology is generally associated with isoforms of the same type of protease. A BLAST homology search of the deduced amino acid sequences reveals that JmCP4 and JmCP5 share homology with other peptidases of the C1A family. JmCP4 exhibited identity from 56% to 91% with other papain-like CPs from six different plants, while JmCP5 presented the same range of identity with papain-like CPs from twelve different plants. JmCP4 presented the highest similarity (91%) to chymomexicain (P84347), while JmCP5 showed the highest identity (87%) to both chymomexicain and CC23 from Vasconcellea cundinamarcensis. The homology comparison showed that JmCP4 and JmCP5 have 83% and 85% sequence identity with mexicain (P84346), respectively. JmCP4 and

Pro-region 108 aa

Mature peptide 214 aa

3’-UTR 131 bp

gDNA Exon 1 469 bp

Intron 1 113 bp

Exon 2 233 bp

Exon 3 138 bp Intron 2 168 bp

Intron 3 86 bp

Exon 4 207 bp

Fig. 2. Schematic representation of the organization of the J. mexicana CP gene. The signal peptide, pro-region, mature peptide, and exon/intron regions are indicated.

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

65

Fig. 3. Multiple alignment analysis of JmCP4, JmCP5 and other CPs from the C1 Caricaceae family, using ClustalW2. Red and blue arrows indicate the start of the signal peptide and pro-region, respectively. A red asterisk denotes the start of the mature peptide. The ERFNIN motif is highlighted with red and the catalytic triad (Cys, His and Asn) is indicated with green, yellow and cyan backgrounds, respectively. Accession numbers: P84346, mexicain; P84347, chymomexicain; ABI30274, VS-B; AEF13978, chymopapain; P00784, papain.

3.6. Modeling of JmCP4 and JmCP5 3D structures

JmCP5 sequences have an identity of 88% with each other, supporting the hypothesis of their identity as CP isoforms within the latex of J. mexicana, as has been reported for other proteases like chymopapain isoforms I to V (Taylor et al., 1999). Table 2 shows a summary of the percentages of identity and accession numbers.

A three-dimensional structure of JmCP4 and JmCP5 was modeled based on their amino acid sequences, using mexicain (2bdz) as a model template. The predicted model shows the typical papain-like

Table 2 Amino acid percentage identity between the mature enzyme sequences of JmCP4 and JmCP5, and known CPs.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

Accession number

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

JmCP4 JmCP5 ADQ27799 AAK83567 ABI30274 ABI30276 P84346 P84347 P00784 AEF13978 CAB38314 CAB38315 CAB38316 CAB38317 ABI30272 ABI30275 XP_002279940

88 88 86 85 84 83 91 63 72 72 72 74 72 68 67 56

86 87 86 84 85 87 65 74 74 74 75 74 69 69 56

84 87 91 82 84 60 70 69 69 70 68 64 64 57

88 86 79 80 59 75 75 74 76 74 66 66 58

87 81 83 62 71 71 71 73 71 68 67 58

82 81 61 68 67 67 47 63 64 64 57

82 59 68 67 67 68 66 64 64 53

59 69 69 69 70 68 63 63 56

61 62 61 59 58 70 70 51

97 97 96 95 60 60 54

99 99 99 61 61 55

99 99 60 61 54

98 61 61 58

60 60 57

99 52

50

17

ADQ27799: mitogenic proteinase (Vasconcellea cundinamarcensis); AAK83567: CP CC23 (V. cundinamarcensis); ABI30274: VS-B (Vasconcellea stipulata); ABI30275: VS-A (V. stipulata); ABI30276: VXH-C (Vasconcellea × heilbornii); ABI30272: VXH-A (Vasconcellea × heilbornii); P84346: mexicain (Jacaratia mexicana); P84347: chymomexicain (J. mexicana); P00784: papain (Carica papaya); AEF13978: chymopapain (C. papaya); CAB38314: chymopapain isoform II (C. papaya); CAB38315: chymopapain isoform III (C. papaya); CAB38316: chymopapain isoform IV (C. papaya); CAB38317: chymopapain isoform V (C. papaya); XP_002279940: CP-like (Vitis vinifera); XP_002510720: putative CP (Ricinus communis); AAC49406: CP (Zinnia violacea).

66

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

folding pattern in the two structures generated, with two domains (L and R) separated by the classic binding cleft (Fig. 4). The catalytic site residues of JmCP4 and JmCP5 proteins are positioned in a similar way to the ones in mexicain, as shown in Fig. 4. The conserved motifs from CPs belonging to the Caricaceae family, such as 11GAVTPV16, 173IKNSWG178, and residues Cys25, Asn175, His159 from the catalytic triad, are found in both JmCP proteins. JmCP4 and JmCP5 also revealed the seven-cysteine residues (Cys) common to this family, which showed the same disulphide connections of Pap, GP-II and mexicain (Choi et al., 1999; Gavira et al., 2007; Kamphuis et al., 1985), namely 22–63, 56–95 and 153–200 (Gavira et al., 2007). Cys25 is found in the reduced state at the active site, a characteristic common to other CPs. JmCP4 and JmCP5 presented Cys residues composing the disulphide bonds found in the mature protein (JmCP4: 21–62, 55–94 and 152–199; JmCP5: 22–63, 56–95 and 153–200), contributing to the stability of the tertiary structure. In order to estimate the quality of the two generated models, the QMEAN global score was calculated for JmCP4 (0.78) and JmCP5 (0.82), where the predicted model reliability ranges from 0 to 1. The tertiary structures produced by the Swiss Model were superimposed on the modeled structures for mexicain (2bdz) (Gavira et al., 2007), chymopapain (1yal), caricain (1meg) and papain (1khq) (Fig. 4). The 3D model showed that the predicted structures for JmCP4 and JmCP5 have a high structural similarity to the selected templates (overall RMSD of 0.65 Å). 3.7. Expression of CPs from J. mexicana in E. coli Culture samples of E. coli BL21 transformed with JmCP4 and JmCP5, collected at several intervals and analyzed by SDS-PAGE, indicated that the optimum time for the expression of the CP gene was 4 h, in the presence of 1 mM IPTG. The newly synthesized proteins represented the major component of the lysates. Electrophoresis analysis

of the bacterial lysates showed that the recombinant proteins were mainly present in the insoluble fraction. A major 40-kDa protein band (expected size), along with changes on the intensity of a band corresponding to a lower molecular weight protein (25 kDa), could be seen for JmCP4 (Fig. 5a, lanes 3–9). For JmCP5 a change in the intensity of the band corresponding to a protein of apparent molecular weight of 40 kDa was observed (Fig. 5b, lanes 3–9). In the case of the expression of JmCP4, total cell protein was separated by electrophoresis and, after immunoblotting, detected with previously raised polyclonal antibodies against mexicain (purified from the latex of J. mexicana). As can be seen in Fig. 5c, anti-mexicain antibodies can efficiently bind to a protein of apparent molecular weight of 40 kDa, which corresponds to the protein seen in the Coomassie-stained gel (Fig. 5a). There is also a band corresponding to a protein of ~ 24 kDa which could be antibodies binding to a degradation product of the 40 kDa protein. A change on the intensity of the bands corresponding to lower molecular weight proteins (~24 kDa) was visible for JmCP4 and could be what the antibodies might be binding to. JmCP4 and JmCP5 proteins are thought to represent CP isoforms in the latex of J. mexicana, in agreement with the results shown for chymopapains in C. papaya (Taylor et al., 1999), in Vasconcellea stipulata and V. × heilbornii (Kyndt et al., 2007) and in C. candamarcensis (Corrêa et al., 2011; Teixeira et al., 2008). Some of the proteinases or CP isoforms from C. papaya (Cohen et al., 1990; Baker et al., 1996; Groves et al., 1996; Revell et al., 1993; Taylor et al., 1992; 1995; 1999; Vernet et al., 1991) and C. candamarcensis (Corrêa et al., 2011) were cloned and expressed in heterologous systems. This is the first report of cloning and expression of a pre-proenzyme isoform and a proenzyme isoform of CPs from J. mexicana. Although, the activity of the purified enzyme remains to be proved, the availability of recombinant mg quantities of purified CPs from J. mexicana would allow to carry out a complete biochemical characterization, as well as the appropriate kinetic studies,

Fig. 4. 3D molecular modeling of J. mexicana CPs. Models at the top represent the tertiary structures predicted by the software SWISS-MODEL and visualized with PyMOL for JmCP4 (a) and JmCP5 (b), analyzed here using mexicain (pdb 2bdz) as a model template. The software Verify3D demonstrated the compatibility of the predicted 3D models. For JmCP4, 90.5% of the residues had a score >0.2 (compatibility 1D–3D). For JmCP5, 89.1% of the residues had a score >0.2 (compatibility 1D–3D). The models have a typical tertiary structure from papain-like CPs, with two domains: Domain L (rich in α helices) and domain R (rich in β sheets). The figure at the bottom represents the backbone models of JmCP4 (orange) and JmCP5 (purple) overlapped with different plant CPs: mexicain (red), chymopapain (blue), caricain (yellow), and papain (green), using PDBeFold.

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

67

Fig. 5. Expression of recombinant proteins JmCP4 (a, c) and JmCP5 (b) in E. coli BL21-DE3. The lysate insoluble fraction was loaded onto a 12% SDS gel and subsequently stained with Coomassie Brilliant Blue R250 (a, b) or immunoblotted and detected with anti-mexicain antibodies (c). The red arrow indicates the CP of interest (40 kDa). In the Coomassiestained gels (a, b): lane 1: mass standards; lane 2: E. coli wild type lysate; lane 3: bacterial lysate without induction; lanes 4–9: bacterial lysate with IPTG induction at several intervals (0 to 6 h). In the western blot (c): lane 1: mass standards; lane 2: E. coli wild type lysate; lane 3: E. coli BL21-DE3 transformed with pET28b-JmCP4; lane 4: E. coli BL21-DE3 transformed with pET28b-JmCP4 and induced with IPTG for 4 h (over-expression of JmCP4).

and to serve as a constant source for pilot-scale recombinant protein production that may function as a first step to compete with other industrial processes. DNA technology and genetic engineering could also help in the production of these types of proteases at the industrial level (Feijoo-Siota and Villa, 2011). 4. Conclusions The cDNA sequence of two CPs from J. mexicana was elucidated: JmCP4 and JmCP5, with 1044 and 969 bp respectively, which codify for proteases that are 214 and 215 aa long. According to the amino acid sequence comparison performed, the residues form the active site are characteristic of the Caricaceae CP family of proteins, as well as the pro-peptide sequence, and are highly conserved when compared to other CPs of plant origin. These proteases seem to be generated as pre-proenzymes. The modeling of the tridimensional structure of the proteases suggested a typical tertiary structure for papain-like CPs. The sequence obtained from gDNA helped identify the presence of three introns. The J. mexicana CPs are thought to be isoforms, a conclusion supported by the existence of similar or identical N-terminal sequences in J. mexicana CPs with minor variations in their molecular size. Finally, in a preliminary expression study, JmCP4 and JmCP5 were cloned into an expression vector used to transform E. coli BL21 cells and successfully expressed. Cloning and expression of CPs from J. mexicana is reported here for the first time. The expression profile showed a 40 kDa protein that was recognized by polyclonal antibodies against mexicain, extracted from the latex of J. mexicana. Acknowledgments Research in the laboratory of MCOS was supported by Instituto Politécnico Nacional-SIP (20100222 and 20110944). JABC, MCOS and CGO are COFAA and EDI-IPN scholars. The authors also want to thank Professor Roberto Briones-Martínez for providing the J. mexicana seeds used in this research. References Alonso, J.M., Granell, A., 1995. A putative vacuolar processing protease is regulated by ethylene and also during fruit ripening in citrus fruit. Plant Physiol. 109, 541–547. Altschul, F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modeling. Bioinformatics 22, 195–201.

Baker, K.C., Taylor, M.A., Cummings, N.J., Tuñón, M.A., Worboys, K.A., Connerton, I.F., 1996. Autocatalytic processing of pro-papaya proteinase IV is prevented by crowding of the active-site cleft. Protein Eng. 9, 525–529. Barrett, A.J., Rawlings, N.D., 2004. Introduction: The Clans and Families of Cysteine Peptidases. In: Barrett, A.J., Rawlings, N.D., Woessner, J.F. (Eds.), Handbook of Proteolytic Enzymes. Academic Press, London, UK, pp. 545–797. Benkert, P., Biasini, M., Schwede, T., 2011. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics 27, 343–350. Beyene, G., Foyer, C.H., Kunert, K.J., 2006. Two new cysteine proteinases with specific expression patterns in mature and senescent tobacco (Nicotiana tabacum L.) leaves. J. Exp. Bot. 57, 1431–1443. Briones-Martínez, R., Juárez-Juárez, M., Oliver-Salvador, M.C., Cortés-Vázquez, M.I., 1997. Influence of enzymatic hydrolysis on plant protein functionality. DSC studies. J. Therm. Anal. 49, 831–837. Brömme, D., Nallaseth, F.S., Turk, B., 2004. Production and activation of recombinant papain-like cysteine proteases. Methods 32, 199–206. Castañeda-Agulló, M., Gavarrón, F.F., Balcazar, M.R., 1942. On a new protease from Pileus mexicanus. Science 96, 365–366. Chapman, H.A., Riese, R.J., Shi, G.-P., 1997. Emerging roles for cysteine proteases in human biology. Annu. Rev. Physiol. 59, 63–88. Chen, H.-J., Huang, D.-J., Hou, W.-C., Liu, J.-S., Lin, Y.-H., 2006. Molecular cloning and characterization of granulin-containing cysteine protease SPCP3 from sweet potato (Ipomoea batatas) senescent leaves. J. Plant Physiol. 163, 863–876. Chen, H.-J., Huang, G.-J., Chen, W.-S., Su, C.-T., Hou, W.-C., Lin, Y.-H., 2009. Molecular cloning and expression of a sweet potato cysteine protease SPCP1 from senescent leaves. Bot. Stud. 50, 159–170. Chen, H.-J., Su, C.-T., Lin, C.-H., Huang, G.-J., Lin, Y.-H., 2010. Expression of sweet potato cysteine protease SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis plants. J. Plant Physiol. 167, 838–847. Choi, K.H., Laursen, R.A., Allen, K., 1999. The 2.1 Å structure of a cysteine protease with proline specificity from ginger rhizome, Zingiber officinale. Biochemistry 38, 11624–11633. Cohen, L.W., Fluharty, C., Dihel, L.C., 1990. Synthesis of papain in Escherichia coli. Gene 88, 263–267. Corrêa, N.C., et al., 2011. Molecular cloning of a mitogenic proteinase from Carica candamarcensis: its potential use in wound healing. Phytochemical 72, 1947–1954. Eakin, A.E., Bouvier, J., Sakanari, J.A., Craik, C.S., McKerrow, J.H., 1990. Amplification and sequencing of genomic DNA fragments encoding cysteine proteases from protozoan parasites. Mol. Biochem. Parasitol. 39, 1–8. Elliot, E., Sloane, B.F., 1996. The cysteine protease cathepsin B in cancer. Perspect. Drug Discov. 6, 12–32. Feijoo-Siota, L., Villa, T.G., 2011. Native and biotechnologically engineered plant proteases with industrial applications. Food Bioprocess Technol. 4, 1066–1088. Forsthoefel, N.R., Cushman, M.A.F., Ostrem, J.A., Cushman, J.C., 1998. Induction of a cysteine protease cDNA from Mesembryanthemum crystallinum leaves by environmental stress and plant growth regulators. Plant Sci. 136, 195–206. Gasteiger, E., et al., 2005. Protein Identification and Analysis Tools on the ExPASy Server. In: Walker, John M. (Ed.), The Proteomics Protocols Handbook. Humana Press, pp. 571–607. Gavira, J., González-Ramírez, L., Oliver-Salvador, M.C., Soriano-García, M., García-Ruíz, J., 2007. Structure of the mexicain-E-64 complex and comparison with other cysteine proteases of the papain family. Acta Crystallogr. D63, 555–563. Ghosh, R., Dattapupta, J., Biswas, S., 2007. A thermostable cysteine protease precursor from a tropical plant contains an unusual C-terminal propeptide: cDNA cloning, sequence comparison and molecular modeling studies. Biochem. Biophys. Res. Commun. 362, 965–970. Groves, M.R., Taylor, M.A.J., Scott, M., Cummings, N.J., Pickersgill, R.W., Jenkins, J.A., 1996. The prosequence of procaricain forms an alfa-helical domain that prevents access to the substrate-binding cleft. Structure 4, 1193–1203.

68

E.M. Ramos-Martínez et al. / Gene 502 (2012) 60–68

Hao, L., Hsiang, T., Goodwin, P.H., 2006. Role of two cysteine proteinases in the susceptible response of Nicotiana benthamiana to Colletotrichum destructivum and the hypersensitive response to Pseudomonas syringae pv. tomato. Plant Sci. 170, 1001–1009. Harrak, H., Azelmat, S., Baker, E.N., Tabaeizadeh, Z., 2001. Isolation and characterization of gene encoding a drought-induced cysteine protease in tomato (Lycopersicon esculentum). Genome 44, 368–374. Joo, H.S., et al., 2007. Cloning and expression of the cathepsin F-like cysteine protease gene in Escherichia coli and its characterization. J. Microbiol. 45, 158–167. Kamphuis, I.G., Drenth, J., Baker, E.N., 1985. Thiol proteases: comparative studies based on the high-resolution structures of papain and actinidin, and on amino acid sequence information for cathepsins B and H, and stem bromelain. J. Mol. Biol. 182, 317–329. Karrer, K.M., Peiffer, S.L., Ditomas, M.E., 1993. Two distinct gene subfamilies within the family of cysteine protease genes. Proc. Natl. Acad. Sci. U. S. A. 90, 3063–3076. Kato, H., Shintani, A., Minamikawa, L., 1999. The structure and organization of two cysteine endopeptidase genes from rice. Plant Cell Physiol. 40, 462–467. Kiyosaki, T., et al., 2009. Wheat cysteine proteases triticain alpha, beta and gamma exhibit mutually distinct responses to gibberellin in germinating seeds. J. Plant Physiol. 166, 101–106. Koizumi, M., Yamaguchi-Shinozaki, K., Tsuji, H., Shinozaki, K., 1993. Structure and expression of two genes that encode distinct drought-inducible cysteine proteinases in Arabidopsis thaliana. Gene 29, 175–182. Kouzuma, Y., Tsukigata, K., Inanaga, H., Doi-Kawano, K., Yamasaki, N., Kimura, M., 2001. Molecular cloning and functional expression of cDNA encoding the cysteine proteinase inhibitor Sca from sunflower seeds. Biosci. Biotech. Biochem. 65, 969–972. Krissinel, E., Henrick, K., 2004. Secondary-structure matching (PDBeFold), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr. D60, 2256–2268. Kruger, J., et al., 2001. A tomato cysteine protease required for cf-2-dependent disease resistance and suppression of autonecrosis. Science 296, 744–747. Kyndt, T., DammeEJ, Van, Van Beeumen, J., Gheysen, G., 2007. Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. FEBS J. 274, 451–462. Larkin, M.A., et al., 2007. ClustalW and ClustalX version 2. Bioinformatics 23, 2947–2948. Lemere, C.A., et al., 1995. The lysosomal cysteine protease, cathepsin S, is increased in Alzheimer's disease and Down syndrome brain. An immunocytochemical study. Am. J. Pathol. 146, 848–860. Linthorst, H.J.M., Vanderdoes, C., Brederode, F.T., Bol, J.F., 1993. Circadian expression and induction by wounding of tobacco genes for cysteine proteinase. Plant Mol. Biol. 21, 685–694. Mikkonen, A., Porali, I., Cercos, M., Ho, T.H., 1996. A major cysteine proteinase, EPB, in germinating barley seeds: structure of two intronless genes and regulation of expression. Plant Mol. Biol. 31, 239–254. Mitchel, R., Chaiden, I., Smith, E., 1970. The complete amino acid sequence of papain. Additions and corrections. J. Biol. Chem. 245, 3485–3492. Mitsuhashi, W., Yamashita, T., Toyomasu, T., Kashiwagi, Y., Konnai, T., 2004. Sequential development of cysteine proteinase activities and gene expression during somatic embryogenesis in carrot. Biosci. Biotech. Biochem. 68, 705–713. Muller-Ladner, U., Gay, R.E., Gay, S., 1996. Cysteine proteinases in arthritis and inflammation. Perspect. Drug Discov. 6, 87–98. Naito, Y., Fujie, M., Usami, S., Murooka, Y., Yamada, T., 2000. The involvement of cysteine proteinase in the nodule development in Chinese milk vetch infected with Mesorhizobium huakuii subsp. rengei. Plant Physiol. 124, 1087–1096. Nielsen, H., Engelbrecht, J., Brunbak, S., Heijne, G., 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1–6. Oliver-Salvador MC (1999) Purificación, caracterización y cristalización de la proteasa cisteínica del latex de Pileus mexicanus: Mexicaína. Thesis, Escuela Nacional de Ciencias Biológicas IPN, Mexico Oliver-Salvador, M.C., Moreno, M., Soriano, M., 2000. Cristalogénesis y estudios estructurales de una proteasa cisteínica aislada del latex de Pileus mexicanus. Ciencia 51, 12–20. Oliver-Salvador, M.C., González-Ramírez, L.A., Gavira, J.A., Soriano-García, M., GarcíaRuiz, J.M., 2004. Purification, crystallization and preliminary X-ray analysis of mexicain. Acta Crystallogr. D60, 2058–2060.

Oliver-Salvador, M.C., Lian, Z., Laursen, R.A., Bolaños-García, V.M., Soriano-García, M., 2011. Biochemical characterization of MX-4, a plant cysteine protease of broad specificity and high stability. Food Chem. 126, 543–552. Palma, M.J., Sandalio, M.L., Javier, C.F., Romero-Puertas, C.M., McCathy, I., del Rio, A.L., 2002. Plant proteases, protein degradation, and oxidative stress: role of peroxisomes. Plant Physiol. Biochem. 40, 521–530. Pereira, M.T., Lopez, M.T., Meira, W.O., Salas, C.E., 2001. Purification of a cysteine proteinase from Carica candamarcensis L. and cloning of a genomic fragment coding for this enzyme. Protein Expr. Purif. 22, 249–257. Portnoy, D.A., Erickson, A.H., Kochan, J., Ravetch, J.V., Unkeless, J.C., 1986. Cloning and characterization of a mouse cysteine proteinase. J. Biol. Chem. 261, 14697–14703. Revell, D.F., et al., 1993. Nucleotide sequence and expression in Escherichia coli of cDNAs encoding papaya proteinase omega from Carica papaya. Gene 127, 221–225. Saleh, Y., Siewinski, M., Kielan, W., Ziolkowski, P., Grybos, M., Rybka, J., 2003. Regulation of cathepsin B and L expression in vitro in gastric cancer tissues by egg cystatin. J. Exp. Ther. Oncol. 3, 319–324. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, New York. Schaffer, M.A., Fischer, R.L., 1988. Analysis of mRNAs that accumulates in response to low temperature identifies a thiol protease gene in tomato. Plant Physiol. 87, 431–436. Shimada, T., Hiraiwa, N., Nishimura, M., Hara-Nishimura, I., 1994. Vacuolar processing enzyme of soybean that converts proproteins to the corresponding mature forms. Plant Cell Physiol. 35, 713–718. Shindo, T., van der Hoorn, R.A.L., 2008. Papain-like cysteine proteases: key players at molecular battlefields employed by both plants and their invaders. Mol. Plant Pathol. 9, 119–125. Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., Levine, A., 1999. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11, 431–444. Taylor, M.A.J., Pratt, K.A., Revell, D.F., Baker, K.C., Sumner, I.G., Goodenough, P.W., 1992. Active papain renatured and processed from insoluble recombinant propapain expressed in Escherichia coli. Protein Eng. 5, 455–459. Taylor, M.A.J., et al., 1995. Recombinant pro-regions from papain and papaya proteinase IV are selective high affinity inhibitors of the mature papaya enzymes. Prot Eng 8, 59–62. Taylor, M.A.J., Al-sheikh, M., Revell, D.F., Sumner, I.G., Connerton, I.F., 1999. cDNA cloning and expression of Carica papaya prochymopapain isoforms in Escherichia coli. Plant Sci. 145, 41–47. Teixeira, R.D., Ribeiro, H.A.L., Gomes, M.T.R., Lopes, M.T., Salas, C.E., 2008. The proteolytic activities in the latex from Carica candamarcensis. Plant Physiol. Biochem. 46, 956–961. Toyooka, K., Okamoto, T., Minamikawa, T., 2000. Mass transport of a proform of a KDELtailed cysteine proteinase (SH-EP) to protein storage vacuoles by endoplasmic reticulum-derived vesicle is involved in protein mobilization in germinating seeds. J. Cell Biol. 148, 453–563. Turk, B., Turk, D., Turk, V., 2000. Lysosomal cysteine proteases: more than scavengers. Biochim. Biophys. Acta 1477, 98–111. Ueda, T., Seo, S., Ohashi, Y., Hashimoto, J., 2000. Circadian and senescence-enhanced expression of a tobacco cysteine protease gene. Plant Mol. Biol. 44, 649–657. Urmenyi, T.P., Bonaldo, M.F., Soares, M.B., Rondinelli, E., 1999. Construction of a normalized cDNA library for the Trypanosoma cruzi genome project. J. Eukaryot. Microbiol. 46, 541–544. Vernet, T., et al., 1991. Processing of the papain precursor. Purification of the zymogen and characterization of its mechanism of processing. J. Biol. Chem. 266, 21451–21457. Watson, D.C., Yaguchi, M., Lynn, K.R., 1990. The amino acid sequence of chymopapain from Carica papaya. Biochem. J. 266, 75–81. Wiederanders, B., Kaulmann, G., Schilling, K., 2003. Functions of propeptide part in cysteine proteases. Curr. Protein Pept. Sci. 4, 309–326. Xu, X.-F., Chye, L.-M., 1999. Expression of cysteine proteinase during development events associated with programmed cell death in brinjal. Plant J 17, 321–328. Zhang, X.-M., et al., 2009. NtCP56, a new cysteine protease in Nicotiana tabacum L., involved in pollen grain development. J. Exp. Bot. 60, 1569–1577.