- Email: [email protected]
Isolation of Klebsiella pneumoniae and Pseudomonas aeruginosa from entomopathogenic nematode-insect host relationship to examine bacterial pathogenicity on Trichoplusia ni
Microbial Pathogenesis 135 (2019) 103606
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Isolation of Klebsiella pneumoniae and Pseudomonas aeruginosa from entomopathogenic nematode-insect host relationship to examine bacterial pathogenicity on Trichoplusia ni
T
Yanhui Hea,b, Qiuju Qinb,c, Michael J. DiLeggeb, Jorge M. Vivancob,∗ a
School of Chemistry and Chemical Engineering, The Key Lab for Green Processing of Chemical Engineering of Xinjiang Bingtuan, Shihezi University, Shihezi, 832003, PR China b Center for Rhizosphere Biology and Department of Horticulture and Landscape Architecture, Colorado State University, Fort Collins, CO, 80523, USA c Agricultural University of Hebei Province, Baoding, 071000, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Heterorhabditis bacteriophora Bio-control Klebsiella pneumonia Pseudomonas aeruginosa Larvae
Klebsiella pneumoniae was isolated from infected pupae of Galleria mellonella and Pseudomonas aeruginosa was isolated from the entomopathogenic nematode Heterorhabditis bacteriophora hosted within the pupae of G. mellonella. Insect consumption and surface application of P. aeruginosa resulted in 83.33% and 81.66% mortality of Trichoplusia ni larvae, respectively. In contrast, 50% mortality was shown when T. ni larvae were fed with K. pneumoniae, and no larvae were killed when applying the bacterium to the larval cuticle. This report shows that two opportunistic human pathogens found in the insect-nematode ecosystem could kill insect pests.
1. Introduction The entomopathogenic nematode Heterorhabditis bacteriophora is known for its parasitism to various insect pests [1–4]. Members of the genus Heterorhabditis are known to vector bacterial endosymbionts such as Photorhabdus which are released inside the nematode's insect host [5,6]. Photorhabdus luminescens is responsible for causing insect mortality in 24–48 h after nematode infection [7,8]. Previously, it has been reported that the nematode H. bacteriophora, hosting the symbiotic bacterium Photorhabdus temperate, was observed to enter and release the bacterium into the insects' hemolymph; thus disrupting the cellular immune defense responses [1]. In addition, Photorhabdus bacteria can actively degrade the insect host by secreting toxins and proteases after penetration, which creates a nutrient-rich environment to sustain the growth and development of H. bacteriophora nematodes [9–11]. It has been observed that P. luminescens expresses a symbiosis with H. bacteriophora through a series of coordinated responses [3,12]. Recently, Del Valle et al. [13] reported that P. luminiscens subsp. laumondii DSPV002 N caused between 37% and 46% mortality of Alphitobius diaperinus larval stages when the bacterium was applied to rice hulls in isolation. To our knowledge, no study has reported on the isolation of microorganisms different from P. luminescens resulting from culturing the microbial symbionts within H. bacteriophora or the infected insect cadaver. The major purposes of this study were (i) to isolate native
∗
bacteria from H. bacteriophora hosted in Galleria mellonella pupae and (ii) to determine the potential biological control effect of the native bacteria against Trichoplusia ni larvae. 2. Methods 2.1. Isolation and identification of bacteria from the Heterorhabditis bacteriophora - Galleria mellonella ecosystem The infected pupal-cadavers of G. mellonella were collected from a commercial farm in which these insects are actively reared, infected with juveniles of H. bacteriophora nematodes, and distributed to the fields as a means of biological control. The infected pupal-cadavers of G. mellonella were surface-sterilized with 70% alcohol and cut with a No. 10 scalpel blade and placed on fresh modified LB agar media plates [3]. Modified LB agar media contains: 5.0 g peptone; 3.0 g yeast extract (YE); 3.0 ml glycerol; 1.0 g sodium chloride; 5 mg magnesium sulfate; 15 g agar; 1000 H2O. The bacteria were isolated by scraping the inside contents of the pupal-cadaver off and spreading them onto the modified LB agar media plates (Fig. S1A). The experiment was carried out at least five times and these plates were incubated at 28 °C for 24 h. Every time the internal contents of the pupae were cultured, at least one cream colored bacterial colony was found along with several other non-indicative bacterial colonies. The cream-colored colony was later
Corresponding author. E-mail address: [email protected] (J.M. Vivanco).
https://doi.org/10.1016/j.micpath.2019.103606 Received 5 March 2019; Received in revised form 18 June 2019; Accepted 19 June 2019 Available online 20 June 2019 0882-4010/ © 2019 Elsevier Ltd. All rights reserved.
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
3. Results
identified as K. pneumoniae and suggests the presence of this microbe within the insect cadaver. Surface-sterilized dead G. mellonella pupae infected with H. bacteriophora were individually dissected on 9 cm fresh modified LB agar plates (Fig. S2). Viable juveniles of H. bacteriophora nematodes were observed in the insect carcass using a dissection microscope (Motic K700P, Canada). H. bacteriophora nematodes (approximately 5 individuals) were carefully transferred to a new Petri dish. After isolation from the insect carcass, one nematode was transferred to a new Petri dish containing LB agar media. In the new plates, the nematodes were wounded with a fine scalpel to excise the inner contents which were subsequently spread onto a fresh modified LB agar plate. The transfer and cutting of the juvenile nematodes were carried out at least five times in a laminar flow hood and cultures were incubated at 28 °C for 24 h. At the end of the incubation period, green bacterial colonies were observed on the plates (Fig. S1B), and discrete colonies were picked aseptically via the use of an inoculation loop and re-cultured onto another Petri dish with fresh modified LB agar. After individual colony isolation, the cultures were incubated for 24 h at 28 °C. Individual colonies were isolated and sub-cultured twice to ensure purity. One green colored bacterial colony was isolated with this methodology. The two bacterial isolates were identified via 16S rRNA gene amplification and subsequently matching the results to the GenBank reference database (MIDI labs, Inc., Newark, DE). Universal bacterial primers 0005F (5’ – TGGAGAGTTTGATCCTGGCTCAG – 3′) and 0531R (5’ - TACCGCGGCTGCTGGCAC – 3’) were used to amplify the 16S gene of each bacterial isolate. Additionally, a 64-well VITEK 2 GN card consisting 47 biochemical tests measuring carbon source utilization, inhibition and resistance, and enzymatic activities were processed in the Veterinary Diagnostic Lab at Colorado State University (Fort Collins, CO) for additional confirmation of the bacterial identification.
3.1. Identification of bacteria The two bacteria isolated from G. mellonella and H. bacteriophora were identified by sequencing of the 16S rRNA gene. Phylogenetic trees for both of the isolates are provided (Fig. S3). The first bacterium expressed cream-colored colonies and was found repeatedly when spreading the internal contents of G. mellonella larvae onto an LB agar plate. This bacterium was identified as Klebsiella pneumoniae (KP) (NCBI Accession No: KF192506; 99% GenBank similarity). The second bacterium had green-colored colonies and was isolated from the H. bacteriophora nematode. This bacterium was identified as Pseudomonas aeruginosa (PA) (NCBI Accession No: CP007224; 99% GenBank similarity). P. aeruginosa was not isolated from all tested nematodes. The biochemical tests performed on the bacteria confirmed the GenBank database match of the bacterial DNA sequence. 3.2. Trichoplusia ni killing bioassays Preliminary experiments showed that both K. pneumonia and P. aeruginosa could kill T. ni larva (Fig. S4). K. pneumonia was able to kill 50% of T. ni larvae when ingested after 3 days (Fig. 1). In contrast, feeding the T. ni larvae with overnight-cultured P. aeruginosa resulted in 83.33% larval mortality. The mortality of insects treated with K. pneumoniae and P. aeruginosa was significantly higher when compared to the control (P value = 0.05). Based on this observation, further experiments were conducted by immersing T. ni larvae into cell suspensions of K. pneumoniae or P. aeruginosa prior to feeding. As shown in Table 1, P. aeruginosa suspension applied onto the larvae killed T. ni. Additionally, when T. ni larvae were immersed into the cell suspension of P. aeruginosa 50% mortality was observed after 2 days, and 81.66% after 3 days. These results were similar to those observed when feeding the P. aeruginosa overnight cultures to the larvae. However, insect larvae treated with cell suspensions of K. pneumoniae or LB media alone (control) expressed no mortality.
2.2. Trichoplusia ni killing bio-assays The two isolated bacteria were incubated in liquid modified LB media overnight at room temperature. The next day, 100 μl of culture media was spread on modified LB agar and subsequently incubated overnight at 28 °C. Larvae of T. ni were raised in the lab and fed a special artificial food (Frontier Agricultural Sciences, Newark, DE), and colonies were kept at 25 °C with 16L: 8D photoperiod conditions. Individual larva corresponding to the 4th instar of T. ni were placed in a Petri dish and fed overnight with each isolated bacterial culture. The plates were incubated at 25 °C for 3 days to monitor the mortality of T. ni. T. ni fed with sterile modified LB agar media alone was used as a control. Three repeated trials of this experiment were conducted, and ten or twenty insect replicates were used to test the pathogenicity of each bacterium. T. ni larvae were considered to be dead when they no longer responded to prodding. Additionally, cell suspensions of each bacterium (OD600 = 1.5 × 108 cfu/ml) were prepared after fermentation, centrifuged at 3000×g and used for T. ni killing assays. The 4th instar T. ni larvae were immersed in the bacterial cell suspension for 20 s then separated to one larva per Petri dish and were fed with fresh modified LB agar media as described above. These experiments were repeated three times (three cycles) with 10 or 20 insect replicates per experimental trial.
4. Discussion Many studies have examined the virulence of K. pneumoniae and P. aeruginosa isolated from hospital or clinical settings as opportunistic human pathogens [14,15]. K. pneumoniae, a gram-negative bacterium belonging to Enterobacteriaceae, is highly successful, versatile and one of the leading human pathogens known to cause both nosocomial - and community-acquired infections [16]. P. aeruginosa is a common gramnegative bacterium that is an opportunistic pathogen of vertebrates, humans [17], insects [18–20], and nematodes [21,22]. In our study, we
2.3. Statistical analyses Results are shown as mean with standard error of three replicates. The data were subjected to one-way ANOVA and Tukey's multiple range tests using origin 8.5 statistical software (OriginLab, Wellesley, MA, USA) at p = 0.05 to detect statistical significance.
Fig. 1. Trichoplusia ni larval mortality after three days feeding with Klebsiella pneumoniae or Pseudomonas aeruginosa, LB corresponds to the control. 2
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
5. Conclusion
Table 1 Trichoplusia ni larval mortality after surface application with Klebsiella pneumoniae or Pseudomonas aeruginosa suspensions, LB corresponds to the control. Treatment
Time (day)
First cycle DN (10 larval)
Second cycle DN (20 larval)
Third cycle DN (10 larval)
Mortality (%)
LB
1 2 3 1 2 3 1 2 3
0 0 0 0 7 10 0 0 0
0 0 0 0 8 15 0 0 0
0 0 0 0 4 7 0 0 0
0 0 0 0 50.00 ± 17.32 81.66 ± 16.07 0 0 0
Pseudomonas aeruginosa Klebsiella pneumoniae
This work isolated a new pathogen of Trichoplusia ni (P. aeruginosa) insects that could be delivered by H. bacteriophora to cause mortality. In addition, a potential mechanism involving primary and secondary infection is described in this study. Conflicts of interest No conflict of interest declared. Acknowledgments This study was supported by Colorado State University Agricultural Experiment Station. Yanhui was supported by China Scholarship Council (No. 201709505007).
DN: Death number of larvae.
Appendix A. Supplementary data
isolated K. pneumoniae from G. mellonella and P. aeruginosa from H. bacteriophora, and subsequently examined their capability of killing T. ni. Our results show that the nematode H. bacteriophora is immune to the pathogenicity of P. aeruginosa, but rather acts as a vector expressing a potential symbiosis with this bacterium. Previous reports have shown that P. aeruginosa infects the free-living nematode Caenorhabditis elegans under experimental conditions and the virulence factors accounting for infectivity were determined [23,24]. In our study, P. aeruginosa effectively killed T. ni larvae by either feeding or by surface-application of the bacterium, and total insect mortality was 83.33% and 81.66%, respectively. In contrast, the effective pathogenicity of K. pneumoniae for T. ni was 50% for feeding and 0% for surface application. We hypothesize that K. pneumonia is a secondary and opportunistic pathogen of insects that requires the primary pathogenicity of stronger microbes such as P. aeruginosa to manifest virulence. Similar studies in lung infections have reported that P. aeruginosa is the primary pathogen and that other pathogens account for secondary infections once the organism’ defenses are compromised [25]. Inman and Holmes (2012) reported that antibacterial activity of metabolites secreted by the phase I variant of Photorhabdus luminescens were screened against 28 different bacterial species and strains [26]. Interestingly, it has been revealed that K. pneumoniae injected into G. mellonella killed the larvae due to a combination of factors such as cell death, phagocytes avoiding phagocytosis, as well as the attenuation of defense responses [27]. It should be noted that in the Insua et al. (2013) study K. pneumoniae was not isolated from G. mellonella insects but was simply tested on this insect. Other studies have illustrated that the adhesins, lipopolysaccharides, and secondary metabolites produced by K. pneumoniae in fermentation broth were the potential virulence factors against G. melonella [16]. In a recent study, the mortality rate of Zophobas morio larvae was increased when P. aeruginosa was applied to larvae experiencing cuticle damage or open wounds as compared to wounded larvae not exposed to the bacterium [18]. Insect mortality has been associated with the accumulation of bacterial cells in the insect or nematode's intestine [21]. Toxic compounds produced by the bacterium such as extracellular proteinases and metalloproteases are exported throughout the host's body as a result of intestinal infection [18,28,29]. Interestingly, the active enzymes (metalloproteases alkaline proteinase, Prt protease) were hypothesized to degrade insect tissues during bioconversion of peptides and amino acids to smaller sulphur, nitrogen, and phosphorus compounds after the insect's death [30]. Presumably, this might be one of the mechanisms that account for the carcass degradation of G. mellonella; which is the preferred environment for reproduction of H. bacteriophora nematodes.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2019.103606. References [1] R. An, K. Suri, J. Jurat‐Fuentes, P. Grewal, Dynamics of transcriptomic response to infection by the nematode Heterorhabditis bacteriophora and its bacterial symbiont Photorhabdus temperata in Heliothis virescens larvae, Insect Mol. Biol. 26 (2017) 584–600 https://doi.org/10.1111/imb.12321. [2] J. Vadnal, R. Ratnappan, M. Keaney, E. Kenney, I. Eleftherianos, D. O'Halloran, et al., Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora, BMC Genomics 18 (2017) 8 https://doi. org/10.1186/s12864-016-3468-6. [3] S. Singh, M. Eric, I. Floyd, H.D. Leonard, Characterization of Photorhabdus luminescens growth for the rearing of the beneficial nematode Heterorhabditis bacteriophora, Indian J. Microbiol. 52 (2012) 325–331 https://doi.org/10.1007/s12088011-0238-7. [4] S. Arthurs, K. Heinz, J. Prasifka, An analysis of using entomopathogenic nematodes against above-ground pests, Bull. Entomol. Res. 94 (2004) 297–306. [5] A. Abdolmaleki, Z. Maafi, H. Dastjerdi, B. Naseri, A. Ghasemi, Immune defense of Pieris brassicae larvae in challenged with Heterorhabditis bacteriophora, its symbiotic bacteria and metabolites, ISJ 14 (2017) 73–84. [6] C.G. Bhat, K. Chauhan, V. Phani, P.K. Papolu, U. Rao, V.S. Somvanshi, Expression of Heterorhabditis bacteriophora C-type lectins, Hb-clec-1 and Hb-clec-78, in context of symbiosis with Photorhabdus bacteria, Symbiosis (2018), https://doi.org/10.1007/ s13199-018-0569-9. [7] R. Rae, M. Riebesell, I. Dinkelacker, Q. Wang, M. Herrmann, A.M. Weller, et al., Isolation of naturally associated bacteria of necromenic Pristionchus nematodes and fitness consequences, J. Exp. Biol. 211 (2008) 1927–1936 https://doi.org/10.1242/ jeb.014944. [8] R. Salgado-Morales, N. Rivera-Gómez, F. Martínez-Ocampo, L.F.L.-A. Beltrán, A. Hernández-Mendoza, E. Dantán-González, Draft genome sequence of Photorhabdus luminescens HIM3 isolated from an Entomopathogenic nematode in agricultural soils, Genome Announc. 5 (2017) e00745-17 https://doi.org/10.1128/ genomeA.00745-17. [9] S.P. Stock, A. Kusakabe, R.A. Orozco, Secondary metabolites produced by Heterorhabditis Symbionts and their application in agriculture: what we know and what to do next, J. Nematol. 49 (2017) 373. [10] T.A. Ciche, K-s Kim, B. Kaufmann-Daszczuk, K.C.Q. Nguyen, D.H. Hall, Cell invasion and matricide during Photorhabdus luminescens transmission by Heterorhabditis bacteriophora nematodes, Appl. Environ. Microbiol. 74 (2008) 2275–2287 https:// doi.org/10.1128/aem.02646-07. [11] C.M. Cabral, A. Cherqui, A. Pereira, N. Simões, Purification and characterization of two distinct metalloproteases secreted by the entomopathogenic bacterium Photorhabdus sp. strain Az29, Appl. Environ. Microbiol. 70 (2004) 3831–3838 https://doi.org/10.1128/aem.70.7.3831-3838.2004. [12] N.J. Tobias, A.K. Heinrich, H. Eresmann, P.R. Wright, N. Neubacher, R. Backofen, et al., Photorhabdus‐nematode symbiosis is dependent on hfq‐mediated regulation of secondary metabolites, Environ. Microbiol. 19 (2017) 119–129 https://doi.org/10. 1111/1462-2920.13502. [13] E.E. Del Valle, L.S. Frizzo, M. Malmierca, M.V. Zbrun, P. Lax, M.E. Doucet, Biological control of Alphitobius diaperinus with Steinernema rarum CUL and Heterorhabditis bacteriophora SMC and feasibility of application in rice hull, J. Pest. Sci. 89 (2016) 161–170 https://doi.org/10.1007/s10340-015-0669-8. [14] K.E. Holt, H. Wertheim, R.N. Zadoks, S. Baker, C.A. Whitehouse, D. Dance, et al., Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health, Proc. Natl. Acad. Sci. U.S.A. 112 (2015) E3574–E3581 https://doi.org/10.1073/pnas. 1501049112.
3
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
53 (2009) 4891–4897 https://doi.org/10.1128/aac.00380-09. [23] M.W. Tan, L.G. Rahme, J.A. Sternberg, R.G. Tompkins, F.M. Ausubel, Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa virulence factors, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 2408–2413. [24] V. Kaitala, L. Ruokolainen, R.D. Holt, J.K. Blackburn, I. Merikanto, J. Anttila, et al., Population dynamics, invasion, and biological control of environmentally growing opportunistic pathogens, Modeling the Transmission and Prevention of Infectious Disease, Springer, 2017, pp. 213–245. [25] J.A. Driscoll, S.L. Brody, M.H. Kollef, The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections, Drugs 67 (2007) 351–368 https://doi. org/10.2165/00003495-200767030-00003. [26] F.L. Inman III, L. Holmes, Antibacterial screening of secreted compounds produced by the phase I variant of Photorhabdus luminescens, Indian J. Microbiol. 52 (2012) 708–709, https://doi.org/10.1007/s12088-012-0307-6. [27] J.L. Insua, E. Llobet, D. Moranta, C. Pérez-Gutiérrez, A. Tomás, J. Garmendia, et al., Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella, Infect. Immun. 81 (2013) 3552–3565 https://doi.org/10.1128/iai. 00391-13. [28] A. Kamaladevi, K. Balamurugan, Role of PMK-1/p38 MAPK defense in Caenorhabditis elegans against Klebsiella pneumoniae infection during host–pathogen interaction, Pathog. Dis. 73 (2015), https://doi.org/10.1093/femspd/ftv021. [29] M. Andrejko, A. Zdybicka-Barabas, M. Cytryńska, Diverse effects of Galleria mellonella infection with entomopathogenic and clinical strains of Pseudomonas aeruginosa, J. Invertebr. Pathol. 115 (2014) 14–25 https://doi.org/10.1016/j.jip.2013.10. 006. [30] P.J. Daborn, N. Waterfield, M.A. Blight, R.H. Ffrench-Constant, Measuring virulence factor expression by the pathogenic bacterium Photorhabdus Luminescens in culture and during insect infection, J. Bacteriol. 183 (2001) 5834–5839 https://doi.org/10. 1128/jb.183.20.5834-5839.2001.
[15] C.A. Sutherland, D.P. Nicolau, Susceptibility profile of ceftolozane/tazobactam and other parenteral antimicrobials against Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa from US hospitals, Clin. Ther. 37 (2015) 1564–1571 https://doi.org/10.1016/j.clinthera.2015.05.501. [16] M.E. Wand, J.W. McCowen, P.G. Nugent, J.M. Sutton, Complex interactions of Klebsiella pneumoniae with the host immune system in a Galleria mellonella infection model, J. Med. Microbiol. 62 (2013) 1790–1798 https://doi.org/10.1099/jmm.0. 063032-0. [17] P. Yorgey, L.G. Rahme, M.W. Tan, F.M. Ausubel, The roles of mucD and alginate in the virulence of Pseudomonas aeruginosa in plants, nematodes and mice, Mol. Microbiol. 41 (2001) 1063–1076 https://doi.org/10.1046/j.1365-2958.2001. 02580.x. [18] G. Maciel-Vergara, A.B. Jensen, J. Eilenberg, Cannibalism as a possible entry route for opportunistic pathogenic bacteria to insect hosts, exemplified by Pseudomonas aeruginosa, a pathogen of the giant mealworm Zophobas morio, Insects 9 (2018) 88 https://doi.org/10.3390/insects9030088. [19] G. Jander, L.G. Rahme, F.M. Ausubel, Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects, J. Bacteriol. 182 (2000) 3843–3845 https://doi.org/10.1128/jb.182.13.3843-3845.2000. [20] Y. Chieda, K. Iiyama, J.M. Lee, T. Kusakabe, C. Yasunaga-Aoki, S. Shimizu, Virulence of an exotoxin A-deficient strain of Pseudomonas aeruginosa toward the silkworm, Bombyx mori, Microb. Pathog. 51 (2011) 407–414 https://doi.org/10. 1016/j.micpath.2011.09.002. [21] M.W. Tan, S. Mahajan Miklos, F.M. Ausubel, Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 715–720 https://doi.org/10.1073/pnas.96.2.715. [22] E. Papaioannou, M. Wahjudi, P. Nadal-Jimenez, G. Koch, R. Setroikromo, W.J. Quax, Quorum-quenching acylase reduces the virulence of Pseudomonas aeruginosa in a Caenorhabditis elegans infection model, Antimicrob. Agents Chemother.
4
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Isolation of Klebsiella pneumoniae and Pseudomonas aeruginosa from entomopathogenic nematode-insect host relationship to examine bacterial pathogenicity on Trichoplusia ni
T
Yanhui Hea,b, Qiuju Qinb,c, Michael J. DiLeggeb, Jorge M. Vivancob,∗ a
School of Chemistry and Chemical Engineering, The Key Lab for Green Processing of Chemical Engineering of Xinjiang Bingtuan, Shihezi University, Shihezi, 832003, PR China b Center for Rhizosphere Biology and Department of Horticulture and Landscape Architecture, Colorado State University, Fort Collins, CO, 80523, USA c Agricultural University of Hebei Province, Baoding, 071000, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Heterorhabditis bacteriophora Bio-control Klebsiella pneumonia Pseudomonas aeruginosa Larvae
Klebsiella pneumoniae was isolated from infected pupae of Galleria mellonella and Pseudomonas aeruginosa was isolated from the entomopathogenic nematode Heterorhabditis bacteriophora hosted within the pupae of G. mellonella. Insect consumption and surface application of P. aeruginosa resulted in 83.33% and 81.66% mortality of Trichoplusia ni larvae, respectively. In contrast, 50% mortality was shown when T. ni larvae were fed with K. pneumoniae, and no larvae were killed when applying the bacterium to the larval cuticle. This report shows that two opportunistic human pathogens found in the insect-nematode ecosystem could kill insect pests.
1. Introduction The entomopathogenic nematode Heterorhabditis bacteriophora is known for its parasitism to various insect pests [1–4]. Members of the genus Heterorhabditis are known to vector bacterial endosymbionts such as Photorhabdus which are released inside the nematode's insect host [5,6]. Photorhabdus luminescens is responsible for causing insect mortality in 24–48 h after nematode infection [7,8]. Previously, it has been reported that the nematode H. bacteriophora, hosting the symbiotic bacterium Photorhabdus temperate, was observed to enter and release the bacterium into the insects' hemolymph; thus disrupting the cellular immune defense responses [1]. In addition, Photorhabdus bacteria can actively degrade the insect host by secreting toxins and proteases after penetration, which creates a nutrient-rich environment to sustain the growth and development of H. bacteriophora nematodes [9–11]. It has been observed that P. luminescens expresses a symbiosis with H. bacteriophora through a series of coordinated responses [3,12]. Recently, Del Valle et al. [13] reported that P. luminiscens subsp. laumondii DSPV002 N caused between 37% and 46% mortality of Alphitobius diaperinus larval stages when the bacterium was applied to rice hulls in isolation. To our knowledge, no study has reported on the isolation of microorganisms different from P. luminescens resulting from culturing the microbial symbionts within H. bacteriophora or the infected insect cadaver. The major purposes of this study were (i) to isolate native
∗
bacteria from H. bacteriophora hosted in Galleria mellonella pupae and (ii) to determine the potential biological control effect of the native bacteria against Trichoplusia ni larvae. 2. Methods 2.1. Isolation and identification of bacteria from the Heterorhabditis bacteriophora - Galleria mellonella ecosystem The infected pupal-cadavers of G. mellonella were collected from a commercial farm in which these insects are actively reared, infected with juveniles of H. bacteriophora nematodes, and distributed to the fields as a means of biological control. The infected pupal-cadavers of G. mellonella were surface-sterilized with 70% alcohol and cut with a No. 10 scalpel blade and placed on fresh modified LB agar media plates [3]. Modified LB agar media contains: 5.0 g peptone; 3.0 g yeast extract (YE); 3.0 ml glycerol; 1.0 g sodium chloride; 5 mg magnesium sulfate; 15 g agar; 1000 H2O. The bacteria were isolated by scraping the inside contents of the pupal-cadaver off and spreading them onto the modified LB agar media plates (Fig. S1A). The experiment was carried out at least five times and these plates were incubated at 28 °C for 24 h. Every time the internal contents of the pupae were cultured, at least one cream colored bacterial colony was found along with several other non-indicative bacterial colonies. The cream-colored colony was later
Corresponding author. E-mail address: [email protected] (J.M. Vivanco).
https://doi.org/10.1016/j.micpath.2019.103606 Received 5 March 2019; Received in revised form 18 June 2019; Accepted 19 June 2019 Available online 20 June 2019 0882-4010/ © 2019 Elsevier Ltd. All rights reserved.
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
3. Results
identified as K. pneumoniae and suggests the presence of this microbe within the insect cadaver. Surface-sterilized dead G. mellonella pupae infected with H. bacteriophora were individually dissected on 9 cm fresh modified LB agar plates (Fig. S2). Viable juveniles of H. bacteriophora nematodes were observed in the insect carcass using a dissection microscope (Motic K700P, Canada). H. bacteriophora nematodes (approximately 5 individuals) were carefully transferred to a new Petri dish. After isolation from the insect carcass, one nematode was transferred to a new Petri dish containing LB agar media. In the new plates, the nematodes were wounded with a fine scalpel to excise the inner contents which were subsequently spread onto a fresh modified LB agar plate. The transfer and cutting of the juvenile nematodes were carried out at least five times in a laminar flow hood and cultures were incubated at 28 °C for 24 h. At the end of the incubation period, green bacterial colonies were observed on the plates (Fig. S1B), and discrete colonies were picked aseptically via the use of an inoculation loop and re-cultured onto another Petri dish with fresh modified LB agar. After individual colony isolation, the cultures were incubated for 24 h at 28 °C. Individual colonies were isolated and sub-cultured twice to ensure purity. One green colored bacterial colony was isolated with this methodology. The two bacterial isolates were identified via 16S rRNA gene amplification and subsequently matching the results to the GenBank reference database (MIDI labs, Inc., Newark, DE). Universal bacterial primers 0005F (5’ – TGGAGAGTTTGATCCTGGCTCAG – 3′) and 0531R (5’ - TACCGCGGCTGCTGGCAC – 3’) were used to amplify the 16S gene of each bacterial isolate. Additionally, a 64-well VITEK 2 GN card consisting 47 biochemical tests measuring carbon source utilization, inhibition and resistance, and enzymatic activities were processed in the Veterinary Diagnostic Lab at Colorado State University (Fort Collins, CO) for additional confirmation of the bacterial identification.
3.1. Identification of bacteria The two bacteria isolated from G. mellonella and H. bacteriophora were identified by sequencing of the 16S rRNA gene. Phylogenetic trees for both of the isolates are provided (Fig. S3). The first bacterium expressed cream-colored colonies and was found repeatedly when spreading the internal contents of G. mellonella larvae onto an LB agar plate. This bacterium was identified as Klebsiella pneumoniae (KP) (NCBI Accession No: KF192506; 99% GenBank similarity). The second bacterium had green-colored colonies and was isolated from the H. bacteriophora nematode. This bacterium was identified as Pseudomonas aeruginosa (PA) (NCBI Accession No: CP007224; 99% GenBank similarity). P. aeruginosa was not isolated from all tested nematodes. The biochemical tests performed on the bacteria confirmed the GenBank database match of the bacterial DNA sequence. 3.2. Trichoplusia ni killing bioassays Preliminary experiments showed that both K. pneumonia and P. aeruginosa could kill T. ni larva (Fig. S4). K. pneumonia was able to kill 50% of T. ni larvae when ingested after 3 days (Fig. 1). In contrast, feeding the T. ni larvae with overnight-cultured P. aeruginosa resulted in 83.33% larval mortality. The mortality of insects treated with K. pneumoniae and P. aeruginosa was significantly higher when compared to the control (P value = 0.05). Based on this observation, further experiments were conducted by immersing T. ni larvae into cell suspensions of K. pneumoniae or P. aeruginosa prior to feeding. As shown in Table 1, P. aeruginosa suspension applied onto the larvae killed T. ni. Additionally, when T. ni larvae were immersed into the cell suspension of P. aeruginosa 50% mortality was observed after 2 days, and 81.66% after 3 days. These results were similar to those observed when feeding the P. aeruginosa overnight cultures to the larvae. However, insect larvae treated with cell suspensions of K. pneumoniae or LB media alone (control) expressed no mortality.
2.2. Trichoplusia ni killing bio-assays The two isolated bacteria were incubated in liquid modified LB media overnight at room temperature. The next day, 100 μl of culture media was spread on modified LB agar and subsequently incubated overnight at 28 °C. Larvae of T. ni were raised in the lab and fed a special artificial food (Frontier Agricultural Sciences, Newark, DE), and colonies were kept at 25 °C with 16L: 8D photoperiod conditions. Individual larva corresponding to the 4th instar of T. ni were placed in a Petri dish and fed overnight with each isolated bacterial culture. The plates were incubated at 25 °C for 3 days to monitor the mortality of T. ni. T. ni fed with sterile modified LB agar media alone was used as a control. Three repeated trials of this experiment were conducted, and ten or twenty insect replicates were used to test the pathogenicity of each bacterium. T. ni larvae were considered to be dead when they no longer responded to prodding. Additionally, cell suspensions of each bacterium (OD600 = 1.5 × 108 cfu/ml) were prepared after fermentation, centrifuged at 3000×g and used for T. ni killing assays. The 4th instar T. ni larvae were immersed in the bacterial cell suspension for 20 s then separated to one larva per Petri dish and were fed with fresh modified LB agar media as described above. These experiments were repeated three times (three cycles) with 10 or 20 insect replicates per experimental trial.
4. Discussion Many studies have examined the virulence of K. pneumoniae and P. aeruginosa isolated from hospital or clinical settings as opportunistic human pathogens [14,15]. K. pneumoniae, a gram-negative bacterium belonging to Enterobacteriaceae, is highly successful, versatile and one of the leading human pathogens known to cause both nosocomial - and community-acquired infections [16]. P. aeruginosa is a common gramnegative bacterium that is an opportunistic pathogen of vertebrates, humans [17], insects [18–20], and nematodes [21,22]. In our study, we
2.3. Statistical analyses Results are shown as mean with standard error of three replicates. The data were subjected to one-way ANOVA and Tukey's multiple range tests using origin 8.5 statistical software (OriginLab, Wellesley, MA, USA) at p = 0.05 to detect statistical significance.
Fig. 1. Trichoplusia ni larval mortality after three days feeding with Klebsiella pneumoniae or Pseudomonas aeruginosa, LB corresponds to the control. 2
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
5. Conclusion
Table 1 Trichoplusia ni larval mortality after surface application with Klebsiella pneumoniae or Pseudomonas aeruginosa suspensions, LB corresponds to the control. Treatment
Time (day)
First cycle DN (10 larval)
Second cycle DN (20 larval)
Third cycle DN (10 larval)
Mortality (%)
LB
1 2 3 1 2 3 1 2 3
0 0 0 0 7 10 0 0 0
0 0 0 0 8 15 0 0 0
0 0 0 0 4 7 0 0 0
0 0 0 0 50.00 ± 17.32 81.66 ± 16.07 0 0 0
Pseudomonas aeruginosa Klebsiella pneumoniae
This work isolated a new pathogen of Trichoplusia ni (P. aeruginosa) insects that could be delivered by H. bacteriophora to cause mortality. In addition, a potential mechanism involving primary and secondary infection is described in this study. Conflicts of interest No conflict of interest declared. Acknowledgments This study was supported by Colorado State University Agricultural Experiment Station. Yanhui was supported by China Scholarship Council (No. 201709505007).
DN: Death number of larvae.
Appendix A. Supplementary data
isolated K. pneumoniae from G. mellonella and P. aeruginosa from H. bacteriophora, and subsequently examined their capability of killing T. ni. Our results show that the nematode H. bacteriophora is immune to the pathogenicity of P. aeruginosa, but rather acts as a vector expressing a potential symbiosis with this bacterium. Previous reports have shown that P. aeruginosa infects the free-living nematode Caenorhabditis elegans under experimental conditions and the virulence factors accounting for infectivity were determined [23,24]. In our study, P. aeruginosa effectively killed T. ni larvae by either feeding or by surface-application of the bacterium, and total insect mortality was 83.33% and 81.66%, respectively. In contrast, the effective pathogenicity of K. pneumoniae for T. ni was 50% for feeding and 0% for surface application. We hypothesize that K. pneumonia is a secondary and opportunistic pathogen of insects that requires the primary pathogenicity of stronger microbes such as P. aeruginosa to manifest virulence. Similar studies in lung infections have reported that P. aeruginosa is the primary pathogen and that other pathogens account for secondary infections once the organism’ defenses are compromised [25]. Inman and Holmes (2012) reported that antibacterial activity of metabolites secreted by the phase I variant of Photorhabdus luminescens were screened against 28 different bacterial species and strains [26]. Interestingly, it has been revealed that K. pneumoniae injected into G. mellonella killed the larvae due to a combination of factors such as cell death, phagocytes avoiding phagocytosis, as well as the attenuation of defense responses [27]. It should be noted that in the Insua et al. (2013) study K. pneumoniae was not isolated from G. mellonella insects but was simply tested on this insect. Other studies have illustrated that the adhesins, lipopolysaccharides, and secondary metabolites produced by K. pneumoniae in fermentation broth were the potential virulence factors against G. melonella [16]. In a recent study, the mortality rate of Zophobas morio larvae was increased when P. aeruginosa was applied to larvae experiencing cuticle damage or open wounds as compared to wounded larvae not exposed to the bacterium [18]. Insect mortality has been associated with the accumulation of bacterial cells in the insect or nematode's intestine [21]. Toxic compounds produced by the bacterium such as extracellular proteinases and metalloproteases are exported throughout the host's body as a result of intestinal infection [18,28,29]. Interestingly, the active enzymes (metalloproteases alkaline proteinase, Prt protease) were hypothesized to degrade insect tissues during bioconversion of peptides and amino acids to smaller sulphur, nitrogen, and phosphorus compounds after the insect's death [30]. Presumably, this might be one of the mechanisms that account for the carcass degradation of G. mellonella; which is the preferred environment for reproduction of H. bacteriophora nematodes.
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2019.103606. References [1] R. An, K. Suri, J. Jurat‐Fuentes, P. Grewal, Dynamics of transcriptomic response to infection by the nematode Heterorhabditis bacteriophora and its bacterial symbiont Photorhabdus temperata in Heliothis virescens larvae, Insect Mol. Biol. 26 (2017) 584–600 https://doi.org/10.1111/imb.12321. [2] J. Vadnal, R. Ratnappan, M. Keaney, E. Kenney, I. Eleftherianos, D. O'Halloran, et al., Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora, BMC Genomics 18 (2017) 8 https://doi. org/10.1186/s12864-016-3468-6. [3] S. Singh, M. Eric, I. Floyd, H.D. Leonard, Characterization of Photorhabdus luminescens growth for the rearing of the beneficial nematode Heterorhabditis bacteriophora, Indian J. Microbiol. 52 (2012) 325–331 https://doi.org/10.1007/s12088011-0238-7. [4] S. Arthurs, K. Heinz, J. Prasifka, An analysis of using entomopathogenic nematodes against above-ground pests, Bull. Entomol. Res. 94 (2004) 297–306. [5] A. Abdolmaleki, Z. Maafi, H. Dastjerdi, B. Naseri, A. Ghasemi, Immune defense of Pieris brassicae larvae in challenged with Heterorhabditis bacteriophora, its symbiotic bacteria and metabolites, ISJ 14 (2017) 73–84. [6] C.G. Bhat, K. Chauhan, V. Phani, P.K. Papolu, U. Rao, V.S. Somvanshi, Expression of Heterorhabditis bacteriophora C-type lectins, Hb-clec-1 and Hb-clec-78, in context of symbiosis with Photorhabdus bacteria, Symbiosis (2018), https://doi.org/10.1007/ s13199-018-0569-9. [7] R. Rae, M. Riebesell, I. Dinkelacker, Q. Wang, M. Herrmann, A.M. Weller, et al., Isolation of naturally associated bacteria of necromenic Pristionchus nematodes and fitness consequences, J. Exp. Biol. 211 (2008) 1927–1936 https://doi.org/10.1242/ jeb.014944. [8] R. Salgado-Morales, N. Rivera-Gómez, F. Martínez-Ocampo, L.F.L.-A. Beltrán, A. Hernández-Mendoza, E. Dantán-González, Draft genome sequence of Photorhabdus luminescens HIM3 isolated from an Entomopathogenic nematode in agricultural soils, Genome Announc. 5 (2017) e00745-17 https://doi.org/10.1128/ genomeA.00745-17. [9] S.P. Stock, A. Kusakabe, R.A. Orozco, Secondary metabolites produced by Heterorhabditis Symbionts and their application in agriculture: what we know and what to do next, J. Nematol. 49 (2017) 373. [10] T.A. Ciche, K-s Kim, B. Kaufmann-Daszczuk, K.C.Q. Nguyen, D.H. Hall, Cell invasion and matricide during Photorhabdus luminescens transmission by Heterorhabditis bacteriophora nematodes, Appl. Environ. Microbiol. 74 (2008) 2275–2287 https:// doi.org/10.1128/aem.02646-07. [11] C.M. Cabral, A. Cherqui, A. Pereira, N. Simões, Purification and characterization of two distinct metalloproteases secreted by the entomopathogenic bacterium Photorhabdus sp. strain Az29, Appl. Environ. Microbiol. 70 (2004) 3831–3838 https://doi.org/10.1128/aem.70.7.3831-3838.2004. [12] N.J. Tobias, A.K. Heinrich, H. Eresmann, P.R. Wright, N. Neubacher, R. Backofen, et al., Photorhabdus‐nematode symbiosis is dependent on hfq‐mediated regulation of secondary metabolites, Environ. Microbiol. 19 (2017) 119–129 https://doi.org/10. 1111/1462-2920.13502. [13] E.E. Del Valle, L.S. Frizzo, M. Malmierca, M.V. Zbrun, P. Lax, M.E. Doucet, Biological control of Alphitobius diaperinus with Steinernema rarum CUL and Heterorhabditis bacteriophora SMC and feasibility of application in rice hull, J. Pest. Sci. 89 (2016) 161–170 https://doi.org/10.1007/s10340-015-0669-8. [14] K.E. Holt, H. Wertheim, R.N. Zadoks, S. Baker, C.A. Whitehouse, D. Dance, et al., Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health, Proc. Natl. Acad. Sci. U.S.A. 112 (2015) E3574–E3581 https://doi.org/10.1073/pnas. 1501049112.
3
Microbial Pathogenesis 135 (2019) 103606
Y. He, et al.
53 (2009) 4891–4897 https://doi.org/10.1128/aac.00380-09. [23] M.W. Tan, L.G. Rahme, J.A. Sternberg, R.G. Tompkins, F.M. Ausubel, Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa virulence factors, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 2408–2413. [24] V. Kaitala, L. Ruokolainen, R.D. Holt, J.K. Blackburn, I. Merikanto, J. Anttila, et al., Population dynamics, invasion, and biological control of environmentally growing opportunistic pathogens, Modeling the Transmission and Prevention of Infectious Disease, Springer, 2017, pp. 213–245. [25] J.A. Driscoll, S.L. Brody, M.H. Kollef, The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections, Drugs 67 (2007) 351–368 https://doi. org/10.2165/00003495-200767030-00003. [26] F.L. Inman III, L. Holmes, Antibacterial screening of secreted compounds produced by the phase I variant of Photorhabdus luminescens, Indian J. Microbiol. 52 (2012) 708–709, https://doi.org/10.1007/s12088-012-0307-6. [27] J.L. Insua, E. Llobet, D. Moranta, C. Pérez-Gutiérrez, A. Tomás, J. Garmendia, et al., Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella, Infect. Immun. 81 (2013) 3552–3565 https://doi.org/10.1128/iai. 00391-13. [28] A. Kamaladevi, K. Balamurugan, Role of PMK-1/p38 MAPK defense in Caenorhabditis elegans against Klebsiella pneumoniae infection during host–pathogen interaction, Pathog. Dis. 73 (2015), https://doi.org/10.1093/femspd/ftv021. [29] M. Andrejko, A. Zdybicka-Barabas, M. Cytryńska, Diverse effects of Galleria mellonella infection with entomopathogenic and clinical strains of Pseudomonas aeruginosa, J. Invertebr. Pathol. 115 (2014) 14–25 https://doi.org/10.1016/j.jip.2013.10. 006. [30] P.J. Daborn, N. Waterfield, M.A. Blight, R.H. Ffrench-Constant, Measuring virulence factor expression by the pathogenic bacterium Photorhabdus Luminescens in culture and during insect infection, J. Bacteriol. 183 (2001) 5834–5839 https://doi.org/10. 1128/jb.183.20.5834-5839.2001.
[15] C.A. Sutherland, D.P. Nicolau, Susceptibility profile of ceftolozane/tazobactam and other parenteral antimicrobials against Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa from US hospitals, Clin. Ther. 37 (2015) 1564–1571 https://doi.org/10.1016/j.clinthera.2015.05.501. [16] M.E. Wand, J.W. McCowen, P.G. Nugent, J.M. Sutton, Complex interactions of Klebsiella pneumoniae with the host immune system in a Galleria mellonella infection model, J. Med. Microbiol. 62 (2013) 1790–1798 https://doi.org/10.1099/jmm.0. 063032-0. [17] P. Yorgey, L.G. Rahme, M.W. Tan, F.M. Ausubel, The roles of mucD and alginate in the virulence of Pseudomonas aeruginosa in plants, nematodes and mice, Mol. Microbiol. 41 (2001) 1063–1076 https://doi.org/10.1046/j.1365-2958.2001. 02580.x. [18] G. Maciel-Vergara, A.B. Jensen, J. Eilenberg, Cannibalism as a possible entry route for opportunistic pathogenic bacteria to insect hosts, exemplified by Pseudomonas aeruginosa, a pathogen of the giant mealworm Zophobas morio, Insects 9 (2018) 88 https://doi.org/10.3390/insects9030088. [19] G. Jander, L.G. Rahme, F.M. Ausubel, Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects, J. Bacteriol. 182 (2000) 3843–3845 https://doi.org/10.1128/jb.182.13.3843-3845.2000. [20] Y. Chieda, K. Iiyama, J.M. Lee, T. Kusakabe, C. Yasunaga-Aoki, S. Shimizu, Virulence of an exotoxin A-deficient strain of Pseudomonas aeruginosa toward the silkworm, Bombyx mori, Microb. Pathog. 51 (2011) 407–414 https://doi.org/10. 1016/j.micpath.2011.09.002. [21] M.W. Tan, S. Mahajan Miklos, F.M. Ausubel, Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 715–720 https://doi.org/10.1073/pnas.96.2.715. [22] E. Papaioannou, M. Wahjudi, P. Nadal-Jimenez, G. Koch, R. Setroikromo, W.J. Quax, Quorum-quenching acylase reduces the virulence of Pseudomonas aeruginosa in a Caenorhabditis elegans infection model, Antimicrob. Agents Chemother.
4