- Email: [email protected]
Isolation of DNA Sequences Amplified at Chromosome 19q13.1–q13.2 Including theAKT2Locus in Human Pancreatic Cancer
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
225, 968–974 (1996)
1280
Isolation of DNA Sequences Amplified at Chromosome 19q13.1–q13.2 Including the AKT2 Locus in Human Pancreatic Cancer1 Wataru Miwa,* Jun Yasuda,* Yoshinori Murakami,* Kazuo Yashima,* Kokichi Sugano,† Teruaki Sekine,‡ Akira Kono,§ Shinichi Egawa,Ø Ken Yamaguchi,Ø Yoshihide Hayashizaki,\ and Takao Sekiya*,2 *Oncogene Division, ‡Radioisotope Laboratory, and ØGrowth Factor Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan; †Clinical Laboratory Division, National Cancer Center Hospital, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan; §Chemotherapy Division, National Kyusyu Cancer Center Research Institute, 3-1-1, Notame, Minami-ku, Fukuoka 815, Japan; and \Genome Science, The Institute of Physical and Chemical Research, 3-1-1, Koyadai, Tsukuba, Ibaraki 305, Japan Received July 11, 1996 In the human pancreatic cancer cell line PANC1, we detected several DNA fragments with abnormally intensified signals by restriction landmark genomic scanning. Major five of these fragments were cloned. All of the cloned fragments were mapped at the 19q13.1-13.2 region where the AKT2 oncogene was located. Southern blotting using the cloned DNA fragments and a fragment of AKT2 cDNA as probes revealed that the AKT2 gene was amplified in 3 of 12 pancreatic cancer cell lines analyzed including PANC1 and in 3 of 20 primary pancreatic cancers. The AKT2 gene was overexpressed in the 3 cell lines with the amplified gene. The results suggest that the AKT2 gene is a candidate oncogene activated by amplification in some human pancreatic cancers. q 1996 Academic Press, Inc.
Pancreatic adenocarcinoma remains a major clinical problem due to its biological agressiveness and very poor survival rate. Understanding the molecular pathogenesis of this disorder will contribute greatly to early diagnosis and better treatment, but little is known so far about the genetic changes that characterize pancreatic cancer. Restriction landmark genomic scanning (RLGS) is an efficient means of wide-range screening for genetic alterations in genomic DNA and cloning the DNA sequences corresponding to RLGS spots of interest allows further molecular biological analysis (1-5). To further understand genes involved in human pancreatic cancers, we detected DNA segments amplified in cancer cell lines by means of RLGS. Our results revealed amplification of a region on chromosome 19q13-q13.2 where the oncogene AKT2 was located in about 20% of human pancreatic cancers either in cell lines or in primary tumors. MATERIALS AND METHODS Cancer cells and DNA preparations. Genomic DNAs were extracted from 12 pancreatic cancer cell lines and normal tissues from 12 individuals, seven lymphocyte samples, three placentas, and tissues from one lung and one colon as described (5). DNA samples were also prepared from primary pancreatic cancers and normal pancreas and gastric mucosa of 20 patients. Pancreatic cancer cell lines KP1N and KP2N (6) and PSN-1 (7) were established as described. Other cell lines were obtained from the ATCC (Rockville).
1 This work was supported in part by a Grant-in-Aid from the Ministry of Health and Welfare for the 2nd Term Comprehensive 10-Year Strategy for Cancer Control, Japan, a Research Grant on Aging and Health from the Ministry of Health and Welfare, a grant from the Special Coordination Fund of Science and Technology Agency of Japan. W. M. is a recipient of a Research Resident Fellowship from the Foundation for Promotion of Cancer Research of Japan. 2 To whom correspondence should be addressed. Fax: /81–5565–9535. E-mail: [email protected].
968 0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
RLGS Analysis and Cloning DNA Fragments corresponding to the RLGS Spots. RLGS was performed as described (5). Briefly, cleaved sites of restriction landmarks were isotopically labeled, then fractionated by two dimensional gel electrophoresis. The combination of enzymes was NotI for providing landmarks, PvuII for the second cleavage and MboI for the third digestion in-gel. Spots with abnormal intensity were quantified using an Image Master (Pharmacia, Milwaukee). DNA fragments corresponding to RLGS spots were cloned using the NotI restriction trapper (AGENE, Kamakura, Japan) as described (4, 5). Southern blot hybridization. Fragments obtained by digesting genomic DNA with MboI endonuclease were Southern blotted and hybridized with 32P labeled probes (5). Probes for the AKT2 (292 base pairs) and TGFb1 (501 base pairs) genes were prepared by PCR amplification of cDNAs from the PANC1 cell line. The probe for the CEA gene was the 3*-untranslated region of the cloned cDNA PCEA14 that was a gift from S. Oikawa (8). The EcoRI-PstI DNA fragment of the N-myc gene was used as a probe for hybridization with an internal control. Primer sequences for the AKT2 probe were 5*-CAAGGATGAAGTCGCTCACA-3* and 5*-CCGTCACTGATGCCCTCTTT-3*. Primers for the TGFb1 probe were as described (9). The intensity of signals on autoradiograms was quantified using the Image Master. Nucleotide sequence analysis. The nucleotide sequences of the cloned fragments were determined by dideoxy chain termination using a kit (AutoRead, Pharmacia) and an automated DNA sequencer (A.L.F., Pharmacia). Homology was searched using the BLAST Network Service of the National Center Biotechnology Information (10). Chromosome assignment of the cloned DNA fragments. Primers were designed to generate sequence-tagged-sites (STSs) for each of the cloned fragments according to the determined nucleotide sequences (Table 1). Chromosomes were assigned by comparison with the NIGMS human/rodent somatic cell hybrid mapping panel 2 (Coriell Cell Research, Camden) as well as the Genebridge 4 radiation hybrid panel (Research Genetics, Huntsville). The radiation hybrid panel consisted of 91 human/hamster somatic hybrid cell lines. Each line retains about one-third of the human genome in fragments of about 10 megabases (11). PCR for STSs was performed in duplicate for the 91 hybrid panel DNAs. The results were scored using the statistical program RHMAPPER at the Whitehead Institute for Biomedical Research (11). RNA preparation and northern blotting. Total cellular RNAs were extracted from subconfluent cells using the acid guanidinium-phenol-chloroform method. The RNAs (10 mg ) were northern blotted on Hybond-N membranes (Amersham, Bucks, U. K.). The probes used for Southern and northern hybridization were the same. To evaluate the level of AKT2 gene expression, the intensity of AKT2 mRNA in autoradiograms was compared to that of b-actin mRNA using the Image MasterTM.
RESULTS
Isolation of DNA fragments amplified in pancreatic cancer cell lines. A comparison of the two RLGS fingerprints shown in Fig. 1A revealed several spots with abnormally intensified signals (about 10 fold) in the pancreatic cancer cell line PANC1. The intensity of these spots in fingerprints of the pancreatic cancer cell lines PSN1, ASPC1, MiaPaCa2 and CFPAC2 and in 12 normal tissues was similar to that of the spots seen in the control in Fig. 1A. DNA fragments corresponding to major five intensified spots (spots 1 to 5, Fig. 1A) were cloned from PANC1 DNA and designated DNAs 1 to 5, respectively. Southern blot analysis of these DNAs confirmed that they were amplified about 15 fold in the PANC1 cell line (Fig. 1B). Figure 2A compares the DNAs from 12 pancreatic cancer cell lines and from lymphocytes digested with the restriction endonuclease MboI. Hybridization with cloned DNA 4 revealed about 15-and 4-fold amplification in KP1N and BXPC3 cells, respectively, in addition to that in PANC1 cells. RLGS analysis of KP1N DNA revealed intensification of a few spots in additon to those observed in PANC1 DNA, suggesting the amplification of wider DNA regions in KP1N cells. Northern blot analysis of RNA from PANC1 cells did not indicate the expression of nucleotide sequences corresponding to the five fragments. On the other hand, RLGS analysis of KP1N DNA did not revealed tumor specific intensified spots, probably due to a relatively low extent of amplification (4 fold, Fig. 1B). Nucleotide sequence analysis and chromosomal assignment using radiation hybrid panels. The nucleotide sequence of the five DNA fragments was not homologous to the known DNA sequences. Based on the determined nucleotide sequences, STSs for the DNA fragments corresponding to the spots were established except for spot 3 (Table 1). The nucleotide sequences analysis revealed that DNA 3 was a part of DNA2. When DNAs 2 and 3 were used as probes, restriction fragments of genomic DNAs hybridized were always identical between 969
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Detection and isolation of DNA fragments amplified in PANC1. A, RLGS fingerprints of DNAs from the pancreatic cancer cell line PANC1 and from lymphocytes as a normal control. B, Southern blot hybridization using cloned DNA fragments corresponding to spots 1 to 5 as probes. Genomic DNAs from the PANC1 cell line (C) and lymphocytes (N) were digested with MboI restriction endonuclease and the same membrane was used for hybridization with DNAs 1 to 5 and the N-myc probe.
the two probes regardless of the restriction enzymes. Therefore, STS for DNA2 but not for DNA3 was established. A PCR-based mapping of the STSs using DNA templates from NIGMS monochromosomal panels revealed that all the cloned DNA fragments were derived from chromosome 19. To more precisely localize each fragment on chromosome 19, DNAs from 91 human/hamster somatic hybrid cell lines (Genebridge 4) were used as PCR templates to amplify the STSs. A statistical analysis of the results from the PCR assay revealed the order of DNAs 1 to 5 and their location in the region on chromosome 19q13.1-13.2 between a locus 1.5 centiRays centromeric and 13.81 centiRays telomeric from the D19S220 locus (Table 1, Fig. 3). These results suggested that the amplified DNA fragments independently cloned in PANC1 cells constituted a single amplicon. According to the physical map of human chromosome 19 (12), the D19S220 locus was located less than 2 megabases from the AKT2 oncogene that was amplified and overexpressed in 10% of ovarian cancers (13). We therefore investigated the involvement of AKT2 gene amplification in pancreatic cancers. Amplification and overexpression of the AKT2 gene in pancreatic cancers. As shown in Fig. 2A, the AKT2 gene was amplified in the PANC1, KP1N and BXPC3 cell lines to the level found in DNA 4. AKT2 gene overexpression in these cell lines was also detected by northern blotting (Fig. 2C). The AKT2 gene was amplified in 3 of 20 primary pancreatic cancers analyzed (Fig. 2B). The level of amplification in these primary pancreatic cancers was 970
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Amplification and overexpression of the AKT2 gene in pancreatic cancers. A, Southern blot analysis of genomic DNAs digested with the restriction endonuclease MboI. DNAs were isolated from pancreatic cancer cell lines: 1, PANC1; 2, PSN1; 3, ASPC1; 4, MiaPaCa2; 5, BXPC3; 6, CFPAC2; 7, CAPAN1; 8, CAPAN2; 9, H48N; 10, FA6; 11, KP1N; and 12, KP2N. Lane 13 contained DNA from lymphocytes as a normal control. Fragments were Southern blotted and hybridized with DNA 4, AKT2 and N-myc probes. DNAs from PANC1, KP1N and normal lymphocytes were separately hybridized with TGFb1, CEA and N-myc probes. B, DNAs were isolated from primary pancreatic cancers (T) and their normal counterparts (N). The same membrane was used for hybridization with the AKT2 and N-myc probes. C, Northern blot analysis of RNA isolated from pancreatic cancer cell lines: 1, PANC1; 2, PSN1; 3, ASPC1; 4, MiaPaCa2; 5, BXPC3; 6, CAPAN1; 7, H48N; 8, FA6; 9, KP1N; and 10 KP2N. The same membrane was used for hybridization with the AKT2 and b-actin probes.
estimated to be 3 to 4 fold, which was relatively lower than that in the cell lines. However, samples from primary pancreatic cancers contained a significant amount of normal DNA, which might cause the level of AKT2 amplification to be underestimated. As the TGFb1 and CEA genes were mapped about 1.0 and 1.5 megabases telomeric from the AKT2 locus, respectively (12), their amplification was similarly analyzed. However, in both PANC1 and KP1N cells, there was no apparent amplification of these two genes (Fig. 2A), indicating that telomeric end of the amplicon could be less than 1.0 megabases telomeric from the AKT2 locus. DISCUSSION Several genetic alterations are consistently identified in human pancreatic cancers, such as mutations of the K-ras gene (ú80%), the P53 gene (50%) (14, 15) and mutations or homozy971
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1 STSs and Primers for Their Amplification by PCR
STS
Fragment size (base pair)
Distance from D19S220 (centiRay)
DNA1
1088
10.9 (telomeric)
DNA2
639
9.54 (telomeric)
DNA4
436
13.81 (telomeric)
DNA5
326
Primer (5* to 3*) AGAATCCCCGATTCCTATTT CTGTAGCCTTGCACAAATGA AGGCCGAGAAATGGACAGAT TTCCCCAGCCTGGCCATCAG GCAGTCCGGGAGCCGGGGAC GCTGGCTTTCCTGGCACACT GTCTGGGGCTGTGAAGCAGG TCAGCCTCCCAAAGTGCTCA
1.5 (centromiric)
gous deletions of the P16 gene (ú85%) (16). Some growth factors and growth factor receptors are also overexpressed in pancreatic cancers (17). We also searched for abnormal genes in primary pancreatic cancers (18-21). However, the molecular events that cause this distinctively agressive neoplasm have not yet been elucidated. To deepen understanding of the genetic alterations involved in pancreatic cancer, we used RLGS, which enabled genome-wide analysis of DNA alterations. We detected several DNA fragments amplified in human pancreatic cancer cell lines by RLGS fingerprinting and assigned the corresponding DNA clones to chromosome 19q13.1-q13.2, where DNA amplification had not been identified in this cancer. The AKT2 gene is a human cellular homologues of the viral oncogene v-akt and encodes a serine-threonine protein kinase (13). The AKT2 gene mapped at chromosome 19q13.1-q13.2 was found to be amplified and overexpressed in about 10% of ovarian cancers (13). Our RLGS
FIG. 3. Mapping of cloned DNA fragments using the Genebridge 4 radiation hybrid panel. The orders of DNAs 1, 2 (3), 4, and 5 determined by the radiation hybrid panels are indicated. Distances determined by radiation doses are indicated as centiRays (cR). One centiRays corresponds to 0.48 centimorgans that are about 285 kilobase pairs on the average at chromosome 19 (11). The AKT2, TGFb1 and CEA genes have been mapped in the region between the D19S220 and WI-7903 loci. The precise relationship between the order of DNAs 1 to 5 and that of these genes remain unclear and therefore loci for the AKT2, TGFb1 and CEA genes are not indicated. 972
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
fingerprinting of pancreatic cancer DNA revealed the amplification of a chromosomal region containing the AKT2 gene. Very recently Chang et al. found the amplified AKT2 gene in human panceratic cancer cell lines PANC1 and ASPC1, and also 1 of 10 primary tumor specimens by Southern blot analysis using genomic AKT2 probe (22). AKT2 gene amplification and overexpression in pancreatic cancers suggest that this gene is an oncogene implicated in the genesis or development of this disorder. Recently, the AKT2 gene has been revealed to be a target of the PDGF-activated phosphatidylinositol 3-kinase (23). Since the PDGFb gene is also overexpressed in pancreatic cancers (24), aberrations of the AKT2 gene might play a role in pancreatic carcinogenesis through the PDGF-mediated signal transduction pathway. The TGFb1 gene encoding a potent growth inhibitor and mapped 1.0 megabases telomeric from the AKT2 locus was not amplified in PANC1 and KP1N cells, suggesting the exclusion of genes disadvantageous for the growth of pancreatic cancer cells from the amplicon. ACKNOWLEDGMENTS We are grateful to Drs. M. Iizuka and M. Shiraishi for helpful discussions and comments.
REFERENCES 1. Hatada, I., Hayashizaki, Y., Hirotsune, S., Komatsubara, H., and Mukai, T. (1991) Natl. Acad. Sci. USA 88, 9523–9527. 2. Hirotsune S., Hatada, I., Komatsubara, H., Nagai, H., Kuma, K., Kobayakawa, K., Kawara, T., Nakagawara, A., Fujii, K., Mukai, T., and Hayashizaki, Y. (1992) Cancer Res. 52, 3642–3647. 3. Nagai, H., Ponglikitmongkol, M., Mita, E., Ohmachi, Y., Yoshikawa, H., Saeki, R., Yumoto, Y., Nakanishi, T., and Matsubara, K. (1994) Cancer Res. 54, 1545–1550. 4. Hirotsune, S., Shibata, H., Okazaki, Y., Sugino, H., Imoto, H., Sasaki, N., Hirose, K., Okuizumi, H., Muramatsu, M., Plass, C., Chapman, V, M., Tamatsukuri, S., Miyamoto, C., Furuichi, Y., and Hayashizaki, Y. (1993) Biochem. Biophys. Res. Commun. 194, 1406–1412. 5. Miwa, W., Yashima, K., Sekine, T., and Sekiya, T. (1995) Electrophoresis 16, 227–232. 6. Ikeda, Y., Ezaki, M., Hayashi, I., Yasuda, D., Nakayama, K., and Kono, A. (1990) Jpn. J. Cancer Res. 81, 987– 993. 7. Yamada, H., Yoshida, T., Sakamoto, H., Terada, M., and Sugimura, T. (1986) Biochem. Biophys. Res. Commun. 140, 167–173. 8. Oikawa, S., Nakazato, H., and Kosaki, G. (1987) Biochem. Biophys. Res. Commun. 142, 511–518. 9. Jokhi, P. P., King, A., Sharkey, A. M., Smith, S. K., and Loke, Y. W. (1994) J. Immunol. 153, 4427–4435. 10. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403–410. 11. Hudoson, T. J., Stein, L. D., Gerety, S. S., Ma, J., Castle, A. B., Silva, J., Slonim, D. K., Baptista, R., Krugyyak, L., Xu, S.-H., Hu. Xintong., Colbert, A. M. E., Rosenberg, C., Reeve-Daly, M. P., Rozen, S., Hui, L., Wu, X., Vestergaard, C., Wilson, K. M., Bae, J. S., Marita, S., Ganiatsas, S., Evans., C.A., DeAngelis, M. M., Ingalls, K. A., Nahf, R. W., Horton Jr., L. T., Anderson, M. O., Collymore, A. J., Ye, W., Kouyoumjian, V., Zemsteva, I. S., Tam, J., Devain, R., Courtney, D. F., Renaud, M. T., Nguyen, H., O’Connor, T. J., Fizames, C., Faure, S., Gyapay, G., Dib, C., Morissette, J., Orlin, J. B., Birren,B. W., Goodman, N., Weissenbach, J., Hawkins, T. W., Foote, S., Page, D. C., and Lander, E. S. (1995) Science 270, 1945–1954. 12. Ashoworth, L. K., Batzer, M. A., Brandriff, B., Branscomb, E., Jong, P. D., Garcia, E., Garnes, J. A., Gordon, L. A., Lamerdin, J. E., Lennon, G., Mohrenweiser, H., Oslen, A. S., Slezak, T., Carrano, A. V. (1995) Nature Genet. 11, 422–427. 13. Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., Tsichlis, P. N., and Testa, J. R. (1992) Proc. Natl. Acad. Sci. USA 89, 9267–9271. 14. Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N., and Perucho, M. (1988) Cell 53, 549–554. 15. Pellegata, N. S., Sessa, F., Renault, B., Bonato, M., Leone, B. E., Solcia, E., and Ranzani, G. N. (1994) Cancer Res. 54, 1556–1560. 16. Caldas, C., Hahn, S. A., da Costa, L. T., Redston, M. S., Schutte, M., Seymour, A. B., Weinstein, C. L., Hruban, R. H., Yeo, C. J., and Kern, S. E. (1994) Nature Genet. 8, 27–32. 17. Korc, M., Chandrasekar, B., Yamanaka, Y., Friess, H., Buchier, M., and Beger, H. G. (1992) J. Clin. Invest. 90, 1352–1360. 18. Sekiya, T., Murakami, Y., and Hayashi, K. (1993) Int. J. Pancreatol. 13, 69–78. 19. Nakamori, S., Yashima, K., Murakami, Y., Ishikawa, O., Ohigashi, H., Imaoka, S., Yaegashi, S., Konishi, Y., and Sekiya, T. (1995) Jpn. J. Cancer Res. 86, 174–181. 973
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
20. Yashima, K., Nakamori, S., Murakami, Y., Yamaguchi, A., Hayashi, K., Ishikawa, O., Konishi, Y., and Sekiya, T. (1994) Int. J. Cancer 59, 43–47. 21. Shimizu, T., Miwa, W., Nakamori, S., Ishikawa, O., and Sekiya, T. (1996) Jpn. J. Cancer Res. 87, 275–278. 22. Cheng, J. Q., Ruggeri, B., Klein, W. M., Sonoda, G., Altomare, D. A., Watson D. K. and Testa, J. R. (1996) Proc. Natl. Acad. Sci. USA 93, 3636–3641. 23. Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R., and Tsichlis, P. N. (1995) Cell 81, 727–736. 24. Ebert, M., Yokoyama, M., Friess, H., Kobrin, M. S., Buchler, M. W., and Korc, M. (1995) Int. J. Cancer 62, 529–535.
974
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
225, 968–974 (1996)
1280
Isolation of DNA Sequences Amplified at Chromosome 19q13.1–q13.2 Including the AKT2 Locus in Human Pancreatic Cancer1 Wataru Miwa,* Jun Yasuda,* Yoshinori Murakami,* Kazuo Yashima,* Kokichi Sugano,† Teruaki Sekine,‡ Akira Kono,§ Shinichi Egawa,Ø Ken Yamaguchi,Ø Yoshihide Hayashizaki,\ and Takao Sekiya*,2 *Oncogene Division, ‡Radioisotope Laboratory, and ØGrowth Factor Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan; †Clinical Laboratory Division, National Cancer Center Hospital, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan; §Chemotherapy Division, National Kyusyu Cancer Center Research Institute, 3-1-1, Notame, Minami-ku, Fukuoka 815, Japan; and \Genome Science, The Institute of Physical and Chemical Research, 3-1-1, Koyadai, Tsukuba, Ibaraki 305, Japan Received July 11, 1996 In the human pancreatic cancer cell line PANC1, we detected several DNA fragments with abnormally intensified signals by restriction landmark genomic scanning. Major five of these fragments were cloned. All of the cloned fragments were mapped at the 19q13.1-13.2 region where the AKT2 oncogene was located. Southern blotting using the cloned DNA fragments and a fragment of AKT2 cDNA as probes revealed that the AKT2 gene was amplified in 3 of 12 pancreatic cancer cell lines analyzed including PANC1 and in 3 of 20 primary pancreatic cancers. The AKT2 gene was overexpressed in the 3 cell lines with the amplified gene. The results suggest that the AKT2 gene is a candidate oncogene activated by amplification in some human pancreatic cancers. q 1996 Academic Press, Inc.
Pancreatic adenocarcinoma remains a major clinical problem due to its biological agressiveness and very poor survival rate. Understanding the molecular pathogenesis of this disorder will contribute greatly to early diagnosis and better treatment, but little is known so far about the genetic changes that characterize pancreatic cancer. Restriction landmark genomic scanning (RLGS) is an efficient means of wide-range screening for genetic alterations in genomic DNA and cloning the DNA sequences corresponding to RLGS spots of interest allows further molecular biological analysis (1-5). To further understand genes involved in human pancreatic cancers, we detected DNA segments amplified in cancer cell lines by means of RLGS. Our results revealed amplification of a region on chromosome 19q13-q13.2 where the oncogene AKT2 was located in about 20% of human pancreatic cancers either in cell lines or in primary tumors. MATERIALS AND METHODS Cancer cells and DNA preparations. Genomic DNAs were extracted from 12 pancreatic cancer cell lines and normal tissues from 12 individuals, seven lymphocyte samples, three placentas, and tissues from one lung and one colon as described (5). DNA samples were also prepared from primary pancreatic cancers and normal pancreas and gastric mucosa of 20 patients. Pancreatic cancer cell lines KP1N and KP2N (6) and PSN-1 (7) were established as described. Other cell lines were obtained from the ATCC (Rockville).
1 This work was supported in part by a Grant-in-Aid from the Ministry of Health and Welfare for the 2nd Term Comprehensive 10-Year Strategy for Cancer Control, Japan, a Research Grant on Aging and Health from the Ministry of Health and Welfare, a grant from the Special Coordination Fund of Science and Technology Agency of Japan. W. M. is a recipient of a Research Resident Fellowship from the Foundation for Promotion of Cancer Research of Japan. 2 To whom correspondence should be addressed. Fax: /81–5565–9535. E-mail: [email protected].
968 0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
RLGS Analysis and Cloning DNA Fragments corresponding to the RLGS Spots. RLGS was performed as described (5). Briefly, cleaved sites of restriction landmarks were isotopically labeled, then fractionated by two dimensional gel electrophoresis. The combination of enzymes was NotI for providing landmarks, PvuII for the second cleavage and MboI for the third digestion in-gel. Spots with abnormal intensity were quantified using an Image Master (Pharmacia, Milwaukee). DNA fragments corresponding to RLGS spots were cloned using the NotI restriction trapper (AGENE, Kamakura, Japan) as described (4, 5). Southern blot hybridization. Fragments obtained by digesting genomic DNA with MboI endonuclease were Southern blotted and hybridized with 32P labeled probes (5). Probes for the AKT2 (292 base pairs) and TGFb1 (501 base pairs) genes were prepared by PCR amplification of cDNAs from the PANC1 cell line. The probe for the CEA gene was the 3*-untranslated region of the cloned cDNA PCEA14 that was a gift from S. Oikawa (8). The EcoRI-PstI DNA fragment of the N-myc gene was used as a probe for hybridization with an internal control. Primer sequences for the AKT2 probe were 5*-CAAGGATGAAGTCGCTCACA-3* and 5*-CCGTCACTGATGCCCTCTTT-3*. Primers for the TGFb1 probe were as described (9). The intensity of signals on autoradiograms was quantified using the Image Master. Nucleotide sequence analysis. The nucleotide sequences of the cloned fragments were determined by dideoxy chain termination using a kit (AutoRead, Pharmacia) and an automated DNA sequencer (A.L.F., Pharmacia). Homology was searched using the BLAST Network Service of the National Center Biotechnology Information (10). Chromosome assignment of the cloned DNA fragments. Primers were designed to generate sequence-tagged-sites (STSs) for each of the cloned fragments according to the determined nucleotide sequences (Table 1). Chromosomes were assigned by comparison with the NIGMS human/rodent somatic cell hybrid mapping panel 2 (Coriell Cell Research, Camden) as well as the Genebridge 4 radiation hybrid panel (Research Genetics, Huntsville). The radiation hybrid panel consisted of 91 human/hamster somatic hybrid cell lines. Each line retains about one-third of the human genome in fragments of about 10 megabases (11). PCR for STSs was performed in duplicate for the 91 hybrid panel DNAs. The results were scored using the statistical program RHMAPPER at the Whitehead Institute for Biomedical Research (11). RNA preparation and northern blotting. Total cellular RNAs were extracted from subconfluent cells using the acid guanidinium-phenol-chloroform method. The RNAs (10 mg ) were northern blotted on Hybond-N membranes (Amersham, Bucks, U. K.). The probes used for Southern and northern hybridization were the same. To evaluate the level of AKT2 gene expression, the intensity of AKT2 mRNA in autoradiograms was compared to that of b-actin mRNA using the Image MasterTM.
RESULTS
Isolation of DNA fragments amplified in pancreatic cancer cell lines. A comparison of the two RLGS fingerprints shown in Fig. 1A revealed several spots with abnormally intensified signals (about 10 fold) in the pancreatic cancer cell line PANC1. The intensity of these spots in fingerprints of the pancreatic cancer cell lines PSN1, ASPC1, MiaPaCa2 and CFPAC2 and in 12 normal tissues was similar to that of the spots seen in the control in Fig. 1A. DNA fragments corresponding to major five intensified spots (spots 1 to 5, Fig. 1A) were cloned from PANC1 DNA and designated DNAs 1 to 5, respectively. Southern blot analysis of these DNAs confirmed that they were amplified about 15 fold in the PANC1 cell line (Fig. 1B). Figure 2A compares the DNAs from 12 pancreatic cancer cell lines and from lymphocytes digested with the restriction endonuclease MboI. Hybridization with cloned DNA 4 revealed about 15-and 4-fold amplification in KP1N and BXPC3 cells, respectively, in addition to that in PANC1 cells. RLGS analysis of KP1N DNA revealed intensification of a few spots in additon to those observed in PANC1 DNA, suggesting the amplification of wider DNA regions in KP1N cells. Northern blot analysis of RNA from PANC1 cells did not indicate the expression of nucleotide sequences corresponding to the five fragments. On the other hand, RLGS analysis of KP1N DNA did not revealed tumor specific intensified spots, probably due to a relatively low extent of amplification (4 fold, Fig. 1B). Nucleotide sequence analysis and chromosomal assignment using radiation hybrid panels. The nucleotide sequence of the five DNA fragments was not homologous to the known DNA sequences. Based on the determined nucleotide sequences, STSs for the DNA fragments corresponding to the spots were established except for spot 3 (Table 1). The nucleotide sequences analysis revealed that DNA 3 was a part of DNA2. When DNAs 2 and 3 were used as probes, restriction fragments of genomic DNAs hybridized were always identical between 969
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Detection and isolation of DNA fragments amplified in PANC1. A, RLGS fingerprints of DNAs from the pancreatic cancer cell line PANC1 and from lymphocytes as a normal control. B, Southern blot hybridization using cloned DNA fragments corresponding to spots 1 to 5 as probes. Genomic DNAs from the PANC1 cell line (C) and lymphocytes (N) were digested with MboI restriction endonuclease and the same membrane was used for hybridization with DNAs 1 to 5 and the N-myc probe.
the two probes regardless of the restriction enzymes. Therefore, STS for DNA2 but not for DNA3 was established. A PCR-based mapping of the STSs using DNA templates from NIGMS monochromosomal panels revealed that all the cloned DNA fragments were derived from chromosome 19. To more precisely localize each fragment on chromosome 19, DNAs from 91 human/hamster somatic hybrid cell lines (Genebridge 4) were used as PCR templates to amplify the STSs. A statistical analysis of the results from the PCR assay revealed the order of DNAs 1 to 5 and their location in the region on chromosome 19q13.1-13.2 between a locus 1.5 centiRays centromeric and 13.81 centiRays telomeric from the D19S220 locus (Table 1, Fig. 3). These results suggested that the amplified DNA fragments independently cloned in PANC1 cells constituted a single amplicon. According to the physical map of human chromosome 19 (12), the D19S220 locus was located less than 2 megabases from the AKT2 oncogene that was amplified and overexpressed in 10% of ovarian cancers (13). We therefore investigated the involvement of AKT2 gene amplification in pancreatic cancers. Amplification and overexpression of the AKT2 gene in pancreatic cancers. As shown in Fig. 2A, the AKT2 gene was amplified in the PANC1, KP1N and BXPC3 cell lines to the level found in DNA 4. AKT2 gene overexpression in these cell lines was also detected by northern blotting (Fig. 2C). The AKT2 gene was amplified in 3 of 20 primary pancreatic cancers analyzed (Fig. 2B). The level of amplification in these primary pancreatic cancers was 970
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Amplification and overexpression of the AKT2 gene in pancreatic cancers. A, Southern blot analysis of genomic DNAs digested with the restriction endonuclease MboI. DNAs were isolated from pancreatic cancer cell lines: 1, PANC1; 2, PSN1; 3, ASPC1; 4, MiaPaCa2; 5, BXPC3; 6, CFPAC2; 7, CAPAN1; 8, CAPAN2; 9, H48N; 10, FA6; 11, KP1N; and 12, KP2N. Lane 13 contained DNA from lymphocytes as a normal control. Fragments were Southern blotted and hybridized with DNA 4, AKT2 and N-myc probes. DNAs from PANC1, KP1N and normal lymphocytes were separately hybridized with TGFb1, CEA and N-myc probes. B, DNAs were isolated from primary pancreatic cancers (T) and their normal counterparts (N). The same membrane was used for hybridization with the AKT2 and N-myc probes. C, Northern blot analysis of RNA isolated from pancreatic cancer cell lines: 1, PANC1; 2, PSN1; 3, ASPC1; 4, MiaPaCa2; 5, BXPC3; 6, CAPAN1; 7, H48N; 8, FA6; 9, KP1N; and 10 KP2N. The same membrane was used for hybridization with the AKT2 and b-actin probes.
estimated to be 3 to 4 fold, which was relatively lower than that in the cell lines. However, samples from primary pancreatic cancers contained a significant amount of normal DNA, which might cause the level of AKT2 amplification to be underestimated. As the TGFb1 and CEA genes were mapped about 1.0 and 1.5 megabases telomeric from the AKT2 locus, respectively (12), their amplification was similarly analyzed. However, in both PANC1 and KP1N cells, there was no apparent amplification of these two genes (Fig. 2A), indicating that telomeric end of the amplicon could be less than 1.0 megabases telomeric from the AKT2 locus. DISCUSSION Several genetic alterations are consistently identified in human pancreatic cancers, such as mutations of the K-ras gene (ú80%), the P53 gene (50%) (14, 15) and mutations or homozy971
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1 STSs and Primers for Their Amplification by PCR
STS
Fragment size (base pair)
Distance from D19S220 (centiRay)
DNA1
1088
10.9 (telomeric)
DNA2
639
9.54 (telomeric)
DNA4
436
13.81 (telomeric)
DNA5
326
Primer (5* to 3*) AGAATCCCCGATTCCTATTT CTGTAGCCTTGCACAAATGA AGGCCGAGAAATGGACAGAT TTCCCCAGCCTGGCCATCAG GCAGTCCGGGAGCCGGGGAC GCTGGCTTTCCTGGCACACT GTCTGGGGCTGTGAAGCAGG TCAGCCTCCCAAAGTGCTCA
1.5 (centromiric)
gous deletions of the P16 gene (ú85%) (16). Some growth factors and growth factor receptors are also overexpressed in pancreatic cancers (17). We also searched for abnormal genes in primary pancreatic cancers (18-21). However, the molecular events that cause this distinctively agressive neoplasm have not yet been elucidated. To deepen understanding of the genetic alterations involved in pancreatic cancer, we used RLGS, which enabled genome-wide analysis of DNA alterations. We detected several DNA fragments amplified in human pancreatic cancer cell lines by RLGS fingerprinting and assigned the corresponding DNA clones to chromosome 19q13.1-q13.2, where DNA amplification had not been identified in this cancer. The AKT2 gene is a human cellular homologues of the viral oncogene v-akt and encodes a serine-threonine protein kinase (13). The AKT2 gene mapped at chromosome 19q13.1-q13.2 was found to be amplified and overexpressed in about 10% of ovarian cancers (13). Our RLGS
FIG. 3. Mapping of cloned DNA fragments using the Genebridge 4 radiation hybrid panel. The orders of DNAs 1, 2 (3), 4, and 5 determined by the radiation hybrid panels are indicated. Distances determined by radiation doses are indicated as centiRays (cR). One centiRays corresponds to 0.48 centimorgans that are about 285 kilobase pairs on the average at chromosome 19 (11). The AKT2, TGFb1 and CEA genes have been mapped in the region between the D19S220 and WI-7903 loci. The precise relationship between the order of DNAs 1 to 5 and that of these genes remain unclear and therefore loci for the AKT2, TGFb1 and CEA genes are not indicated. 972
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
fingerprinting of pancreatic cancer DNA revealed the amplification of a chromosomal region containing the AKT2 gene. Very recently Chang et al. found the amplified AKT2 gene in human panceratic cancer cell lines PANC1 and ASPC1, and also 1 of 10 primary tumor specimens by Southern blot analysis using genomic AKT2 probe (22). AKT2 gene amplification and overexpression in pancreatic cancers suggest that this gene is an oncogene implicated in the genesis or development of this disorder. Recently, the AKT2 gene has been revealed to be a target of the PDGF-activated phosphatidylinositol 3-kinase (23). Since the PDGFb gene is also overexpressed in pancreatic cancers (24), aberrations of the AKT2 gene might play a role in pancreatic carcinogenesis through the PDGF-mediated signal transduction pathway. The TGFb1 gene encoding a potent growth inhibitor and mapped 1.0 megabases telomeric from the AKT2 locus was not amplified in PANC1 and KP1N cells, suggesting the exclusion of genes disadvantageous for the growth of pancreatic cancer cells from the amplicon. ACKNOWLEDGMENTS We are grateful to Drs. M. Iizuka and M. Shiraishi for helpful discussions and comments.
REFERENCES 1. Hatada, I., Hayashizaki, Y., Hirotsune, S., Komatsubara, H., and Mukai, T. (1991) Natl. Acad. Sci. USA 88, 9523–9527. 2. Hirotsune S., Hatada, I., Komatsubara, H., Nagai, H., Kuma, K., Kobayakawa, K., Kawara, T., Nakagawara, A., Fujii, K., Mukai, T., and Hayashizaki, Y. (1992) Cancer Res. 52, 3642–3647. 3. Nagai, H., Ponglikitmongkol, M., Mita, E., Ohmachi, Y., Yoshikawa, H., Saeki, R., Yumoto, Y., Nakanishi, T., and Matsubara, K. (1994) Cancer Res. 54, 1545–1550. 4. Hirotsune, S., Shibata, H., Okazaki, Y., Sugino, H., Imoto, H., Sasaki, N., Hirose, K., Okuizumi, H., Muramatsu, M., Plass, C., Chapman, V, M., Tamatsukuri, S., Miyamoto, C., Furuichi, Y., and Hayashizaki, Y. (1993) Biochem. Biophys. Res. Commun. 194, 1406–1412. 5. Miwa, W., Yashima, K., Sekine, T., and Sekiya, T. (1995) Electrophoresis 16, 227–232. 6. Ikeda, Y., Ezaki, M., Hayashi, I., Yasuda, D., Nakayama, K., and Kono, A. (1990) Jpn. J. Cancer Res. 81, 987– 993. 7. Yamada, H., Yoshida, T., Sakamoto, H., Terada, M., and Sugimura, T. (1986) Biochem. Biophys. Res. Commun. 140, 167–173. 8. Oikawa, S., Nakazato, H., and Kosaki, G. (1987) Biochem. Biophys. Res. Commun. 142, 511–518. 9. Jokhi, P. P., King, A., Sharkey, A. M., Smith, S. K., and Loke, Y. W. (1994) J. Immunol. 153, 4427–4435. 10. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403–410. 11. Hudoson, T. J., Stein, L. D., Gerety, S. S., Ma, J., Castle, A. B., Silva, J., Slonim, D. K., Baptista, R., Krugyyak, L., Xu, S.-H., Hu. Xintong., Colbert, A. M. E., Rosenberg, C., Reeve-Daly, M. P., Rozen, S., Hui, L., Wu, X., Vestergaard, C., Wilson, K. M., Bae, J. S., Marita, S., Ganiatsas, S., Evans., C.A., DeAngelis, M. M., Ingalls, K. A., Nahf, R. W., Horton Jr., L. T., Anderson, M. O., Collymore, A. J., Ye, W., Kouyoumjian, V., Zemsteva, I. S., Tam, J., Devain, R., Courtney, D. F., Renaud, M. T., Nguyen, H., O’Connor, T. J., Fizames, C., Faure, S., Gyapay, G., Dib, C., Morissette, J., Orlin, J. B., Birren,B. W., Goodman, N., Weissenbach, J., Hawkins, T. W., Foote, S., Page, D. C., and Lander, E. S. (1995) Science 270, 1945–1954. 12. Ashoworth, L. K., Batzer, M. A., Brandriff, B., Branscomb, E., Jong, P. D., Garcia, E., Garnes, J. A., Gordon, L. A., Lamerdin, J. E., Lennon, G., Mohrenweiser, H., Oslen, A. S., Slezak, T., Carrano, A. V. (1995) Nature Genet. 11, 422–427. 13. Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., Tsichlis, P. N., and Testa, J. R. (1992) Proc. Natl. Acad. Sci. USA 89, 9267–9271. 14. Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N., and Perucho, M. (1988) Cell 53, 549–554. 15. Pellegata, N. S., Sessa, F., Renault, B., Bonato, M., Leone, B. E., Solcia, E., and Ranzani, G. N. (1994) Cancer Res. 54, 1556–1560. 16. Caldas, C., Hahn, S. A., da Costa, L. T., Redston, M. S., Schutte, M., Seymour, A. B., Weinstein, C. L., Hruban, R. H., Yeo, C. J., and Kern, S. E. (1994) Nature Genet. 8, 27–32. 17. Korc, M., Chandrasekar, B., Yamanaka, Y., Friess, H., Buchier, M., and Beger, H. G. (1992) J. Clin. Invest. 90, 1352–1360. 18. Sekiya, T., Murakami, Y., and Hayashi, K. (1993) Int. J. Pancreatol. 13, 69–78. 19. Nakamori, S., Yashima, K., Murakami, Y., Ishikawa, O., Ohigashi, H., Imaoka, S., Yaegashi, S., Konishi, Y., and Sekiya, T. (1995) Jpn. J. Cancer Res. 86, 174–181. 973
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC
Vol. 225, No. 3, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
20. Yashima, K., Nakamori, S., Murakami, Y., Yamaguchi, A., Hayashi, K., Ishikawa, O., Konishi, Y., and Sekiya, T. (1994) Int. J. Cancer 59, 43–47. 21. Shimizu, T., Miwa, W., Nakamori, S., Ishikawa, O., and Sekiya, T. (1996) Jpn. J. Cancer Res. 87, 275–278. 22. Cheng, J. Q., Ruggeri, B., Klein, W. M., Sonoda, G., Altomare, D. A., Watson D. K. and Testa, J. R. (1996) Proc. Natl. Acad. Sci. USA 93, 3636–3641. 23. Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R., and Tsichlis, P. N. (1995) Cell 81, 727–736. 24. Ebert, M., Yokoyama, M., Friess, H., Kobrin, M. S., Buchler, M. W., and Korc, M. (1995) Int. J. Cancer 62, 529–535.
974
AID
BBRC 5255
/
6907$$$661
08-06-96 13:46:11
bbrca
AP: BBRC