Isolation of Xenopus HIF-prolyl 4-hydroxylase and rescue of a small-eye phenotype caused by Siah2 over-expression

Biochemical and Biophysical Research Communications 355 (2007) 419–425 www.elsevier.com/locate/ybbrc

Isolation of Xenopus HIF-prolyl 4-hydroxylase and rescue of a small-eye phenotype caused by Siah2 over-expression Susumu Imaoka *, Taichi Muraguchi, Tsutomu Kinoshita Nanobiotechnology Research Center and Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda 669-1337, Japan Received 22 January 2007 Available online 8 February 2007

Abstract Hypoxia is an important physiological condition during embryonic development. Hypoxia-inducible factor (HIF) is the mediator of hypoxic response of cells. The prolyl hydroxylase (PHD) of HIF plays a key role in stabilizing of HIF and the oxygen homeostasis of organisms. In this study, we isolated two PHD proteins, PHD45 and PHD28, and characterized them during the embryonic development of Xenopus laevis, which is an excellent model for embryonic development because of the ease of embryonic manipulation and the feasibility of transgenesis. Based on amino acid sequences, Xenopus PHD45 and PHD28 were homologous with human PHD2 and PHD3, respectively. In embryonic development, PHD45 expression was complementary to that of PHD28. xHIF-1a protein level was at a maximum around stage 20 when expression of PHD45 disappeared, while expression of PHD28 reached a maximum at stage 20, suggesting that PHD28 is inducible by HIF-1a. Recently, Siah2 was found to be an ubiquitin ligase of PHD proteins and to regulate degradation of PHD proteins. Over-expression of xSiah2 decreased PHD45 but not PHD28 and caused the small-eye phenotype of Xenopus. Additional over-expression of PHD47 rescued the abnormality caused by xSiah2, suggesting that the level of expression or activity of PHD proteins is important to the maintenance of homeostasis in embryonic development. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Prolyl hydroxylase domain protein; HIF-1a; Xenopus laevis; Siah2

Although hypoxia (low oxygen level) is often associated with pathophysiological states such as cancer [1], it is also an important and relatively common condition to which embryos must adapt throughout development [2]. Hypoxia-inducible factor (HIF) is a transcription factor principally responsible for hypoxia [3]. HIF-1 is composed of two subunits, HIF-1a and ARNT [4]. At normoxia, HIF-1a is hydroxylated at two proline residues by a prolyl hydroxylase domain (PHD) protein [5,6], followed by ubiquitination by the von Hippel-Lindau (VHL) protein and Abbreviations: HIF-1a, hypoxia-inducible factor-1a; RT-PCR, reverse transcription-polymerase chain reaction; PHD, prolyl hydroxylase domain protein; VHL, von Hippel-Lindau; EPO, erythropoietin; VEGF, vascular endothelial growth factor; Arnt, aryl hydrocarbon receptor nuclear translocator; Siah2, Seven-in-Absentia homolog 2; MYND, Myeloid translocation protein 8, Nervy, and DEAF1. * Corresponding author. Fax: +81 79 565 7673. E-mail address: [email protected] (S. Imaoka). 0006-291X/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2007.01.166

degradation by the 26S proteasome [7]. The stability of HIF-1a is regulated principally through PHDs. PHD proteins of mammalians such as human comprise three isozymes, PHD1, PHD2, and PHD3 [8,9]. All have been found to possess the ability to hydroxylate HIF-1a peptide in vitro [8,9]. However, specific biological functions and localizations of these PHDs have also been reported [10]. By the study with RNAi for PHD2 and PHD3, PHD2 primarily limits HIF-1a expression under normoxia, while PHD3 regulates HIF-1a availability under moderately hypoxic conditions [10]. PHD1 is located exclusively in the cell nucleus; the majority of PHD2 is expressed in the cytoplasm; and PHD3 is partly present in the cytoplasm and partly in the nucleus [11]. These findings suggest that PHD proteins have specific biological roles in the maintenance of cell homeostasis. The Siah protein is highly conserved mammalian homolog of Drosophila seven in absentia and is a RING finger-

420

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425

containing nuclear protein required for the formation of R7 photoreceptor cells during development of the fly eye [12]. In Xenopus embryos, over-expression of Siah2 induces a small-eye phenotype [13]. Siah2 is found to have E3 ubiquitin ligase activities and to ubiquitinate PHD1 and PHD3 [14]. Siah2 limits PHD1 and PHD3 availability during hypoxia, thereby regulating HIF-1a expression during hypoxic conditions. The Siah protein is found as a factor necessary for embryonic development but there are no data concerning its relationship to the Siah protein and a PHD–HIF system during embryonic development. The accessibility of a large number of eggs, the ease of embryonic manipulation, and the feasibility of transgenesis in Xenopus makes the frog an excellent model for examining the biological functions of the hypoxic response system during embryonic development. In this study, we isolated novel PHDs (termed PHD28 and PHD45) from Xenopus embryos and characterized them. Materials and methods Eggs, embryos, and RT-PCR. Xenopus eggs were obtained by the method described previously [15]. The developmental stages of embryos were determined according to a normal table of Xenopus laevis [16]. Xenopus kidney cells, A6, were cultured in normal oxygen levels under air and low-oxygen conditions (1% O2) as described previously [17]. Total RNA was extracted from eggs and embryos at various stages. Random 9mer-primed first-strand cDNA was prepared from 1 lg of total RNA using reverse transcriptase I (Fermentas, Burlington, Ontario, Canada) according to the manufacturer’s instructions. Each polymerase chain reaction (PCR) was performed with this cDNA (0.2 lg) as a template. Primers for Xenopus HIF-1a (xHIF-1a), PHD45, PHD28, Xenopus Siah2 (xSiah2), Xenopus ornithine decarboxylase (xODC), and b-actin used in this study are shown Table 1. PCR was done with KOD DNA polymerase (Toyobo, Osaka, Japan). The program for PCR was 94 °C for 2 min; a number of cycles (shown in Table 1) of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; then a final extension at 72 °C for 5 min. The cycle numbers

shown in Table 1 are within the linear range of amplification. Bands of amplified DNA fragments on agarose gel were quantified by NIH Image. Cloning of xPHDs and xSiah2. Xenopus PHD cDNAs were isolated as follows. First, EGL nine homolog 2 (Caenorhabditis elegans) of Xenopus laevis was found by searching in GenBank (Accession No. BC076808). Two primers were designated from the DNA sequence of BC076808; 5 0 -T ACGGATCCACAGCAGACAGACATAATGG-3 0 (underline, BamHI; double underline, initiation codon) and 5 0 -GAGAAGCTTTGGTTA TATCAGATACACTG-3 0 (underline, HindIII). PCR was done with KOD DNA polymerase: denaturation at 94 °C for 2 min; then 35 cycles of 94 °C for 30 s, 55 °C for 30 s and 68 °C for 1 min. The amplified fragment was cut with BamHI and HindIII and subcloned into pBluescript to get a full-length Xenopus PHD. The molecular weight of this PHD calculated from the deduced amino acid sequence was 45.3 kDa (including 408 amino acid residues), and this PHD was termed PHD45. Human PHD3 cDNA (EGLN3 homolog, Accession No. AJ310545) was isolated by PCR with two primers: 5 0 -GGGGAGCTCACCTCGATTCTGCGGGCGAG-3 0 (underline, SacI; initiation codon starts just after this sequence) and 5 0 -AA (underline, PstI). ACTGCAGAGAATTCAGGAACCGTTACT-3 0 cDNA from Hep3B human hepatoma cells was used as a template. The amplified fragment was inserted into pBluescript with SacI and PstI sites, and full-length human PHD3 cDNA was obtained. A homology search for human PHD3 was done against the Xenopus EST library in the National Institute for Basic Biology of Japan. We found the Xenopus homologs of human PHD3 (contig 032151). It seemed to include the Nterminal region but to lack C-terminal region by comparison of human PHD3. Xenopus PHD homolog cDNA was isolated by PCR with primers 5 0 -GGGATGCCCGTCATGCACAG-3 0 (underline, estimated start codon) and 5 0 -T(n)CTGATCTAGAGGTACCGGATCC (oligo dT-3sites adaptor primer included in Takara 3 0 -full race kit). cDNA from the blastrula and neulura stages were used as templates. Synthesis of cDNA and PCR was done by the manufacturer’s instructions for Takara (Shiga, Janan). Full-length cDNA of the Xenopus PHD3 homolog was obtained by subcloning the amplified fragment into pGEM by T-A cloning. It consisted of 245 amino acid residues, and its molecular weight was calculated as 27.9 kDa. It was termed PHD28. The primers for isolation of Siah2 (xSiah2) were designed from the cDNA sequence (Accession No. AF155509): 5 0 -ATGGATCCGGTTCAGCAGAAGCGCGATG-3 0 (underline, BamHI; double underline, start codon) and 5 0 -TAGTCGACT GGACAACATGTGGAAATGG-3 0 (reverse primer; underline, SalI). PCR was performed under the same conditions as the isolation of

Table 1 Oligonucleotides used in this study Name

GenBank Accession No.

xHIF-1a Sense Anti-sense

AJ277829

PHD28 Sense Anti-sense

This study

PHD45 Sense Anti-sense

BC076808

xSiah2 Sense Anti-sense

AF155509

xODC Sense Anti-sense

BC044004

b-Actin Sense Anti-sense

AF079161

Sequence

Size

Cycles

5 0 -AACCATACGAAGATGTTCCA-3 0 5 0 -CTCAGTTGAAGGCTCTGACT-3 0

263

33

5 0 -GGGATGCCCGTCATGCACAG-3 0 5 0 -CGCCATTACCAGGATAACAT-3 0

390

33

5 0 -AGATGAGCCAGAGGAGTTGG-3 0 5 0 -GTTTACCACTGCAGTGTCGG-3 0

441

28

5 0 -GGTTCAGCAGAAGCGCGATG-3 0 5 0 -TTCTCCATTGCCAGGTTCCG-3 0

370

30

5 0 -CAGTGGCTGCACTGATCCACAGA-3 0 5 0 -TCATTCCGCTCTCCTGAGCAC-3 0

744

24

5 0 -CAGGAGATGGCCACAGCTGCC-3 0 5 0 -TCTTTCTGCATTCTATCAGCA-3 0

275

24

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425 xPHD45 cDNA. Full-length xSiah2 was subcloned into pBluescript with BamHI and SalI. Antibodies and Western blotting. Whole eggs and embryos were homogenized in PBS and solubilized with sodium dodecylsulfate (SDS). The resulting solution was subjected to SDS–polyacrylamide gel electrophoresis with a 10% acrylamide gel. Proteins were blotted onto a nitrocellulose membrane and reacted with antibodies against human PHD3 and human HIF-1a. The antibody against human HIF-1a had been prepared previously [17]. Human PHD3 cDNA was subcloned into a pQE vector containing a His-tag and IPTG promoter. PHD3 was expressed in Escherichia coli and purified on a Ni–NTA agarose column (Qiagen), then used to immunize rabbits as described previously [17]. We confirmed that the antibody against human HIF-1a cross-reacted with xHIF-1a and the antibody against human PHD3 did with PHD45 and PHD28, using xHIF1a, PHD45, and PHD28 expressed in E. coli. RNA synthesis, microinjection, and whole-mount in situ hybridization. The full-length PHD45, PHD28, and xSiah2 cDNAs were subcloned into pCS2+. Capped mRNA was made using this construct and the mCAP RNA synthesis kit (Gibco BRL) according to the manufacturer’s instructions. Fertilization, culture, and microinjection of mCAP PHD45, PHD28, and xSiah2 RNAs RNA were performed as described previously [15]. One blastomere of a two-cell-stage embryo was injected with 1–2 ng/ 5 nl mRNA.

421

Results Isolation and characterization of Xenopus PHDs In humans, three HIF-1a prolyl hydroxylase, PHD1, PHD2, and PHD3, have been reported, and these are homologs of EGLN2, EGLN1, and EGLN2 from C. elegans, which were first isolated as HIF-1a prolyl hydroxylase [8]. We searched Xenopus prolyl hydroxylase homologs in GenBank and found the EGLN2 homolog (Accession No. BC076808). Full-length cDNA of the Xenopus EGLN2 homolog was isolated from egg cDNA. The molecular weight calculated from the deduced amino acid sequence was 45.3 kDa (including 408 amino acid residues), and it was designated PHD45. PHD45 had MYND (Myeloid translocation protein 8, Nervy, and DEAF1)type zinc finger [18] and oxygenase domains (Fig. 1). The amino acid sequence of PHD45 showed 65%, 80%, and 65% homology to that of human PHD1 (including 407

Fig. 1. Alignment of amino acid sequences of human and Xenopus PHD proteins. Amino acid sequences of Xenopus PHD45 and PHD28 isolated in this study were compared with human PHD2 (GenBank Accession No. AJ310543) and PHD3 (GenBank Accession No. AJ310545). The MYND-type zinc finger domain and catalytic domain are indicated in boxes. The asterisk indicates the conserved amino acid residues in four PHD proteins. Amino acid residues in boldface identify the catalytic center of PHD.

422

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425

amino acid residues, GenBank Accession No. AJ310544), PHD2 (including 426 amino acid residues, GenBank Accession No. AJ310543), and PHD3 (including 293 amino acid residues, GenBank Accession No. AJ310545), respectively. Another PHD homolog in Xenopus was identified in the EST library. Compared to human PHDs, it includes the N-terminal region but seems not to include the C-terminal region (stop codon). The C-terminal region was isolated by 3 0 -RACE. The full-length cDNA included 245 amino acid residues, and the molecular weight calculated from the deduced amino acid sequence was 27.9 kDa. It was designated PHD28. The amino acid sequence of Xenopus PHD28 showed 60%, 64%, 75%, and 59% homology to that of human PHD1, PHD2, PHD3, and Xenopus PHD45. PHD28 lacked MYND-type zinc finger domain [18]. The amino acid sequence of the catalytic domain was highly conserved in human PHD2, PHD3, Xenopus PHD45 and PHD28. The four amino acid residues indicated in boldface in Fig. 1 were completely conserved in the four PHD proteins. These amino acid residues are active centers interacting with Fe (II) ion and 2-oxoglutarate [19].

A

Temporal expression of PHD45, PHD28, and xHIF-1a Fig. 2 shows the temporal expression of PHD45, PHD28, and HIF-1a as examined by RT-PCR from the unfertilized egg stage to stage 42 (larva stage). PHD45 revealed maternal expression and was detected at the egg stage and stage 8. Its expression disappeared at stage 10.5 and stage 20, and increased from stage 28 (Fig. 2A). On the contrary, maternal expression of PHD28 was low, and its expression reached a maximum at stage 20 (Fig. 2B). Expression of PHD45 and PHD28 seemed to be complementary to each other. HIF-1a mRNA was expressed at all stages examined, and expression levels remained unchanged through the development of Xenopus investigated in this study (Fig. 2C). Expression of HIF-1a is regulated by protein levels, prolyl hydroxylation, ubiquitination, and degradation by proteasomes. In Western blotting, expression of HIF-1a protein reached a maximum at stage 20 (Fig. 2C). Sipe et al. [20] investigated HIF-1a mRNA expression during development of Xenopus embryos by ribonuclease protection analysis and reported that expression of HIF-1a mRNA was highest at stages

B

ratio

ratio 1.5

1.0

1.0 0.5 0.5 0.0

0.0

e g g S t . 8 S t .1 0 .5 S t . 2 0 S t .28 S t . 3 5 S t . 4 2

PHD45

PHD28

xODC

xODC

C

ratio

D

e g g St .8 S t. 10 . 5 S t. 2 0 St . 2 8 S t . 35 S t. 4 2

ratio

2.0

3.0

1.0

2.0 1.0

0 . 0 egg S t .8 S t .1 0 . 5 S t .2 0 S t .2 8 S t .3 5 S t .4 2

0.0

xHIF-1 α

Normoxia

Hypoxia

PHD28

xODC Western blotting (HIF-1 α)

β-actin

Fig. 2. Temporal expression of PHD45, PHD28, and xHIF-1a in Xenopus embryos. Total RNA was isolated from eggs and whole embryos at each stage. RT-PCR was done with total RNA and specific primers for PHD45 (A), PHD28 (B), and xHIF-1a (C). Bands on agarose electrophoresis shown under each graph were quantitated by NIH Image. Values in the graph are expressed as ratios of each gene’s mRNA and xODC mRNA. RT-PCR was done with three different samples; values in the graphs are expressed as means ± SD. The graph (C) also includes Western blot of xHIF-1a at each stage. Expression of PHD28 in A6 under normoxia and hypoxia is also shown (D). Values are expressed as ratios of PHD28 mRNA and b-actin mRNA. RT-PCR was done with three different samples, and values in the graphs are expressed as means ± SD.

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425

10–20. Their results concerning HIF-1a mRNA are slightly different from ours. However, the HIF-1a protein level reached a maximum at stage 20 in this study. Expression of PHD45 and xHIF-1a proteins were reciprocal to each other. In Xenopus, PHD45 may be the main enzyme that hydroxylates proline residues of HIF-1a. The amino acid sequence of PHD45 showed the highest homology to human PHD2, which is mainly involved in HIF-1 regulation [21]. This fact is consistent with results in the current study. In contrast, PHD28 is similar to human PHD3. PHD3 is significantly induced by hypoxia and is regulated by HIF-1a [10,22]. Hence, we investigated the expression of PHD28 by hypoxia with A6 cells (Fig. 2D). PHD28 was significantly induced by hypoxia. The protein level of xHIF-1a was highest at stage 20, and expression of PHD28 was also the highest at stage 20, suggesting that HIF-1a induces PHD28 during the development of Xenopus embryos. Over-expression of PHD rescues abnormality of Xenopus embryos induced by over-expression of xSiah2 Over-expression of Xenopus PHDs and xSiah2 were investigated (Fig. 3A). When xSiah2 RNA was injected into 18 eggs, 9 of which (50%) revealed a small-eye phenotype as reported previously [13]. When xSiah2 and PHD45 were co-injected to 23 eggs, small eyes were induced in 5 embryos (21% of injected eggs). Co-injection of xSiah2 and PHD28 to 49 eggs rescued the small-eye phenotype

423

(6 embryos, 12% of injected eggs). We performed these experiments three times and obtained the similar results. The expression pattern of xSiah2 mRNA (Fig. 3B) was similar to that of PHD45 (Fig. 2A). Over-expression of xSiah2 reduced PHD45 protein levels but not those of PHD28 (Fig. 3C). In Western blotting with embryos, the PHD45 protein was detected from stage 20–35 (Fig. 3C). During these stages, the levels of xSiah2 mRNA were low. On the contrary, expression of the PHD28 protein was complementary with that of PHD45. These enzymes seem to work complementarily, although xSiah2 regulated PHD45 but not PHD28. The regulation of PHD45 may be different from that of PHD28. Discussion In this study, two Xenopus PHD proteins, PHD45 and PHD28, were isolated. PHD45 and PHD28 were homologous with human PHD2 and PHD3, respectively. Previously, investigation using siRNA, human PHD2 was shown to have the dominant role of controlling the levels of HIF-1a in normoxia in a range of cell types [21]. Little or no effect was observed with siRNA for PHD1 and PHD3. In the current study, expression of PHD45 mRNA was lowest at stage 10.5–20 (although PHD45 protein began to increase at stage 20) while expression of HIF-1a protein was highest at stage 20, completely disappeared at stage 28, and was increased again at stage 42. PHD45 protein disappeared at stage 42. These results suggest that

B xSiah2/ xODC

A Normal

x S ia h2 (1ng)

I nj xS i a h2 x Si a h 2 (2ng)

xODC

Inj Control

C 0/15 (0%)

xSiah2+GFP

9/18 (50%)

xSiah2+PHD28

6/49 (12%)

xSiah2+xPHD45

W es t e rn b l o t t in g

PHD45 PHD28

5/23 (21%) egg

st.8 st.10.5 st 20 st.28 st.35 st.42

Cont.

Inj.

Fig. 3. Effects of over-expression of xSiah2 and Xenopus PHD proteins on embryonic development of Xenopus. xSiah2 mRNA(1–2 ng) and additional PHD28 and PHD45 mRNAs were injected into Xenopus eggs at the two-cell stage; then embryos were cultured (A). The arrows indicate injection sites. The table shows ratios and percentages of abnormal embryos (small-eye phenotype). Graph (B) shows the temporal expression of xSiah2 mRNA. Total RNA was isolated from eggs and whole embryos at each stage. RT-PCR was done with total RNA and specific primers for xSiah2. Bands on agarose electrophoresis shown under the graph were quantitated by NIH Image. Values in the graph are expressed as ratios of xSiah2 mRNA and xODC mRNA. Temporal expression of PHD45 and PHD28 proteins and effects of xSiah2 expression on PHD45 and PHD28 expression were also examined (C). Western blotting of PHD45 and PHD28 was done with an antibody against human PHD3. We confirmed that the antibody recognized Xenopus PHD45 and PHD28. Total protein was isolated from embryos at each stage or from embryos injected by xSiah2 mRNA. ‘‘Cont.’’ and ‘‘Inject.’’ indicate control embryos injected by GFP only and embryos injected by GFP and xSiah2, respectively.

424

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425

PHD45 dominantly regulates HIF-1a expression. Meanwhile, expression of PHD28 mRNA correlated with HIF1a protein levels; both expressions reached their maximums at stage 20, suggesting that PHD28 is inducible under hypoxia, similar to PHD3 in humans. In fact, PHD28 was induced in A6 cells under hypoxia. The expression pattern during embryonic development suggested that PHD45 has complementarily with PHD28. In A6 cells, when PHD28 was induced under hypoxia, expression of PHD45 was decreased (data not shown). Recently, Siah2 has been reported to regulate PHDs that were ubiquitinated by the Siah2 protein and PHDs that were degraded by proteasomes [14,23]. The function of Siah2 was first identified as an important factor in the development of the insect and the vertebrate eye [12]. However, its biological role in eye development has not been well understood. In this study, over-expression of xSiah2 in Xenopus embryos induced the small-eye phenotype described previously [13]. Over-expression of xSiah2 reduced expression of PHD45 but not PHD28. In humans, PHD3 (homologous with PHD28) was the main target of Siah2 [24]. Unlike in humans, PHD45 (homologous with human PHD2) is a target of xSiah2 because over-expression of xSiah2 specifically reduced PHD45. However, over-expression of PHD28 alone as well as PHD45 rescued the small-eye phenotype. On the contrary, over-expression of both PHD45 and PHD28 caused malformation of the head and induced the phenotype of no eyes (data not shown). Excess expression or deficient expression of PHD45 and PHD28 together causes malformation of the head region including eye. From their temporal expression patterns, PHD45 and PHD28 function complimentarily. If Siah2 is over-expressed and PHD45 is degraded, overexpression of PHD45 or PHD28 may rescue the abnormality because of this complimentarily. The main target of PHD45 is HIF-1a but the main target of PHD28 may be different. In humans, HIF-1a is the target of PHD2, and PHD3 degrades HIF-2a [10]. The level of expression or activity of PHD proteins is important to the maintenance of homeostasis in embryos, and a complex mechanism may be involved in the abnormality of embryos overexpressing PHDs and xSiah2.

Acknowledgments This study was partially supported by a special Grantin-Aid of the Advanced Program of High-Profile Research for Academia-Industry Cooperation, sponsored by the Ministry of Education, Science, Culture, Sports and Technology of Japan. This study was also partially supported by a Health Sciences Research Grant for Research on Environmental Health from the Ministry of Health, Labor and Welfare of Japan, and by a Grant-in Aid from Kwansei Gakuin University. We thank Ms. K. Tanaka for her technical assistance.

References [1] G.L. Semenza, HIF-1: mediator of physiological and pathophysiological responses to hypoxia, J. Appl. Physiol. 88 (2000) 1474–1480. [2] E.Y. Chen, M. Fujinaga, A.J. Giaccia, Hypoxic microenvironment within an embryo induces apoptosis and is essential for proper morphological development, Teratology 60 (1999) 215– 225. [3] G.L. Wang, G.L. Semenza, Purification and characterization of hypoxia-inducible factor 1, J. Biol. Chem. 270 (1995) 1230–1237. [4] G.L. Wang, B.H. Jiang, E.A. Rue, G.L. Semenza, Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension, Proc. Natl. Acad. Sci. USA 92 (1995) 5510–5514. [5] M. Ivan, K. Kondo, H. Yang, W. Kim, J. Valiando, M. Ohh, A. Salic, J.M. Asara, W.S. Lane, W.G. Kaelin Jr., HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing, Science 292 (2001) 464–468. [6] P. Jaakkola, D.R. Mole, Y.M. Tian, M.I. Wilson, J. Gielbert, S.J. Gaskell, A. Kriegsheim, H.F. Hebestreit, M. Mukherji, C.J. Schofield, P.H. Maxwell, C.W. Pugh, P.J. Ratcliffe, Targeting of HIF-a to the von Hippel–Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation, Science 292 (2001) 468–472. [7] P.H. Maxwell, M.S. Wiesener, G.W. Chang, S.C. Clifford, E.C. Vaux, M.E. Cockman, C.C. Wykoff, C.W. Pugh, E.R. Maher, P.J. Ratcliffe, The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis, Nature 399 (1999) 271–275. [8] A.C. Epstein, J.M. Gleadle, L.A. McNeill, K.S. Hewitson, J. O’Rourke, D.R. Mole, M. Mukherji, E. Metzen, M.I. Wilson, A. Dhanda, Y.M. Tian, N. Masson, D.L. Hamilton, P. Jaakkola, R. Barstead, J. Hodgkin, P.H. Maxwell, C.W. Pugh, C.J. Schofield, P.J. Ratcliffe, C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation, Cell 107 (2001) 43–54. [9] R.K. Bruick, S.L. McKnight, A conserved family of prolyl-4hydroxylases that modify HIF, Science 294 (2001) 1337–1340. [10] R.J. Appelhoff, Y.M. Tian, R.R. Raval, H. Turley, A.L. Harris, C.W. Pugh, P.J. Ratcliffe, J.M. Gleadle, Differential function of the prolyl hydroxylases PHD1, PHD2, and PHD3 in the regulation of hypoxiainducible factor, J. Biol. Chem. 279 (2004) 38458–38465. [11] E. Metzen, U. Berchner-Pfannschmidt, P. Stengel, J.H. Marxsen, I. Stolze, M. Klinger, W.Q. Huang, C. Wotzlaw, T. Hellwig-Burgel, W. Jelkmann, H. Acker, J. Fandrey, Intracellular localisation of human HIF-1 alpha hydroxylases: implications for oxygen sensing, J. Cell Sci. 116 (2003) 1319–1326. [12] R.W. Carthew, G.M. Rubin, Seven in absentia, a gene required for specification of R7 cell fate in the Drosophila eye, Cell 63 (1990) 561– 577. [13] S. Bogdan, S. Senkel, F. Esser, G.U. Ryffel, E. Pogge, v. Strandmann, Misexpression of Xsiah-2 induces a small eye phenotype in Xenopus, Mech. Dev. 103 (2001) 61–69. [14] K. Nakayama, I.J. Frew, M. Hagensen, M. Skals, H. Habelhah, A. Bhoumik, T. Kadoya, H. Erdjument-Bromage, P. Tempst, P.B. Frappell, D.D. Bowtell, Z. Ronai, Siah2 regulates stability of prolylhydroxylases, controls HIF1alpha abundance, and modulates physiological responses to hypoxia, Cell 117 (2004) 941–952. [15] T. Kiyota, H. Jono, S. Kuriyama, K. Hasegawa, S. Miyatani, T. Kinoshita, X-Serrate-1 is involved in primary neurogenesis in Xenopus laevis in a complementary manner with X-Delta-1, Dev. Genes Evol. 211 (2001) 367–376. [16] J. Gerhart, M. Kirschner (Ed.), Normal Table of Xenopus laevis (Daudin), Garland Publishing, New York and London, 1994. [17] M. Osada, S. Imaoka, T. Sugimoto, T. Hiroi, Y. Funae, NADPHcytochrome P-450 reductase in the plasma membrane modulates the activation of hypoxia-inducible factor 1, J. Biol. Chem. 277 (2002) 23367–23373. [18] K.O. Choi, T. Lee, N. Lee, J.H. Kim, E.G. Yang, J.M. Yoon, J.H. Kim, T.G. Lee, H. Park, Inhibition of the catalytic activity of

S. Imaoka et al. / Biochemical and Biophysical Research Communications 355 (2007) 419–425 hypoxia-inducible factor-1a-prolyl-hydroxylase 2 by a MYND-type zinc finger, Mol. Pharmacol. 68 (2005) 1803–1809. [19] M.A. McDonough, V. Li, E. Flashman, R. Chowdhury, C. Mohr, B.M. Lienard, J. Zondlo, N.J. Oldham, I.J. Clifton, J. Lewis, L.A. McNeill, R.J. Kurzeja, K.S. Hewitson, E. Yang, S. Jordan, R.S. Syed, C.J. Schofield, Cellular oxygen sensing: Crystal structure of hypoxiainducible factor prolyl hydroxylase (PHD2), Proc. Natl. Acad. Sci. USA 103 (2006) 9814–9819. [20] C.W. Sipe, E.J. Gruber, M.S. Saha, Short upstream region drives dynamic expression of hypoxia-inducible factor 1alpha during Xenopus development, Dev. Dyn. 230 (2004) 229–238. [21] E. Berra, E. Benizri, A. Ginouves, V. Volmat, D. Roux, J. Pouyssegur, HIF prolyl-hydroxylase 2 is the key oxygen sensor

425

setting low steady-state levels of HIF-1a in normoxia, EMBO J. 22 (2003) 4082–4090. [22] D.P. Stiehl, R. Wirthner, J. Koditz, P. Spielmann, G. Camenisch, R.H. Wenger, Increased prolyl 4-hydroxylase domain proteins compensate for decreased oxygen levels. Evidence for an autoregulatory oxygen-sensing system, J. Biol. Chem. 281 (2006) 23482–23491. [23] A. Khurana, K. Nakayama, S. Williams, R.J. Davis, T. Mustelin, Z. Ronai, Regulation of the ring finger E3 ligase Siah2 by p38 MAPK, J. Biol. Chem. 281 (2006) 35316–35326. [24] K. Nakayama, S. Gazdoiu, R. Abraham, Z.Q. Pan, Z. Ronai, Hypoxia-induced assembly of prolyl hydroxylase PHD3 into complexes: implications for its activity and susceptibility for degradation by the E3 ligase Siah2, Biochem. J. 401 (2007) 217–226.