Isolation of detergent-resistant membranes (DRMs) from Escherichia coli

Analytical Biochemistry 518 (2017) 1e8

Contents lists available at ScienceDirect

Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio

Isolation of detergent-resistant membranes (DRMs) from Escherichia coli
E. Guzma
n-Flores a, Adria
n F. Alvarez a, Sebastia
n Poggio b, Marina Gavilanes-Ruiz c, Jose Dimitris Georgellis a, *
noma de M
Departamento de Gen
etica Molecular, Instituto de Fisiología Celular, Universidad Nacional Auto exico, M
exico City, Mexico
noma de M
Instituto de Investigaciones Biom
edicas, Universidad Nacional Auto exico, M
exico City, Mexico c
noma de M
Departamento de Bioquímica, Facultad de Química, Universidad Nacional Auto exico, M
exico City, Mexico a

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 May 2016 Received in revised form 16 September 2016 Accepted 26 October 2016 Available online 29 October 2016

Lipid rafts or membrane microdomains have been proposed to compartmentalize cellular processes by spatially organizing diverse molecules/proteins in eukaryotic cells. Such membrane microdomains were recently reported to also exist in a few bacterial species. In this work, we report the development of a procedure for membrane microdomain isolation from Escherichia coli plasma membranes as well as a method to purify the latter. The method here reported could easily be adapted to other gram-negative bacteria, wherein the isolation of this kind of sub-membrane preparation imposes special difficulties. The analysis of isolated membrane microdomains might provide important information on the nature and function of these bacterial structures and permit their comparison with the ones of eukaryotic cells. © 2016 Elsevier Inc. All rights reserved.

Keywords: Membrane microdomains Gram-negative bacteria SPFH-domain

1. Introduction The composition of bacterial membranes differs significantly from the ones of eukaryotic cells. While some lipid species, mainly glycerolipids, are shared there are specific lipid components for eukaryotic and prokaryotic membranes [1,2]. A notable difference is the lack of endogenous sphingolipids and cholesterol as lipidbilayer components in the vast majority of most bacterial cells [3e6]. Interestingly, both these types of lipids are essential components in liquid-ordered lipid clusters known as lipid rafts or membrane microdomains in eukaryotic cells [7,8]. One of the most important properties of these membrane structures has been proposed to be their ability to include or exclude proteins to variable extent, thereby spatially organizing proteins and promoting kinetically favorable interactions [9]. Interestingly, recent reports have described the presence of lipid raft-like structures in Bacillus subtilis, Staphylococcus aureus and Borrelia burgdorferi [10e12]. A trait of eukaryotic lipid rafts is that among their most consistent components is a group of proteins containing the stomatin/prohibitin/flotillin/HflK/C (SPFH) domain, and therefore are

* Corresponding author. Instituto de Fisiología Celular, Universidad Nacional
noma de Me
xico, 04510 Me
xico City, Mexico. Auto E-mail address: [email protected] (D. Georgellis). http://dx.doi.org/10.1016/j.ab.2016.10.025 0003-2697/© 2016 Elsevier Inc. All rights reserved.

used as bona fide markers of lipid rafts [12,13]. Interestingly, these SPFH domain-containing proteins that appear to be implicated in the orchestration of diverse processes related to lipid raft formation, signal transduction, vesicle trafficking, cytoskeleton rearrangement, and ion channel regulation [13e16] are found not only in eukaryotes but are also widely distributed in prokaryotes. As is the case of eukaryotic lipid rafts, bacterial SPFH domain-containing proteins were also found to be associated to membrane microdomains [12]. Despite this, their functions remain poorly understood in bacteria, although they appear to be involved in stress responses such as high-salt and antibiotic treatment and processes such as sporulation and biofilm formation in Bacillus subtilis [12,17e19], and also in the transmission cycle of Borrelia burgdorferi spirochetes [10]. Another characteristic of the membrane microdomains is that their components can be resistant to the solubilization by non-ionic detergents at low temperatures. Therefore the study of lipid rafts has been pursued by the analysis of detergent-resistant membranes (DRM). Although, the same principles apply for DRM isolation from membranes from a variety of organisms and cells types, there are important differences between each procedure [20e23]. For instance, DRM isolation from MDCK cells requires a much lower concentration of detergent as compared to DRM isolation from Nicotiana tabacum cells [24,25]. At any rate, even though there are various protocols for DRM isolation from eukaryotic membranes,

2


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

there are no protocols for DRM isolation from gram-negative bacteria. Here, we report a detailed procedure aiming at the isolation of DRMs from Escherichia coli. Our method, which could be adapted to any gram-negative bacteria, enabled the enrichment of HflC, an E. coli SPFH-domain containing protein, in isolated DRM fractions, and transmission electron micrographs showed that our DRM preparations are similar to the typical ones isolated from eukaryotic organisms. The herein described method could facilitate the study of membrane microdomains from gram-negative bacteria, and it might provide important insights in respect to the bacterial membrane/protein organization. Finally, it will permit the comparison of DRMs isolated from bacterial cells with the ones of eukaryotic cells. 2. Materials and methods 2.1. Materials Lysogeny broth (LB), Ampicillin, Sucrose, Trizma, EDTA, NaCl, MgSO4, lysozyme, and DNase were obtained from Sigma Aldrich (St. Louis, MO, USA). Silver nitrate, formalin and sodium thiosulfate were obtained from J.T. Baker. Triton X-100 was obtained from Pierce (Rockford, IL, USA). OptiPrep solution was obtained from AxiseShield (Oslo, Norway). Hybond-ECL filter and Immobilon Western detection system were obtained from Amersham Biosciences and Millipore, respectively. 2.2. Strains and culture conditions To construct strains IFC5018 (MG1655, ompC::ha-Cmr) and IFC5019 (MG1655, hflC::ha-Cmr), the ompC and hflC genes were end-tagged with a hemaglutinine (HA) epitope by homologous recombination using the lambda Red recombinase system [26,27]. Briefly, PCR amplified fragments, using primers ompC-HA-Fw (50 CACTGATAACATCGTAGCTCTGGGTCTGGTTTACCAGTTCTATCCGTA TGATGTTCCT-30 ) and pKD-ompC-Rv (50 -AAAAAGGGCCCGCAGG CCCTTTGTTCGATATCAATCGAGAGAATATCCTCCTTAGTTC-30 ), or hflC-HA-Fw (50 -TTTCTTCCGCTACATGAAGACGCCGACTTCCGCAACGC GTTATCCGTATGATGTTCCTG-30 ) and pKD-hflC-Rv (50 -AGGATGCG GTGGCTTTATTGACCTGTACCGCAGTCGTTATAATGAATATCCTCCTTAG TTC-30 ), and plasmid pSU314 [27] as template, were transformed in pKD46 [26] carrying cells of E. coli K12 MG1655, and recombinants were selected by growth in chloramphenicol-agar plates. Similarly, strain IFC5020 (MG1655, hflC::mCherry-Kanr) was generated by recombination of a PCR product obtained using primers pFluorhflC-Fw (50 -TTTCTTCCGCTACATGAAGACGCCGACT TCCGCAACGCGTATGGTGAGCAAGGGCGAG-30 ) and pKD-hflC-Rv, and plasmid pMXFL1 as template. To construct plasmid pMXFL1, mCherry and Kan resistance coding sequences were PCR amplified using primers Yfp-Fw-Eco (50 - CGGAATTCATGGTGAGCAAGGGCGAGGAG-30 ) and Yfcr-HindIII (50 - CAAAAGCTTCTTACTTGTACAGCTCGTCCATGC-30 ) and plasmid pCHYC-4 [28] as template; and pKD-KpnHind-Fw (50 GGGGTACCAAGCTTGTGTAGGCTGGAGCTGCTTC-30 ) and pKD-Eco-Rv (50 - CGGAATTCATATGAATATCCTCCTTAGTTC-30 ) with plasmid pKD4 [26] as template, respectively. The two amplified DNA fragments were digested by HindIII and ligated, and the product was used a template in PCR reaction with primers Yfp-Fw-Eco and pKD-Eco-Rv. Finally, purified PCR product was digested with EcoRI and cloned into the same restriction site of pSU311 [27], resulting in plasmid pMXFL1. E. coli (strain MG1655 and derivatives) cells were routinely cultured at 37  C in LB medium, whereas Vibrio alginolyticus cells were grown at 37  C in LB medium supplemented with 3% (w/v) of NaCl. Media were supplemented with antibiotics at the following

concentrations: chloramphenicol, 25 mg/ml; ampicillin, 100 mg/ml; kanamycin, 50 mg/ml.

2.3. Inner membrane isolation To generate spheroplasts we used a modified version of the method described by Renner & Weibel [29]. Briefly, 1 L of fresh LB medium was inoculated with 10 ml of an overnight culture and incubated at 37  C and 220 rpm. At an OD600 of 0.4, ampicillin was added to a final concentration of 10 mg/ml and the culture was incubated for 3 h at the same conditions. At that point E. coli cells were converted to filaments that were harvested by centrifugation (15 min at 1500g), and resuspended in 10 ml of buffer A (1 M sucrose, 0.2 M Tris-HCl [pH 8.0]). Subsequently, EDTA and lysozyme were added at final concentrations of 2 mM and 12.5 mg/ml, respectively, gently mixed by inverting ~6 times and incubated on ice. After 10 min, 90 ml of sterile water supplemented with DNase (12 mg/ml) were added and gently mixed by inverting ~15 times. Spheroplasts formation was confirmed by phase-contrast microscopy, and they were collected by centrifugation at 1200g for 30 min at 4  C. Then, the spheroplasts were resuspended in 10 ml of ice-cold buffer B (20 mM Tris-HCl [pH 7.2], 50 mM NaCl, 5 mM EDTA) containing 20% w/w sucrose, and they were passed through a French pressure cell at 20,000 psi. The lysate was clarified of cell debris by centrifugation at 10,000g for 30 min at 4  C, and 5 ml samples of the supernatant were placed on top of discontinuous sucrose gradients with the following composition: bottom to top 10 ml at 50%, 5 ml at 46%, 10 ml at 42%, 10 ml at 36%, 5 ml at 32% and 10 ml at 27% (all w/w). All sucrose solutions were prepared in buffer B. The gradients were centrifuged at 38,000 rpm (~113,000g) for 12 h at 4  C in a 45Ti rotor. Subsequently, 1.5 ml aliquots were collected from top to bottom, the pellet was resuspended in 1.5 ml of buffer B, and the inner membrane (IM)-containing fractions were identified by Western blot analysis, as described below. Finally, the IM-containing fractions were diluted with ice-cold buffer B, in order to lower the sucrose concentration to 10% (w/w), and centrifuged at ~113,000g for 1 h at 4  C. The pellet, containing the IMs, was stored at 20  C. 4.4 ± 0.3 mg of IM total protein/L of cell culture was recovered.

2.4. DRM isolation The frozen IM-containing pellets were thawed on ice and resuspended in ice-cold TNE solution (50 mM Tris-HCl buffer [pH 7.4], 150 mM NaCl, 5 mM EDTA). 500 mg of protein was mixed with ice-cold Triton X-100 resulting in a final detergent concentration of 1% w/v and in detergent:protein ratios of 6:1, 7:1, 8:1, 9:1, 10:1 or 11:1, gently mixed for 10 s, and incubated for 30 min on ice. Subsequently, ice-cold solution of Optiprep was added to a final concentration 40% (w/v), and gently mixed for 10 s. This suspension was carefully overlaid with 6.1 ml of a 30% (w/v) Optiprep solution (diluted in ice-cold TXNE buffer [TNE buffer supplemented with 0.1% Triton X-100 w/v]), resulting into two phases. Finally, 1.5 ml of ice-cold TXNE buffer was overlaid forming a third phase. The gradients were centrifuged at 37,000 rpm (~173,000g) for 6 h at 4  C in a SW 40Ti rotor, and 1 ml fractions were collected from the top to the bottom of each gradient, and stored at 4  C. The HflC containing fractions were identified by Western blot analysis using HflC::HA antibodies, and DRMs (a yield of 145 ± 14 mg of total protein/mg of inner membrane total protein was obtained at the 8:1 Triton X100:protein ratio) were concentrated by ultracentrifugation at 42,000 rpm (~106,000g) for 1 h at 4  C, and stored at 80  C.


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

3

Fig. 1. Steps in spheroplast conversion of E. coli. Phase-contrast images of (A) E. coli cells growing at mid-log phase (OD600 ¼ 0.4), (B) filamented cells formed 3 h after ampicillin addition to the culture media; and (C) giant spheroplasts formed after treatment of the filamented cells with EDTA/Lysozyme and subjected to osmotic shock.

Monoclonal antibodies against the HA epitope (Sigma Aldrich), serving for the OmpC-HA and HflC-HA, or DnaK (Enzo Life Sciences), or polyclonal antibodies against ArcB [30], were used at a dilution of 1:10,000 to the filter and incubated for 1 h at room temperature. The bound antibody was detected by using antimouse IgG antibody or anti-rabbit IgG antibody conjugated to horseradish peroxidase (1:10,000 dilution) and the Immobilon Western detection system (Millipore).

A

top

B

27-50% (w/w) sucrose gradient

bottom 50

30

% sucrose (w/w)

2.6. Fluorescence microscopy 40

10

30

OD280

20

20

0 0

10

C

20

Fraction number

30

69kD

DnaK

88kD

ArcB OpmC::HA

41kD wt C(-) F3 F6 F9 F12 F15 F18 F21 F24 F27 F30 F33 P

Fig. 2. Isolation of E. coli inner membrane. (A) Total spheroplast extracts were fractionated on a discontinuous sucrose gradient. (B) Total protein (solid line) and sucrose percentage (dotted line) in the collected fractions are indicated. (C) Equal volume of representative fractions were analyzed by Western blot analysis using specific antibodies against DnaK (a cytoplasmic protein), ArcB (an inner membrane protein), and OmpC-HA (an outer membrane protein) as described in Materials and Methods section. Extracts from a wild type strain (wt) and a dnaK or arcB mutant (D), used as positive and negative controls, respectively, are shown in the first and second lane of the gel. F1 to F33 represent the fractions collected from top to bottom of the gradient.

2.5. Immunoblotting Equal volumes (10 ml) of representative fractions of gradients were separated by SDS-PAGE (12% polyacrylamide gel), and the proteins were transferred to a Hybond-ECL filter (Amersham Biosciences). The filter was equilibrated in TTBS buffer (25 mM Tris, 150 mM NaCl, and 0.1% Tween-20) for 10 min and incubated in blocking buffer (5% w/v milk in TTBS) for 1 h at room temperature.

Fluorescence microscopy images were taken from a Nikon E600 microscope and a Hamamatsu ORCA-ER camera. Images were then processed with identical settings and processed in the same way with ImageJ [31]. HflC-mcherry cells were immobilized on a glass slide covered with an agarose-pad slide containing 0.1 M sucrose to prevent osmotic shock of spheroplast cells. 2.7. Electron microscopy IMs and DRMs were prepared for electron microscopy as reported previously [20]. Briefly, the IM and DRM samples were ultracentrifuged and pellets were fixed with 1 ml of glutaraldehyde 2.5% (v/v) in 100 mM phosphate buffer (pH 7.0) and washed with the same buffer 4e5 times. Pellets were post-fixed with osmium tetroxide (1%) for 2 h at 4  C and washed with phosphate buffer 4e5 times. Subsequently, samples were dehydrated with successive wash steps using ethanol (30e100% v/v), and finally with propylene oxide. Finally, the samples were embedded in Propylene oxideEpon (1:1) for 48 h at 60  C. Ultrathin sections of 70e80 nm (Reichert Jung) were observed with an electron microscope (JEOL 1200-EXII) operated at 60e80 kV. 2.8. Silver staining of proteins in polyacrylamide gels For silver staining we used the method described by Mortz et al. [32] with some minor modifications. Briefly, 5 mg of total protein of inner membrane and DRMs were resolved in a 10% polyacrylamide gel, fixed overnight (50% MeOH, 12% HAc, 0.05% formalin), washed three times in 35% EtOH/water for 20 min, sensitized 5 min (0.02% sodium thiosulfate), and washed with distilled water for 30 s. Then, the gel was stained for 20 min (0.2% silver nitrate, 0.076% formalin), washed one time with water for 30 s, developed for 1e5 min (6% sodium carbonate, 0.05% formalin, 0.0004% sodium thiosulfate) and the developing reaction was stopped by 5 min incubation in a

4


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

Fig. 3. Sub-cellular localization of HflC-mcherry. Phase contrast microscopy, fluorescence microscopy and merge of untreated cells (A), filamented cells (B) and giant spheroplasts (C).

solution containing 50% MeOH and 12% HAc. 3. Results and discussion 3.1. Spheroplast generation and separation of inner membranes from outer membranes and cytosolic proteins Gram-negative bacteria such as Escherichia coli are surrounded by a lipopolysaccharide containing outer membrane (OM), a thin peptidoglycan cell wall, and a cytoplasmic phospholipid bilayer or inner membrane (IM). The OM of E. coli (and other Gram-negative bacteria) is a bilayer with phospholipids in the inner leaflet and lipopolysaccharides in the outer one. This composition confers to OM natural resistance to solubilization by bile salts, a property that enables them to survive in the mammalian gut, or detergents, such as Triton X-100 [33] that is usually employed for DRM preparations. Therefore, the use of OM-free IMs emerges as a prerequisite if pure E. coli DRMs are to be obtained. To this end, we took advantage of the facts that EDTA and lysozyme treatment of E. coli cells generates spheroplasts (cells devoid of peptidoglycan wall) [34], and that better separation of inner and outer membranes is achieved in density gradients when spheroplast extracts than crude extracts are used [33,35,36]. However, the EDTA-lysozyme treatment at concentrations reported previously [34] led to the conversion of

less than 50% of the cells to spheroplasts (data no shown). In an effort to improve the spheroplast conversion rate, we used increasing concentrations of lysozyme. However, this treatment led to the generation of “ghost cells” (empty bacterial cell envelopes) rather than improving spheroplast-conversion yield (data not shown). Then, an attempt to produce giant spheroplasts from filamentous cells was done [29]. To this end, cells (Fig. 1 A) were first treated with a sub-lethal concentration of ampicillin to generate filamented cells, having more than 4 normal cell-unit lengths (Fig. 1 B), followed by digestion of the cell wall by lysozyme that led to the conversion of cells to spheroplasts (Fig. 1 C). This procedure, which left unaffected the integrity of the lipid membranes as no generation of ghost cells was observed, enabled the complete transformation of cells to spheroplasts (Fig. 1 C). Spheroplasts were then passed through a French pressure cell, and the lysate was cleared by centrifugation. Although sonication has also been used to disrupt cells in order to obtain membrane vesicles without any notable differences from the use of French press [37], the latter is preferred because it eliminates the risk of unnecessary protein warming. In order to separate IM vesicles from soluble proteins and OM vesicles, the cleared supernatant was layered on a discontinuous sucrose gradient (50e27% w/w of sucrose), as described in the materials and methods section. After ultracentrifugation, two visible bands and a pellet were observed


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

A

F1 F2 . . . F10

6:1

Total protein (μg/ml)

B

7:1 8:1 9:1 10:1 11:1 detergent/protein ratios

200

6:1 7:1 8:1 9:1 10:1 11:1

150 100 50

0

2

4

6

Fraction number

8

10

C

In eukaryotes, SPFH-domain containing proteins have been shown to be associated with DRMs, and, therefore, they are used as positive markers [13]. Because of their localization on restricted sites on the membrane, fluorescent hybrids of these proteins appear as discrete foci. We therefore argued that if membrane microdomain integrity were to be affected by the transformation of E. coli cells to giant spheroplasts, localization of HflC, a SPFHdomain containing protein of E. coli, should also be affected. To test this possibility, HflC was fused to mCherry, and the localization of the chromosomal hybrid protein was detected by epifluorescence microscopy in normal cells, filamented cells, and giant spheroplasts. It was observed that HflC-mCherry was localized on discrete foci on the poles of the normal cells (Fig. 3A). However, in addition to the polar localization of HflC-mCherry other foci appeared in the filamentous cells (Fig. 3B). Finally, these foci of fluorescence were also present on the giant spheroplasts (Fig. 3C). Thus, membrane microdomain integrity appears to remain intact during ampicillin/lysozyme treatment and spheroplast generation.

7:1

Model membranes and in vivo studies have confirmed the association of cholesterol and sphingolipids in liquid-ordered phases [40,41]. The fact that these components can be extracted by nonionic detergents, such as Triton X-100 in the so-called detergent resistant membrane (DRM) fractions [42e44], has provided DRM isolation as an important tool for the biochemical characterization of these liquid-ordered lipid clusters. In this respect, it is important to mention that a critical step for the isolation of DRMs is the selection of the appropriate detergent/protein ratio, which must be adapted for each particular case, because it is extremely variable depending on the origin/nature of the membrane [45]. For instance, an optimal detergent/protein ratio of 15:1 was reported for preparation of DRMs from Nicotiana tabacum leaves [25], whereas a ratio of 8:1 was used for similar preparations from Arabidopsis thaliana leaves [21]. Moreover, a 12.5:1 ratio (w/w) was reported as the optimal condition for DRM preparations from plasma membranes from Phaseolus vulgaris, Nicotiana tabacum leaves, and germinating Zea mays embryos [20]. Finally, DRMs from bovine neutrophils have been recovered at ratios between 5:1 and 10:1 [46], whereas a 3:1 ratio was sufficient for DRM isolation from epithelial cells (MDCK cells) [24]. Thus far, no studies on isolation of DRMs from gram-negative bacteria have been reported. It is noteworthy to mention that the available studies reported so far on the existence of lipid microdomains in bacteria have been based on the use of a commercial kit that was designed to isolate DRM from eukaryotic cells and that uses one standard Triton X-100 concentration (8e10). Given the importance of using specific conditions to obtain DRM fractions, we considered necessary to look for the optimal detergent/protein ratio for isolation of DRMs from E. coli inner membranes. Therefore, the isolated IMs from strain IFC5019, which carries a HflC-HA, were incubated at various Triton X-100/protein ratios at 4  C for 30 min. The treated IMs were separated by ultracentrifugation in an Optiprep gradient. A visible opaque band, whose intensity declines as the ratio of Triton X-100/protein increases, was observed on the upper part of the gradient (Fig. 4A). This band is indicative of

10:1 11:1 6 7

3.2. Membrane-microdomain integrity appears unaffected by the filamentation and spheroplast generation process

3.3. Isolation of DRMs from E. coli inner membrane

9:1

5

proteomic and lipidomic studies are to be pursued. To our knowledge, the studies performed thus far employed whole cell extracts [38,39], and therefore specific allocation of components to the inner or outer membrane is not possible.

6:1 8:1

1 2 3 4

5

8 9 10

Fig. 4. Isolation of Detergent-Resistant Membranes. Isolated E. coli inner membranes were treated with different Triton X-100/protein ratios and (A) DRMs were isolated by flotation using an Optiprep gradient. DRMs in the Optiprep gradient are visible as an opaque band and indicated by an arrow. (B) Total amount of protein in the various fractions is presented. Values represent the average of four independent experiments. (C) Equal volume of the collected fractions were analyzed by Western blot analysis using specific antibodies against HflC-HA as described in Materials and Methods section. F1 to F11 represent the fraction collected from top to bottom of the gradient.

(Fig. 2A) in the gradient, indicating the fractions of enriched cellular components. The gradient was then fractionated in 1.5 ml aliquots and the protein content and percentage of sucrose in each fraction were measured (Fig. 2B). Finally, the fractions were analyzed by Western blot analysis using specific antibodies against ArcB, DnaK, and OmpC-HA, serving as protein markers for IM, soluble protein, and OM, respectively (Fig. 2C). It was found that an efficient separation was achieved as the IMs were enriched in fractions 21 to 30 (from top to bottom) whereas the soluble proteins and the OMs were located in fractions 3 to 18 and in the pellet, respectively. It has to be mentioned that several variations of the above gradient were tested, but the one here described resulted in the best separation of IMs from OMs and soluble proteins. Fractions 21 to 30, containing IM vesicles, were pooled together and collected by ultracentrifugation. The pellet was stored for subsequent DRM purification steps. It is important to notice that the availability of pure bacterial inner membranes is of the outmost relevance, especially when

6


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

Fig. 5. Visualization of IMs and DRMs from E. coli by transmission electron microscopy (TEM). (i) Inner membranes. DRMs prepared at Triton X-100/protein ratios (ii) 6:1 (iii) 7:1, (iv) 8:1 and (v) 9:1 and (vi) 11:1. Arrows indicate the fiber-like structures.

Fig. 6. Protein profile and ultrastructure of isolated DRM samples. (A) 5 mg of inner membrane (IM), purified DRMs, or DRMs stored for two months (DRM*) were separated on 10% polyacrylamide gels and visualized by silver staining. SM indicates the size marker. (B) Electron microcopy of stored DRMs.

membrane clusters or DRMs that, because of their low density, are able to float on density gradients [47]. Subsequently, ten fractions (F1eF10 from top to bottom) were collected, and the protein content in each of them was measured. It was noted that the total protein content of the top fractions (F1 and F2) decreases whereas the one of the bottom fractions increases with increasing Triton X-

100/protein ratio (Fig. 4B). This is to be expected because the higher Triton X-100 concentration results in a more effective solubilization of the IMs and liberation of the lipid embedded proteins, which because of their high density are unable to float and remain in the bottom fractions of the gradient. Subsequently, the above collected fractions were probed for their content in the SPFH-domain containing protein HflC that is expected to be associated with DRMs and therefore used as positive marker. Western blot analysis using 10 ml of each fraction and HA specific antibodies revealed that treatment with Triton X-100/protein ratios up to 8:1 resulted in that most of the HflC-HA protein migrated to the top fraction (F2) of the gradient (Fig. 4C), corresponding to a specific density of 1.163 g ml1 (that is the interface between TXNE and 30% Optiprep). As expected, fraction F2 matched precisely to the aforementioned opaque band (Fig. 4), which was also found to coincide with a peak of total protein (Fig. 4B). On the other hand, treatment with a Triton X-100/protein ratio of 9:1 resulted in that almost half of HflC was in fraction F2 while the rest was found in fractions F7eF10, at the bottom of the gradient (Fig. 4). Finally, when the Triton X-100/ protein ratios 10:1 and 11:1 were used, the entire amount of HflC was in the F7eF10 bottom fractions of the gradient (Fig. 4). Therefore, we propose that the 8:1 Triton X-100/protein ratio should be chosen as the optimal one for DRM isolation from IMs of E. coli. The obtained DRMs were, then, inspected by transmission electron microscopy (Fig. 5). The ultrastructural images revealed the presence of membrane vesicles of variable diameter at Triton X-


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma

A

7

D i

ii

10 μm

iii

10 μm

10 μm

4:1

6:1

8:1

10:1

12:1

B E

top

27-50% (w/w) sucrose gradient

bottom

30

50

20

40

10

30

% sucrose (w/w)

OD280

C

Total protein (μg)

200

4:1 6:1 8:1 10:1 12:1

150 100 50

0

2

4

6

Fraction number

8

10

20

0 0

10

20

Fraction number

30

Fig. 7. DRM isolation from V. alginolyticus. (A) Steps in spheroplast conversion of V. alginolyticus. Phase-contrast images of (i) V. alginolyticus cells growing at mid-log phase, (ii) filamented cells formed 3 h after ampicillin addition to the culture media; and (iii) giant spheroplasts formed after treatment of the filamented cells with EDTA/Lysozyme and subjected to osmotic shock. (B) Total spheroplast extracts were fractionated on a discontinuous sucrose gradient. Circle indicates the position of inner membranes in the gradient. (C) Total protein (solid line) and sucrose percentage (dotted line) in the collected fractions are indicated. (D) Treatment of IMs with various Triton X-100/protein ratios and isolation of DRMs by flotation using an Optiprep gradient. DRMs in the Optiprep gradient are visible as an opaque band and indicated by an arrow. (B) Total amount of protein in the various fractions is presented.

100/protein ratios up to 6:1. On the other hand, a fiber-like structure with different lengths appears in the DRMs prepared at detergent/protein ratios of 7:1, 8:1 and 9:1. It is worth noting that such structures have been previously observed in eukaryotic DRMs [20,25,48,49]. The amount of these fiber-like structures decrease at ratios higher that 9:1 (data not shown) and completely disappear at a ratio 11:1 (Fig. 5), where no evident lipid structures are observed, suggesting that the IMs are completely solubilized. The protein content of the isolated DRM fractions, generated at 8:1 Triton X-100/protein ratio, was scrutinized by SDS-PAGE and silver staining (Fig. 6A). It was observed that while the majority of IM proteins were not present in the DRM fraction, various proteins were enriched in this fraction. Finally, our DRM preparations, which were precipitated and stored at 80  C, appear to be quite stable, as judged by their ultrastructure (Fig. 6B) and by their electrophoretic profiling of total proteins (Fig. 6A) that showed no significant changes in a period of approximately two months. No longer times were tested.

4. Conclusions Membrane microdomains or lipid rafts have been extensively studied in eukaryotic model systems, but the existence of such lipid structures in bacteria was only recently reported. The fact that the lipid composition of eukaryotic and bacterial membranes differs significantly raises the question of whether these lipid structures have common properties and functions. Therefore the biochemical analysis of the bacterial membrane microdomains, which will enable their comparison with DRMs from eukaryotic cells, is of chief interest. Although some studies have begun to isolate and investigate the composition of bacterial DRMs, there are no reports from the model bacterium E. coli or other gram-negative bacteria. The herein described procedure will allow the analysis of both lipid and protein composition of the lipid raft-like microdomains of Gram-negative bacteria and facilitate the comparison of these bacterial structures with the ones of eukaryotic cells. Acknowledgments

3.4. DRM isolation from inner membrane of V. alginolyticus To test whether our method could be useful for the isolation and characterization of DRMs from other gram-negative bacteria, we attempted to implement it on Vibrio alginolyticus. Using the abovedescribed protocols, it was found that V. alginolyticus behaved similarly to E. coli in terms of giant spheroplast generation (Fig. 7A), inner membrane separation on sucrose gradients (Fig. 7B and C), treatment with increasing amounts of Triton X100, and separation of DRMs on Optiprep gradients (Fig. 7D and E). It, thus, appears that the herein described procedure could also contribute to the study of membrane microdomains from other gram-negative bacteria.

We thank Claudia Rodríguez and Rodolfo Paredes for technical assistance. This work was partially supported by grants 178033 and 238368 from the Consejo Nacional de Ciencia y Tecnología (CONACyT), IN206412, IN222815 and IA203216 from DGAPA, UNAM. References [1] G. van Meer, D.R. Voelker, G.W. Feigenson, Membrane lipids: where they are and how they behave, Nat. Rev. Mol. Cell Biol. 9 (2008) 112e124, http:// dx.doi.org/10.1038/nrm2330. [2] C. Sohlenkamp, O. Geiger, Bacterial membrane lipids: diversity in structures and pathways, FEMS Microbiol. Rev. 40 (2016) 133e159, http://dx.doi.org/ 10.1093/femsre/fuv008. [3] L.J. Heung, C. Luberto, M. Del Poeta, Role of sphingolipids in microbial

8

[4]

[5]

[6] [7]

[8] [9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]


n-Flores et al. / Analytical Biochemistry 518 (2017) 1e8 J.E. Guzma pathogenesis, Infect. Immun. 74 (2006) 28e39, http://dx.doi.org/10.1128/ IAI.74.1.28-39.2006. D. An, C. Na, J. Bielawski, Y.A. Hannun, D.L. Kasper, Membrane sphingolipids as essential molecular signals for Bacteroides survival in the intestine, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 4666e4671, http://dx.doi.org/10.1073/ pnas.1001501107. J.T. Hannich, K. Umebayashi, H. Riezman, Distribution and functions of sterols and sphingolipids, Cold Spring Harb. Perspect. Biol. 3 (2011) a004762, http:// dx.doi.org/10.1101/cshperspect.a004762. C. Goodman, Sphingolipids: microbes talk to T cells, Nat. Chem. Biol. 9 (2013), http://dx.doi.org/10.1038/nchembio.1328, 529e529. J.R. Silvius, Role of cholesterol in lipid raft formation: lessons from lipid model systems, Biochim. Biophys. Acta 1610 (2003) 174e183, http://dx.doi.org/ 10.1016/S0005-2736(03)00016-6. D. Lingwood, K. Simons, Lipid rafts as a membrane-organizing principle, Science 327 (2010) 46e50, http://dx.doi.org/10.1126/science.1174621. J.A. Allen, R.A. Halverson-Tamboli, M.M. Rasenick, Lipid raft microdomains and neurotransmitter signalling, Nat. Rev. Neurosci. 8 (2007) 128e140, http:// dx.doi.org/10.1038/nrn2059. T.J. LaRocca, J.T. Crowley, B.J. Cusack, P. Pathak, J. Benach, E. London, et al., Cholesterol lipids of Borrelia burgdorferi form lipid rafts and are required for the bactericidal activity of a complement-independent antibody, Cell Host Microb. 8 (2010) 331e342, http://dx.doi.org/10.1016/j.chom.2010.09.001. T.J. LaRocca, P. Pathak, S. Chiantia, A. Toledo, J.R. Silvius, J.L. Benach, et al., Proving lipid rafts exist: membrane domains in the prokaryote Borrelia burgdorferi have the same properties as eukaryotic lipid rafts, PLoS Pathog. 9 (2013) e1003353, http://dx.doi.org/10.1371/journal.ppat.1003353.
pez, R. Kolter, Functional microdomains in bacterial membranes, Genes D. Lo Dev. 24 (2010) 1893e1902, http://dx.doi.org/10.1101/gad.1945010. D.T. Browman, M.B. Hoegg, S.M. Robbins, The SPFH domain-containing proteins: more than lipid raft markers, Trends Cell Biol. 17 (2007) 394e402, http://dx.doi.org/10.1016/j.tcb.2007.06.005. M.F. Langhorst, A. Reuter, C.A.O. Stuermer, Scaffolding microdomains and beyond: the function of reggie/flotillin proteins, Cell. Mol. Life Sci. 62 (2005) 2228e2240, http://dx.doi.org/10.1007/s00018-005-5166-4. I.C. Morrow, R.G. Parton, Flotillins and the PHB domain protein family: rafts, worms and anaesthetics, Traffic 6 (2005) 725e740, http://dx.doi.org/10.1111/ j.1600-0854.2005.00318.x. N. Kato, M. Nakanishi, N. Hirashima, Flotillin-1 regulates IgE receptormediated signaling in rat basophilic leukemia (RBL-2H3) cells, J. Immunol. 177 (2006) 147e154, http://dx.doi.org/10.4049/jimmunol.177.1.147. B.G. Butcher, J.D. Helmann, Identification of Bacillus subtilis sigma-dependent genes that provide intrinsic resistance to antimicrobial compounds produced by Bacilli, Mol. Microbiol. 60 (2006) 765e782, http://dx.doi.org/10.1111/ j.1365-2958.2006.05131.x. H.-M. Zhang, Z. Li, M. Tsudome, S. Ito, H. Takami, K. Horikoshi, An alkaliinducible flotillin-like protein from Bacillus halodurans C-125, Protein J. 24 (2005) 125e131, http://dx.doi.org/10.1007/s10930-004-1519-3. C. Donovan, M. Bramkamp, Characterization and subcellular localization of a bacterial flotillin homologue, Microbiology 155 (2009) 1786e1799, http:// dx.doi.org/10.1099/mic.0.025312-0.
zquez-V
L. Carmona-Salazar, M. El Hafidi, C. Enríquez-Arredondo, C. Va azquez,
lez de la Vara, M. Gavilanes-Ruíz, Isolation of detergent-resistant L.E. Gonza membranes from plant photosynthetic and non-photosynthetic tissues, Anal. Biochem. 417 (2011) 220e227, http://dx.doi.org/10.1016/ j.ab.2011.05.044. G.H.H. Borner, D.J. Sherrier, T. Weimar, L. V Michaelson, N.D. Hawkins, A. Macaskill, et al., Analysis of detergent-resistant membranes in Arabidopsis. Evidence for plasma membrane lipid rafts, Plant Physiol. 137 (2005) 104e116, http://dx.doi.org/10.1104/pp.104.053041. U. Jakop, B. Fuchs, R. Süss, G. Wibbelt, B. Braun, K. Müller, et al., The solubilisation of boar sperm membranes by different detergents - a microscopic, MALDI-TOF MS, (31)P NMR and PAGE study on membrane lysis, extraction efficiency, lipid and protein composition, Lipids Health Dis. 8 (2009) 49, http://dx.doi.org/10.1186/1476-511X-8-49. R. Williamson, A.J. Thompson, M. Abu, A. Hye, A. Usardi, S. Lynham, et al., Isolation of detergent resistant microdomains from cultured neurons: detergent dependent alterations in protein composition, BMC Neurosci. 11 (2010) 120, http://dx.doi.org/10.1186/1471-2202-11-120. J.-L. Delaunay, M. Breton, G. Trugnan, M. Maurice, Differential solubilization of inner plasma membrane leaflet components by Lubrol WX and Triton X-100, Biochim. Biophys. Acta 1778 (2008) 105e112, http://dx.doi.org/10.1016/ j.bbamem.2007.09.017. S. Mongrand, J. Morel, J. Laroche, S. Claverol, J.-P. Carde, M.-A. Hartmann, et al., Lipid rafts in higher plant cells: purification and characterization of Triton X100-insoluble microdomains from tobacco plasma membrane, J. Biol. Chem. 279 (2004) 36277e36286, http://dx.doi.org/10.1074/jbc.M403440200. K.A. Datsenko, B.L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6640e6645, http://dx.doi.org/10.1073/pnas.120163297. S. Uzzau, N. Figueroa-Bossi, S. Rubino, L. Bossi, Epitope tagging of chromosomal genes in Salmonella, Proc. Natl. Acad. Sci. U. S. A. 98 (2001)

15264e15269, http://dx.doi.org/10.1073/pnas.261348198. [28] M. Thanbichler, A.A. Iniesta, L. Shapiro, A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus, Nucleic Acids Res. 35 (2007) e137, http://dx.doi.org/10.1093/nar/gkm818. [29] L.D. Renner, D.B. Weibel, Cardiolipin microdomains localize to negatively curved regions of Escherichia coli membranes, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 6264e6269, http://dx.doi.org/10.1073/pnas.1015757108. ~ a-Sandoval, D. Georgellis, The ArcB sensor kinase of Escherichia coli [30] G.R. Pen autophosphorylates by an intramolecular reaction, J. Bacteriol. 192 (2010) 1735e1739, http://dx.doi.org/10.1128/JB.01401-09. [31] C.A. Schneider, W.S. Rasband, K.W. Eliceiri, NIH Image to ImageJ: 25 years of image analysis, Nat. Methods 9 (2012) 671e675, http://dx.doi.org/10.1038/ nmeth.2089. €rg, Improved silver staining protocols for [32] E. Mortz, T.N. Krogh, H. Vorum, A. Go high sensitivity protein identification using matrix-assisted laser desorption/ ionization-time of flight analysis, Proteomics 1 (2001) 1359e1363, http:// dx.doi.org/10.1002/1615-9861(200111)1:11<1359::AIDPROT1359>3.0.CO;2-Q. [33] M. Thein, G. Sauer, N. Paramasivam, I. Grin, D. Linke, Efficient subfractionation of gram-negative bacteria for proteomics studies, J. Proteome Res. 9 (2010) 6135e6147, http://dx.doi.org/10.1021/pr1002438. [34] D.C. Birdsell, E.H. Cota-Robles, Production and ultrastructure of lysozyme and ethylenediaminetetraacetate-lysozyme spheroplasts of Escherichia coli, J. Bacteriol. 93 (1967) 427e437. http://www.pubmedcentral.nih.gov/ articlerender.fcgi?artid¼315014&tool¼pmcentrez&rendertype¼abstract (Accessed 29 March2016). [35] T. Miura, S. Mizushima, Separation by density gradient centrifugation of two types of membranes from spheroplast membrane of Escherichia coli K12, Biochim. Biophys. Acta 150 (1968) 159e161. http://www.ncbi.nlm.nih.gov/ pubmed/4868245 (Accessed 29 March 2016). [36] B. Witholt, M. Boekhout, M. Brock, J. Kingma, H.V. Heerikhuizen, L.D. Leij, An efficient and reproducible procedure for the formation of spheroplasts from variously grown Escherichia coli, Anal. Biochem. 74 (1976) 160e170. http:// www.ncbi.nlm.nih.gov/pubmed/786067 (Accessed 29 March 2016). [37] S. Morein, D. Henricson, L. Rilfors, Separation of inner and outer membrane vesicles from Escherichia coli in self-generating Percoll gradients, Anal. Biochem. 216 (1994) 47e51, http://dx.doi.org/10.1006/abio.1994.1006. [38] D. Oursel, C. Loutelier-Bourhis, N. Orange, S. Chevalier, V. Norris, C.M. Lange, Lipid composition of membranes of Escherichia coli by liquid chromatography/ tandem mass spectrometry using negative electrospray ionization, Rapid Commun. Mass Spectrom. 21 (2007) 1721e1728, http://dx.doi.org/10.1002/ rcm.3013. [39] J. Gidden, J. Denson, R. Liyanage, D.M. Ivey, J.O. Lay, Lipid compositions in Escherichia coli and Bacillus subtilis during growth as determined by MALDITOF and TOF/TOF mass spectrometry, Int. J. Mass Spectrom. 283 (2009) 178e184, http://dx.doi.org/10.1016/j.ijms.2009.03.005. [40] H.J. Risselada, S.J. Marrink, The molecular face of lipid rafts in model membranes, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 17367e17372, http:// dx.doi.org/10.1073/pnas.0807527105. [41] C. Eggeling, C. Ringemann, R. Medda, G. Schwarzmann, K. Sandhoff, S. Polyakova, et al., Direct observation of the nanoscale dynamics of membrane lipids in a living cell, Nature 457 (2009) 1159e1162, http://dx.doi.org/ 10.1038/nature07596. [42] D.A. Brown, J.K. Rose, Sorting of GPI-anchored proteins to glycolipid-enriched membrane subdomains during transport to the apical cell surface, Cell 68 (1992) 533e544, http://dx.doi.org/10.1016/0962-8924(92)90095-5. [43] A. Gorodinsky, D.A. Harris, Glycolipid-anchored proteins in neuroblastoma cells form detergent-resistant complexes without caveolin, J. Cell Biol. 129 (1995) 619e627. http://www.pubmedcentral.nih.gov/articlerender.fcgi? artid¼2120430&tool¼pmcentrez&rendertype¼abstract (Accessed 29 March 2016). [44] D.A. Brown, Lipid rafts, detergent-resistant membranes, and raft targeting signals, Physiology (Bethesda) 21 (2006) 430e439, http://dx.doi.org/10.1152/ physiol.00032.2006. [45] S. Schuck, M. Honsho, K. Ekroos, A. Shevchenko, K. Simons, Resistance of cell membranes to different detergents, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 5795e5800, http://dx.doi.org/10.1073/pnas.0631579100. [46] T. Nebl, K.N. Pestonjamasp, J.D. Leszyk, J.L. Crowley, S.W. Oh, E.J. Luna, Proteomic analysis of a detergent-resistant membrane skeleton from neutrophil plasma membranes, J. Biol. Chem. 277 (2002) 43399e43409, http:// dx.doi.org/10.1074/jbc.M205386200. [47] E.C. Lai, Lipid rafts make for slippery platforms, J. Cell Biol. 162 (2003) 365e370, http://dx.doi.org/10.1083/jcb.200307087. [48] A. Moscatelli, A. Gagliardi, L. Maneta-Peyret, L. Bini, N. Stroppa, E. Onelli, et al., Characterisation of detergent-insoluble membranes in pollen tubes of Nicotiana tabacum (L.), Biol. Open 4 (2015) 378e399, http://dx.doi.org/10.1242/ bio.201410249. [49] T. Peskan, M. Westermann, R. Oelmüller, Identification of low-density Triton X-100-insoluble plasma membrane microdomains in higher plants, Eur. J. Biochem. 267 (2000) 6989e6995, http://dx.doi.org/10.1046/j.14321327.2000.01776.x.