Isolation of chicken astrovirus from specific pathogen-free chicken embryonated eggs

Isolation of chicken astrovirus from specific pathogen-free chicken embryonated eggs1 Luis Fabian N. Nu˜ nez,∗ Silvana H. Santander Parra,∗ Elena Mettifogo,∗ M´ arcia Helena B. Catroxo,† ∗ Claudete S. Astolfi-Ferreira, and Antonio J. Piantino Ferreira∗,2 ∗

Department of Pathology, School of Veterinary Medicine, University of S˜ ao Paulo, Av. Prof. Dr. Orlando M. Paiva, 87, 05508-270, S˜ ao Paulo, SP, Brazil; and † Laboratory of Electron Microscopy, Center for Research and Development of Animal Health, InstitutoBiol´ ogico, Av. Cons. Rodrigues Alves, 1252, 04014-002, S˜ ao Paulo, SP, Brazil

Key words: chicken astrovirus, chicken embryonated eggs, viral isolation, enteric virus 2015 Poultry Science 00:1–8 http://dx.doi.org/10.3382/ps/pev086

INTRODUCTION

et al. (2000)], and duck astrovirus [by Asplin (1965)], being their genomes completely sequenced. CAstV is a small, rounded, nonenveloped virus, typically 28 to 30 nm in diameter with a star-like morphology (Maondez and Arias, 2007; Kang et al., 2012b). Its genome varies from 6.4 to 7.7 kb in length and has 3 open reading frames (ORF) and a poly-A tail (Koci and Schultz-Cherry, 2002; Maondez and Arias, 2007; De Benedictis et al., 2011). ORF 1a and ORF 1b encode nonstructural proteins, and ORF 2 encodes a capsid precursor protein (De Benedictis et al., 2011). The family Astroviridaeis divided into 2 genera: mammalian astroviruses and avian astroviruses. CAstV has been associated with RSS in chickens and has been associated previously with poor weight gain and enteric diseases in chickens. RSS was first described by Olsen (1977) and Kouwenhoven et al. (1978) in broilers. At that time, the syndrome produced a high economic impact due to weight loss, lower feed conversion, and mortality. The disease is characterized by diarrhea, depression, and lethargy, with pale intestines and/or cecum containing watery contents (Jindal et al., 2009). Antigenic characterization of avian astroviruses has been limited due to the difficulty of isolating and growing these viruses (Koci and Schultz-Cherry, 2002). Currently, 2 serotype of CAstV has been described (Pantin-Jackwood et al., 2011).

Enteric poultry diseases are reported worldwide, such as runting–stunting syndrome (RSS) and malabsorption syndrome in broilers and poult enteritis syndrome and poult enteritis and mortality syndrome in turkey poults. These enteric syndromes are associated with several infectious agents, including viruses and bacteria, although viruses are being more frequently studied and associated with enteric diseases in chickens (Saif, 2013; Kang et al., 2012a; Reynolds and Schultz-Cherry, 2008). Astroviruses have been detected and associated with enteric diseases (Reynolds and Schultz-Cherry, 2008). Five avian astroviruses have been identified in poultry: turkey astroviruses 1 and 2 [by Saif et al. (1985)], chicken astrovirus [CAstV; by Baxendale and Mebatsion (2004)], avian nephritis virus [ANV; by Imada

 C 2015 Poultry Science Association Inc. Received November 4, 2014. Accepted January 15, 2015. 1 The authors would like to thank the Funda¸c˜ao de Amparo a` Pesquisa do Estado de S˜ ao Paulo and Conselho Nacional de Desenvolvimento Cient´ıfico e Tecnol´ogico for financial support of this study. A. J. Piantino Ferreira is the recipient of a Conselho Nacional de Desenvolvimento Cient´ıfico e Tecnol´ogico fellowship. 2 Corresponding author: [email protected]

1

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

were screened for CAstV, and differential diagnostic testing was performed for avian nephritis virus, avian rotavirus, avian reovirus, chicken parvovirus, infectious bronchitis virus, and fowl adenovirus Group I to detect co-infection with other infectious agents. Seven- or 14-day-old CEEs presented with hemorrhages, edema, a gelatinous aspect, deformities, and dwarfism. The supporting membranes did not show any alterations. Here, we have described the isolation of CAstV and its pathological characteristics in SPF CEE.

ABSTRACT Astroviruses have been associated with enteric disorders in many animal species, including chickens. Here, we describe the isolation, propagation, and pathological characteristics of chicken astrovirus (CAstV) in specific pathogen free (SPF) chicken embryonated eggs (CEE) from chickens with diarrhea and runting–stunting syndrome. The CEE were inoculated via the yolk sac route. Viral confirmation was carried out using PCR techniques and transmission electron microscopy negative staining with ammonium molybdate. The intestinal contents

˜ NUNEZ ET AL.

2

Table 1. Target genes, primer sequences, and amplicon sizes for the RT–PCR and PCR assays for differential diagnostic testing for enteric viruses, including CAstV. Virus

Primer names Gene target

ChPV CAstV ANV FAdV-I IBV

Avian reovirus Avian rotavirus

NS ORF-1b ORF-1b Hexon UTR

S4 NSP4 F

Amplicon size (bp)

Reference

561

Zsak et al., 2009

362

Day et al., 2007

473

Day et al., 2007

897

Meulemans et al., 2001

179

Cavanagh et al., 2002

1,120

Pantin-Jackwood et al., 2008

630

Day et al., 2007

324

Pang et al., 2002



5 TTCTAATAACGATATCACT3 5 TTTGCGCTTGCGGTGAAGTCTGGCTCG3 5 GAYCARCGAATGCGRAGRTTG3 5 TCAGTGGAAGTGGGKARTCTAC3 5 GYTGGGCGCYTCYTTTGAYAC3 5 CRTTTGCCCKRTARTCTTTRT3 5 CAARTTCAGRCAGACGGT3 5 TAGTGATGMCGSGACATCAT3 5 ATGTCTATCGCCAGGGAAATGTC3 5 GGGCGTCCAAGTGCTGTACCC3 5 GCTCTAACTCTATACTAGCCTA3 5 GTGCGTGTTGGAGTTTCCCG3 5 TACGCCATCCTAGCTGGA3  5 GTGCGGAAAGATGGAGAAC3 5 GTTGGGGTACCAGGGATTAA3 5 GGAGGATGTTGGCAGCATT3 5 GTCAACATATACACCTCATC3

Here, we report the isolation of CAstVs and their pathological features in specific pathogen free (SPF) chicken embryonated eggs (CEE) obtained from commercial chicken flocks with diarrhea and RSS.

MATERIALS AND METHODS Virus Strains Intestinal contents of broilers or broiler breeders showing signs of enteric disease were sent to the Laboratory of Avian Diseases at Faculdade de Medicina Veterin´ aria e Zootecnia–University of S˜ ao Paulo for molecular diagnosis of enteric viruses [CAstV, ANV, reovirus, rotavirus, fowl adenovirus Group I (FAdV1), infectious bronchitis virus (IBV), and chicken parvovirus (ChPV)]; sequences of primers used are described in Table 1. The procedure is described by Mettifogo et al., 2014; 280 samples were collected between 2008 and 2010 from broilers or broiler breeders with clinical signs of diarrhea or RSS from farms located in several Brazilians states (S˜ao Paulo, Santa Catarina, and Rio Grande do Sul), which are areas of intensive poultry production. Each of these samples was tested for all 7 viruses described above according to previously described methods (Mettifogo et al., 2014) and 14 were shown to be positive only for CAstV using realtime (RT)–PCR and confirmed by DNA sequencing. These 14 samples positive only for CAstV were used in the present study for isolation of CAstV with the inoculation of them in SPF CEE (Table 3).

CAstV Inocula First-passage inocula were prepared using the same suspension of the 14 samples positives only for CAstV that was used for molecular testing, with the addition of PBS 0.1 M at pH 7.4 to dilute the suspension to 1.5 mL, thus replacing the volume used for the DNA and

RNA (250 μL) extractions. The suspensions for molecular testing were made using an aliquot of intestinal contents placed into sterile microfuge tubes containing PBS 0.1 M at pH 7.4; these suspensions were homogenized and underwent 3 cycles of freezing and thawing at −20◦ C for 10 min and 56◦ C for 1 min, respectively. The samples were then centrifuged at 12,000 × g for 20 min at 4◦ C and the supernatant was diluted 1:7 to a final volume of 1,300 μL with PBS 0.1 M at pH 7.4. In addition, 10 μL antibiotic (10,000 IU/mL penicillin and 2 mg/mL streptomycin sulfate) and 10 μL of antifungal (amphotericin B 0.02 mg/mL) were added to each sample. For the next 2 viral isolation passages, a suspension was made with equal aliquots of PBS and macerated embryo and yolk collected during necropsy, following the procedure described above.

SPF Chicken Embryonated Eggs Seven-day-old SPF White Leghorn CEE were used. Eggs were maintained in an automated hatchery that provided both stable temperature (37.5 to 38◦ C) and humidity (35 to 40%). The SPF CEEs were kindly doR nated by CEVA Animal Health and Laborat´ orio Bio Vet, both located in Brazil.

Virus Isolation Seven-day-old (first group) and 14-day-old (second group) CEEs were used for virus isolation. On the seventh or 14th d incubation, each egg was visualized, and dead eggs were discarded. Viable eggs were marked with the inoculation site, the sample number, and the passage number. The eggs were disinfected with 70% alcohol, drilled, and inoculated with 0.2 mL inocula using the yolk sac route. No other route of inoculation was tested. A negative control was also inoculated with 0.2 mL sterile PBS 0.1 M at pH 7.4. Each sample was inoculated into 3 eggs, and the eggs were sealed and

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

NDV

PVF1 PVR1 CAS pol 1F CAS pol 1R ANV pol 1F ANV pol 1R Hexon A Hexon B UTR 11 UTR 44 UTR 31 S4-F13 S4-R1133 NSP4-F30 NSP4-R660 New S New A

Primer sequences 

3

ISOLATION OF CHICKEN ASTROVIRUS Table 2. Results of CAstV isolation in SPF CEEs confirmed by RT–PCR and visualization of viral particles by transmission electron microscopy, along with differential diagnostic testing for other enteric viruses. Strategy for CAstV isolation in SPF CEE Virus

Inoculation of 7-day-old CEEs n = 14

Inoculation of 14-day-old CEEs n = 14

Total number of viruses isolated

CAstV ChPV IBV ANV FAdV-1 Avian rotavirus Avian reovirus NDV

31 0 0 0 0 0 0 0

51 0 0 0 0 0 0 0

8 0 0 0 0 0 0 0

Total

3

5

8

1

Number of positive samples.

Macroscopic Characterization SPF CEEs were subjected to necropsies after natural death or euthanasia. The embryos were examined for gross lesions that developed due to viral infection, such as deformities, stunting, and curled, as well as the presence of hemorrhages, edema, and a gelatinous aspect. Macroscopic lesions were evaluated qualitatively to determine the presence (positive) or absence (negative) of injuries.

Confirmation of Viral Isolation Confirmation of viral isolation was carried out by detecting viral nucleic acid using the molecular techniques of PCR and RT–PCR using primers and protocols cited in Table 1, by visualizing viral particles using negative staining electron microscopy (EM) and by determining the presence of gross lesions in the embryo. Embryos and supporting membranes that showed macroscopic lesions that were positive by molecular techniques and that had visible viral particles on EM were considered positive for CAstV isolation. At each passage, all samples were also molecularly tested for ANV, ChPV, IBV, FAdV-I, reovirus, rotavirus, and Newcastle disease virus (NDV; Table 2).

Sampling, Preservation, and Processing of Samples for Molecular Testing RT–PCR and PCR were used to confirm RNA and DNA viral isolation, respectively, in the CEEs containing macroscopic lesions and alterations in the embryonic tissues. The embryo and yolk were collected separately. After maceration, the samples were placed into sterile 15 mL plastic tubes and stored at −20◦ C until use. Also after maceration, an aliquot of each sample (embryo and yolk) was collected in a microfuge tube containing 0.1 M PBS at pH 7.4. Surplus material was stored at −20◦ C. Samples collected in microfuge tubes were frozen at −20◦ C for 10 min, thawed at 56◦ C for 1 min, and then homogenized for 20 s; this procedure was repeated 3 times. The samples were then centrifuged at 12,000 × g for 20 min at 4◦ C for DNA viruses or at 12,000 × g for 30 min at 4◦ C for RNA viruses.

Nucleic Acid Extraction TRIzol reagent (Invitrogen Life Technologies, CA) was used according to the manufacturer’s instructions for the extraction of RNA and DNA from the samples and from negative (ultra-pure water) and positive controls.

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

set in the hatchery. The viral samples were inoculated in 2 groups. In the first group (Group 1), inoculations were performed in 7-day-old CEEs, when the formation and differentiation of the embryonic intestines begin (Senne, 1998); in the second group (Group 2), inoculations were performed in 14-day-old CEEs, when the intestines are more developed and functional (Moran, 2007; Karcher and Applegate, 2008). Embryonic viability was observed daily for 5 d postinoculation. Embryos that died within 24 h after inoculation were discarded because they were considered to have a nonspecific cause of death, possibly due to damage caused during inoculation or from bacterial contamination. After the first 24 h, dead eggs were taken out of the hatchery and maintained at 4◦ C until necropsy to avoid viral degradation. In our experience, storing eggs in a refrigerator does not change the morphological characteristics of the embryo. Eggs inoculated on the seventh or 14th d age that maintained their viability until the fifth d postinoculation were euthanized. For both eggs that died during incubation and those that were euthanized, necropsies were performed to examine the embryo and yolk. The head, wings, and legs were removed before the embryo was macerated and used for the next viral passage. In parallel, after maceration, an aliquot of each sample (embryo and yolk) was placed into a microfuge tube containing 0.1 M PBS at pH 7.4, homogenized, and submitted to 3 cycles of freezing and thawing. The remaining procedures for making the inocula are described above in the preceding section; thereafter, a 0.2 mL volume of each sample was inoculated into eggs for subsequent passages (Senne, 1998).

4

˜ NUNEZ ET AL.

Reverse Transcription Polymerase Chain Reaction The extracted RNA underwent reverse transcription to obtain cDNA that was specific for a gene fragment from each virus of interest. The reverse transcription reaction contained 3.5 μL extracted RNA and 6.5 μL reaction mix containing 2 μL 10× buffer, 1 μL 10 mM deoxynucleotide triphosphates, 1 μL dithiothreitol, 0.5 μL the Moloney murine leukemia virus, enzyme (Invitrogen Life Technology, CA) and 1 μL each of the forward and reverse primers. The extracted RNA (3.5 μL) was denatured at 94◦ C for 5 min before addition to the reaction mixture. The reverse transcription reaction was performed under the following conditions: 45◦ C for 60 min and 72◦ C for 10 min. The cDNA then underwent PCR.

The PCR reaction used 22.5 to 24 μL mixture that contained 0.5 pmol each of the forward and reverse primers, 2.5 μL 10X buffer, 4 μL 1.25 mM deoxynucleotide triphosphates, 0.75 to 2 μL 50 mM MgCl2 , 1 U platinum DNA polymerase (Invitrogen Life Technology, CA) and 1 to 2.5 μL cDNA. PCR was performed under the following conditions: 94◦ C for 3 min to completely denature the cDNA; 30 cycles denaturation at 94◦ C for 1 min, hybridization of primers at 50◦ C for 1 min, and extension at 72◦ C for 1 min; and a final incubation at 72◦ C for 10 min. The reaction was then maintained at 4◦ C for an unspecified period until being stored at −20◦ C. The RT–PCR and PCR amplifications were performed using similar protocols to those described previously, as listed in Table 1. The amplified products (362 bp for CAstV, 473 bp for ANV, 179 bp for IBV, 630 bp for avian rotavirus, 1,120 bp for avian reovirus, 561 bp for ChPV, 897 bp for FAdV-1, and 324 bp for NDV) were subjected to electrophoresis in a 1.5% agarose gel along with a 100 bp molecular ladder (Invitrogen). The samples were stained with Sybr Safe (Invitrogen) and analyzed with a transilluminator and camera made by Alpha Imager mini Analyses System (Alpha Innotech Corp., San Leandro, CA).

Negative Staining Transmission Electron Microscopy A suspension of each sample from both seven- and 14-day-old embryo homogenate preparations inoculated with CAstV, as described above, was clarified at 1,780 × g for 10 min. The harvested supernatant was then centrifuged at 100,000 × g for 90 min. The pellet was resuspended in 0.5 mL deionized water, 3 μL was mixed with 100 μL ammonium molybdate, and a 2 μL drop of this mixture was placed onto a 200 mesh formvarcoated grid for 5 min. Grids were examined by an elec-

RESULTS As is described in the materials and methods of the original samples analyzed previously by own team group (Mettifogo et al., 2014) only 14 were positives for CAstV and negative for the other enteric viruses tested.

Virus Isolation Virus isolation was confirmed by visualizing viral particles by EM, by the presence of gross lesions in the embryo, and by using PCR and RT–PCR. All samples were tested for CAstV, ChPV, ANV, IBV, FAdVI, avian rotavirus, avian reovirus, and NDV. Here, we isolated 8 samples of CAstV that were negative for isolation of ANV, ChPV, IBV, FAdV-I, NDV, rotavirus, and reovirus. CAstV was isolated and propagated in 7and 14-day-old chicken embryonated eggs. Significant lesions were observed after one passage in the 7-day-old embryos, but no lesions were observed in the 14-day-old embryos. Three CAstV samples were isolated and propagated in 7-day-old eggs, and 5 samples were isolated from 14-day-old eggs (Tables 2 and 3). All samples positive by molecular techniques that were submitted for negative staining EM showed viral particles, confirming the presence of CAstV in the samples, as shown in Figure 2 (a and b represent strain 358-2 isolated in 7- and 14-day-old CEE, respectively). Negative controls were negative for all viruses tested.

Strategy for Isolation, Culture, and Propagation of Enteric Viruses in SPF CEE For propagation in SPF CEE, samples potentially containing enteric viruses were inoculated using the yolk route, which is most commonly used for the propagation of enteric viruses. Viral strains of CAstV were isolated in Groups 1 and 2 SPF CEE. There was better isolation, culture, and propagation when the inoculum was prepared as described in the Materials and Methods section above. This strategy of isolation, culture, and viral propagation was used in both groups, and CAstV was isolated in the first passage. Testing suspensions for multiple viruses using molecular techniques to identify samples that are positive for only one virus is a strategy that can be used to isolate and propagate CAstV, especially for the isolation of pure strains (Table 2).

Macroscopic Characterization of Lesions Produced by CAstV in the CEE The embryos were sacrificed according to the ethical protocols approved by the committee on Care and Use of Laboratory Animal Resources of the School of Veterinary Medicine, University of Sao Paulo and then

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

PCR

tron microscope (Philips, Model EM 208, Amsterdam, Netherlands) to check for the presence of viral particles.

5

ISOLATION OF CHICKEN ASTROVIRUS Table 3. Clinical history and demographic information for chicken flocks presenting with diarrhea and RSS signs for which CAstV isolation was performed in SPF CEE.1 Individual clinical signs of the birds from which the samples come, and that were inoculated in SPF CEE

CAstV isolated in SPF CEE

Origin of the sample

Chicken ages

Location, Brazilian state

Diarrhea

Stunting

d7

d 14

242-62A 336-18 358-9E 354-6 359-1 359-2 359-3 358-22 361-1 361-2 362-1 362-5 371-3 388-1

Broilers Broilers Broilers Broilers Broiler breeders Broiler breeders Broiler breeders Broilers Broilers Broilers Broilers Broilers Broilers Broilers

5 wk 8d 8d 29 d 1d 1d 1d 8d 8d 8d 3d 14 d 22 d 8d

SP SP SP SC SC SC SC SC SP SP RS RS RS SC

No Yes Yes Yes No No No Yes Yes Yes No Yes No No

No Yes Yes Yes No No No No Yes Yes Yes Yes Yes Yes

NI I NI NI NI I NI I NI NI NI NI NI NI

NI I I NI NI I NI I NI NI NI I NI NI

1 I = Samples where CAstV was isolated in SPF CEE; NI = Not isolated from 7-day-old or 14-day-old CEEs; P = S˜ ao Paulo State; SC = Santa Catarina; RS = Rio Grande do Sul. 2 CAstV strain 358-2 was subjected to transmission electron microscopy.

Figure 1. A normal embryo (left) compared with hemorrhagic, edematous embryos with gelatinous aspects and dwarfism (right).

examined for lesions and macroscopic alterations. The embryos from Group 1 showed lesions and macroscopic alterations, including hemorrhages, edema, dwarfism, a gelatinous aspect, and deformities. Macroscopic lesions were evaluated qualitatively as the presence (positive) or absence (negative) of lesions. The embryos from Group 2 did not show any type of lesion or alteration. Figure 1 shows embryonic lesions from CEEs where CAstV was isolated, and Tables 2 and 3 provide viral isolation strategies, results of the differential diagnostic

testing for other enteric viruses, clinical signs, and embryo ages. In 3 passages, there was no mortality at any day postinoculation. The negative control embryos did not show any lesion or macroscopic alteration.

Standards for the Macroscopic Characterization of CAstV In the 3 first passages, the embryos were completely hemorrhagic and edematous with deformities, and to

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

Sample designations

˜ NUNEZ ET AL.

6

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

Figure 2. Transmission electron micrographs of CAstV particles in embryo homogenate preparations. Figures 2a and 2b show CAstV Strain 358-2 isolated from 7- and 14-day-old CEE, respectively. The bar = 280 nm.

a lesser extent, a gelatinous aspect. Dwarfism was evident, but curl was not observed. These results are depicted in Figure 1. There was no embryo mortality post inoculation in any passage where the virus was isolated. No lesions were found in the embryos inoculated at 14-days-old, which appeared normal, including normal thoracic and abdominal internal organs. There was no mortality.

DISCUSSION Enteric diseases in poultry generate considerate economic losses, and many enteric viruses are associated with them. Although enteric viruses in poultry have

been recognized for decades, there is still a lack of information about them. Viruses have been identified in chickens and turkeys that have enteric diseases in many countries, thus demonstrating their wide distribution (Pantin-Jackwood et al., 2007; Pantin-Jackwood et al., 2008; de Wit et al., 2011; Kang et al., 2012a; Koo et al., 2013). Astroviruses have been identified in turkeys (Silva et al., 2008; Moura-Alvarez et al., 2013) and chickens (Mettifogo et al., 2014) in Brazil, suggesting a possible relationship between astroviruses and enteric diseases in birds. Here, we described the isolation of CAstV from chickens with enteric problems in Brazil. Embryonic age is considered a determinant in the success or failure of viral isolation. Therefore,

7

ISOLATION OF CHICKEN ASTROVIRUS

was performed using molecular tests for specific gene sequences that have been previously described (Meulemans et al., 2001; Cavanagh et al., 2002; Day et al., 2007; Pantin-Jackwood et al., 2008; Zsak et al., 2009) and using negative staining transmission EM to visualize viral particles. PCR and RT–PCR was used to detect and confirm the isolation of CAstV and to exclude the presence of other viral agents such as ANV, reovirus, rotavirus, FAdV-I, IBV, and ChPV. There is little information about CAstV isolation from CEE, although the virus has been detected in commercial chicken flocks (Pantin-Jackwood et al., 2006, 2007; Guy, 1998; de Wit et al., 2011; Mettifogo et al., 2014). The results obtained here show the lesions that CAstV produces in embryos, which may contribute to our understanding of CAstV in the future and its relationship with the pathogenesis of enteric diseases. Here, the isolation of CAstV was possible. This successful isolation was obtained by using suspensions for molecular testing to identify samples that were positive only for CAstV. In at least 3 samples no virus was detected in any of the passages, which may be due to a low viral quantity in the samples, storage conditions of the samples, the total time of sample storage, difficulty in viral adaptation to the CEE, and/or problems in detecting other viruses (Senne, 1998). In our study, the CEE age (7- or 14-d age) chosen for inoculation provides an alternative method for the isolation and propagation of CAstV. Macroscopic characterization of the lesions caused by CAstV will help in its diagnosis and viral detection. While the embryonic lesions for other viruses are very similar and none provide a pathognomonic sign for the detection and confirmation of CAstV isolation, the presence of lesions, such as hemorrhages, edema, dwarfism, a gelatinous aspect, and deformities, should be suggestive of CAstV. To our knowledge, this study represents the first isolation of CAstV in SPF CEE from chickens with enteric disease in Brazil.

REFERENCES Asplin, F. 1965. Duck hepatitis: Vaccination against two serological types. Vet. Rec. 77:1529–1530. B´anyai, K., E. Dand´ ar, K. M. Dorsey, T. Mat´ o, and V. Palya. 2011. The genomic constellation of a novel avian orthoreovirus strain associated with runting-stunting syndrome in broilers. Virus Genes 42:82–89. Baxendale, W., and T. Mebatsion. 2004. The isolation and characterisation of astroviruses from chickens. Avian Pathol. 33:364–370. Cavanagh, D., K. Mawditt, D. B. Welchman, P. Britton, and R. E. Gough. 2002. Coronaviruses from pheasants (Phasianus colchicus) are genetically closely related to coronaviruses of domestic fowl (infectious bronchitis virus) and turkeys. Avian Pathol. 31:81–93. Day, J. M., E. Spackman, and M. Pantin-Jackwood. 2007. A multiplex RT-PCR test for the differential identification of turkey astrovirus type 1, turkey astrovirus type 2, chicken astrovirus, avian nephritis virus, and avian rotavirus. Avian Dis. 51: 681–684. De Benedictis, P., S. Schultz-Cherry, A. Burnham, and G. Cattoli. 2011. Astrovirus infections in humans and animals–Molecular biology, genetic diversity, and interspecies transmissions. Infect. Genet. Evol. 11:1529–1544.

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

7-day-old embryonated eggs were selected for inoculation as the optimal age for viral isolation using the yolk sac route (Senne, 1998). However, based on the enteric nature of CAstV and the stage of embryo development, yolk sac inoculation was also carried out in 14-day-old embryonated eggs, which may provide better isolation because the intestines would already be developed and functional (Moran, 2007; Karcher and Applegate, 2008). CAstV grew well in both seven- and 14-day-old CEE. The 7-day-old CEE were already described as an optimal age for isolation of enteric viruses (Senne, 1998). However, the inoculation of 14-day-old CEE may also be an optimal age for isolation of CAstV because at this age, the intestines of the embryo are more developed, and the intestinal cells likely possess more receptors for CAstV, thus enabling its replication and propagation without producing injuries in others tissues or organs of the embryo. Isolation of CAstV from fecal samples is very difficult because of the presence of other viruses, such as adenovirus, reovirus, or rotavirus, which also grow well in CEE (Guy, 2008). Here, we isolated CAstV from fecal samples, confirming that CAstV is circulating in Brazilian chicken flocks and maybe in Latin America poultry; however, there are no reports of CAstV in other countries on this part of the continent (Nu˜ nez and Ferreira, 2013). The samples of CAstV isolated here were inoculated by the yolk sac route, demonstrating that this route is effective for CAstV isolation. The use of the yolk sac as a route of infection and the enterotropic nature of CAstV may allow CAstV to directly enter the digestive organs of the embryo, particularly the intestine; thus, this procedure provides an optimal medium for CAstV culture, development, and propagation. The yolk has the function of nourishing the embryo, and thus is in direct contact with the embryo from a few h after fecundation (Nakazawa et al., 2006). There was no mortality in any of the 3 passages in either group, demonstrating that CAstV may not produce embryonic lethality, similar to what has previously been described for turkey astrovirus (Tang et al., 2006). Samples of CAstV were isolated in the first passage and remained in subsequent passages; CAstV isolation did not require blind passages, unlike for other viruses, such as IBV and reovirus, that require one or more blind passages before isolation (Guy, 2008; B´anyai et al., 2011; Saif, 2013). The embryos from which CAstV was isolated showed hemorrhages, edema, and dwarfism, similar to the alterations previously described for turkey astrovirus (Reynolds and SchultzCherry, 2008). These macroscopic characteristics indicated that CAstV reached the embryo and caused injuries in the embryo at 7 d age; however, the supporting membranes did not show any alterations. In addition to observing gross lesions in the embryo and supporting structures, viral isolation may be confirmed by molecular techniques. Here, viral detection

8

˜ NUNEZ ET AL. virus infection frequency according to age and clinical signs of intestinal disease. Poult. Sci. 92:945–955. Nakazawa, F., H. Nagai, M. Shin, and G. Sheng. 2006. Negative regulation of primitive hematopoiesis by the FGF signaling pathway. Blood. 108:3335–3343. Nu˜ nez, L. F., and A. J. Piantino Ferreira. 2013. Viral agents related to enteric disease in commercial chicken flocks, with special reference to Latin America. World’s Poult. Sci. J. 69:853–864. Olsen, D. E. 1977. Isolation of a reovirus-like agent from broiler chicks with diarrhea and stunting. Proc. West. Poult. Dis. Conf. 26:131–139. Pang, Y., H. Wang, T. Girshick, Z. Xie, and M. I. Khan. 2002. Development and application of a multiplex polymerase chain reaction for avian respiratory agents. Avian Dis. 46:691–699. Pantin-Jackwood, M. J., J. M. Day, M. W. Jackwood, and E. Spackman. 2008. Enteric viruses detected by molecular methods in commercial chicken and turkey flocks in the United States between 2005 and 2006. Avian Dis. 52:235–244. Pantin-Jackwood, M. J., E. Spackman, J. M. Day, and D. Rives. 2007. Periodic monitoring of commercial turkeys for enteric viruses indicates continuous presence of astrovirus and rotavirus on the farms. Avian Dis. 51:674–680. Pantin-Jackwood, M. J., E. Spackman, and P. R. Woolcock. 2006. Molecular characterization and typing of chicken and turkey astroviruses circulating in the United States: Implications for diagnostics. Avian Dis. 50:397–404. Pantin-Jackwood, M. J., K. O. Strother, E. Mundt, L. Zsak, J. M. Day, and E. Spackman. 2011. Molecular characterization of avian astroviruses. Arch. Virol. 156:235–244. Reynolds, D. L., and S. L. Schultz-Cherry. 2008. Astrovirus Infections. Pages 351–355 in Diseases of Poultry. Y. M. Saif, A. M. Fadly, J. R. Glisson, L. R. McDougald, L. K. Nolan, and D. E. Swayne, eds. Wiley, New York, NY. Saif, Y. M. 2013. Viral enteric infections. Pages 375–376 in Diseases of Poultry. D. E. Swayne, J. R. Glisson, L. R. McDougald, L. K. Nolan, D. L. Suarez, and V. Nair, eds. Wiley, New York, NY. Saif, L. J., Y. M. Saif, and K. W. Theil. 1985. Viruses in diarrheic turkey poults. Avian diseases. 23:798–811. Senne, D. A. 1998. Virus identification and classification. Pages 235– 240 in A Laboratory Manual for the Isolation and Identification of Avian Pathogens. D. E. Swayne, J. R. Glisson, J. E. Pearson, W. M. Reed, M. W. Jackwood, and P. Woolcock, eds. AAAP, Kennett Square, PA. Silva, S. E. L., A. M. Bonetti, A. T. M. Petrocelli, H. F. Ferrari, M. C. R. Luvizotto, and T. C. Cardoso. 2008. Detection of turkey astrovirus in young poults affected with poult enteritis complex in Brazil. J. Vet. Med. Sci. 70:629–631. Tang, Y., M. V. Murgia, L. Ward, and Y. M. Saif. 2006. Pathogenicity of turkey astroviruses in turkey embryos and poults. Avian Dis. 50:526–531. Zsak, L., K. O. Strother, J. M. Day, and A. K. O. Strother. 2009. Development of a polymerase chain reaction procedure for detection of chicken and turkey parvoviruses. Avian Dis. 53:83–88.

Downloaded from http://ps.oxfordjournals.org/ at University of Colorado on March 31, 2015

de Wit, J. J., G. B. Dam, J. M. Laar, Y. Biermann, I. Verstegen, F. Edens, and C. C. Schrier. 2011. Detection and characterization of a new astrovirus in chicken and turkeys with enteric and locomotion disorders. Avian Pathol. 40:453–461. Guy, J. S. 1998. Virus infections of the gastrointestinal tract of poultry. Poult. Sci. 77:1166–1175. Guy, J. S. 2008. Isolation and propagation of coronaviruses in embryonated eggs. Meth. Mol. Biol. 454:109–117. Imada, T., S. Yamaguchi, M. Mase, K. Tsukamoto, M. Kubo, and A. Morooka. 2000. Avian nephritis virus (ANV) as a new member of the family Astroviridae and construction of infectious ANV cDNA. J. Virol. 74:8487–8493. Jindal, N., D. P. Patnayak, A. F. Ziegler, A. Lago, and S. M. Goyal. 2009. Experimental reproduction of poult enteritis syndrome: Clinical findings, growth response, and microbiology. Poult. Sci. 88:949–958. Kang, K. I., M. El-Gazzar, H. S. Sellers, F. Dorea, S. M. Williams, T. Kim, S. Collett, and E. Mundt. 2012a. Investigation into the aetiology of runting and stunting syndrome in chickens. Avian Pathol. 41:41–50. Kang, K. I., A. H. Icard, E. Linnemann, H. S. Sellers, and E. Mundt. 2012b. Determination of the full length sequence of a chicken astrovirus suggests a different replication mechanism. Virus Genes. 44:45–50. Karcher, D. M., and T. Applegate. 2008. Survey of enterocyte morphology and tight junction formation in the small intestine of avian embryos. Poult. Sci. 87:339–350. Koci, M. D., and S. Schultz-Cherry. 2002. Avian astroviruses. Avian Pathol. 31:213–227. Koo, B. S., H. R. Lee, E. O. Jeon, M. S. Han, K. C. Min, S. B. Lee, and I. P. Mo. 2013. Molecular survey of enteric viruses in commercial chicken farms in Korea with a history of enteritis. Poult. Sci. 92:2876–2885. Kouwenhoven, B., M. Vertommen, and J. H. H. van Eck. 1978. Runting and leg weakness in broilers: Involvement of infectious factors. Vet. Sci. Commun. 2:253–259. Maondez, E., and C. A. Arias. 2007. Astroviruses. Pages 982–998 in Fields Virology. P. M. Knipe, and D. M. Howley eds. Lippincott, Williams, and Wilkins, Boston, MA. Mettifogo, E., L. F. Nu˜ nez, J. L. Chac´on, S. H. Santander Parra, C. S. Astolfi-Ferreira, J. A. Jerez, R. C. Jones, and A. J. Piantino Ferreira. 2014. Emergence of enteric viruses in production chickens is a concern for avian health. Sci. World J. ID 450423. doi:10.1155/2014/450423. Meulemans, G., M. Boschmans, V. D. Berg, and M. Decaesstecker. 2001. Polymerase chain reaction combined with restriction enzyme analysis for detection and differentiation of fowl adenoviruses. Avian Pathol. 30:655–660. Moran, E. T. 2007. Nutrition of the developing embryo and hatchling. Poult. Sci. 86:1043–1049. Moura-Alvarez, J., J. L. Chac´ on, L. Scanavini, L. F. Nu˜ nez, C. S. Astolfi-Ferreira, R. C. Jones, and A. J. Piantino Ferreira. 2013. Enteric viruses in Brazilian turkey flocks: Single and multiple