Isometric contraction of microvascular pericytes from mouse brain parenchyma

Microvascular Research 73 (2007) 20 – 28 www.elsevier.com/locate/ymvre

Isometric contraction of microvascular pericytes from mouse brain parenchyma Kazuhiko Oishi ⁎, Tsutomu Kamiyashiki, Yuko Ito Department of Pharmacology, Meiji Pharmaceutical University, 2-522-1, Noshio, Kiyose, Tokyo 204-8588, Japan Received 29 April 2006; revised 10 August 2006; accepted 22 August 2006 Available online 9 October 2006

Abstract Pericytes were isolated and cultured from mouse cerebroparenchymal microvessels. A single pericyte clone was three-dimensionally cultured in a collagen gel by adding tensile stress, resulting in the reconstruction of narrow stringy fibers. When the contractility of these fibers was evaluated isometrically, they contracted in response to acetylcholine (ACh)1 or noradrenaline; this was accompanied by an increase in intracellular calcium concentration ([Ca2+]i). The fibers that were pre-contracted by ACh were completely relaxed by papaverine, which is a smooth-muscle relaxant. Moreover, the muscarinic ACh receptor-antagonist atropine depressed the [Ca2+]i response that was induced by ACh. This study demonstrates for the first time the quantitative measurement of the contractions produced by cultured microvascular pericytes from mouse brain parenchyma. © 2006 Elsevier Inc. All rights reserved. Keywords: Brain parenchyma; Collagen gel fiber; Contractility; Isometric force; Microvascular pericytes

Introduction The microcirculation of the brain consists of a functionally specialized system of capillaries, small arterioles, and venules, which together modulate its microenvironment. Capillaries have been stimulated to contract or dilate in experimental systems in response to various physiologically important substances (Rhodin, 1967). It has been postulated, therefore, that capillaries possess the ability to contract independently, which might play an important part in regulating perfusion and permeability. Pericytes are perivascular cells that are associated with capillaries and postcapillary venules. Based on their location Abbreviations: ACh, acetylcholine; AM, acetoxymethyl ester; bFGF, basic fibroblast growth factor; BSA, bovine serum albumin; cDNA, complementary; DNA, C-terminus, carboxy-terminus; DABCO, 1,4-diazobicyclo-[2.2.2]-octane; DDBJ, DNA Data Bank of Japan; DMEM, Dulbecco's modified Eagle's medium; ET-1, endothelin-1; FBS, fetal bovine serum; FITC, fluorescein isothyocianate; GFAP, glial fibrillary acidic protein; HBSS, Hanks' balanced salt solution; His, histamine; IgG, immunoglobulin G; mRNA, messenger RNA; Nterminus, amino-terminus; NA, noradrenaline; PBS, phosphate-buffered saline; PGF2α, prostaglandin F2α; Phe, phenylephrine; RT-PCR, reverse transcriptionpolymerase chain reaction; SE, standard error; 5-HT, serotonin. ⁎ Corresponding author. Fax: +18 424 95 8403. E-mail addresses: [email protected] (K. Oishi), [email protected] (T. Kamiyashiki), [email protected] (Y. Ito). 0026-2862/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.mvr.2006.08.004

and their complement of muscle cytoskeletal proteins, it has been proposed that pericytes play a role in the regulation of blood flow (Hirschi and D'Amore, 1996). A substantial body of indirect evidence suggests that the pericytes of the microvascular systems have a contractile function (Das et al., 1988; Kelley et al., 1987, 1988). In most cases, pericyte contraction was assessed on cells grown on deformable substrates rather than directly on nondeformable plastic dishes, thus permitting cell shortening. We have previously established a method for reconstituting artificial smooth-muscle fibers (Oishi et al., 2000). This method permitted the quantitative measurement of the contractile force generated by smooth-muscle cells of a defined type for the first time (Bao et al., 2002; Oishi et al., 2002a,b). This technique enabled us to directly observe the contractile function of pericytes. To our knowledge, the present study is the first to show that microvascular pericytes from mouse brain parenchyma contract isometrically in response to typical contractile agonists in a dose-dependent manner. Materials and methods Isolation of cerebral microvessels All procedures using animals were performed in accordance with the Guidelines for Animal Experimentation of the Japanese Association for Laboratory Animal Science, and were approved by the Institutional Animal

K. Oishi et al. / Microvascular Research 73 (2007) 20–28 Use and Care Committee at Meiji Pharmaceutical University, Japan. Male C57BL/6 mice (Charles River Lab. Japan, Yokohama, Japan) aged 6– 8 weeks were anesthetized by intraperitoneal injection of pentobarbital (35 mg/kg) and exsanguinated. After decapitation, the brains were quickly removed and placed in a Petri dish containing Hanks' balanced salt solution (HBSS). The cortex was dissected out and finely minced with a single-edged razor blade. The tissue from four brains was then incubated with 1 mg/ml collagenese and 15 μg/ml DNase I in 10 ml Dulbecco's modified Eagle's medium (DMEM; high glucose; Gibco BRL Co., NY, USA) supplemented with 50 U/ml penicillin and 50 μg/ml streptomycin at 37°C for 60 min with gentle stirring. The suspension was diluted with 10 ml DMEM and centrifuged at 2200×g at 4°C for 8 min. The supernatant was discarded, and the pellet was washed by resuspension in 8 ml DMEM containing 20% bovine serum albumin (BSA) and recentrifuged at 1000×g at 4°C for 20 min. The supernatant was discarded, and the pellet was collected and incubated with 1 mg/ml collagenese and 15 μg/ml DNase I in 5 ml DMEM at 37°C for 30 min with gentle stirring. The suspension was diluted with 5 ml DMEM and was centrifuged at 1600×g at 4°C for 10 min. The supernatant was discarded, and the pellet was washed by resuspension in 8 ml DMEM and recentrifuged at 700×g at 4°C for 10 min. The supernatant was discarded, and the pellet, which contained small arterioles, venules, and capillaries, was collected.

Cell culture The microvessel-enriched fraction was plated on plastic culture dishes in 2 ml DMEM supplemented with 50 U/ml penicillin, 50 μg/ml streptomycin, and 20% fetal bovine serum (FBS). This was incubated at 37°C in a 95% air– 5% CO2 atmosphere. Out-growing tube-like capillary cords were identified by phase-contrast microscopy within the first 3 days after seeding, and pericytes began to proliferate. When the cultures reached confluence, the cells were subcultured using 0.05% trypsin for dissociation. One of the clones, PC17C4, was obtained from pericytes using cloning rings. The PC17C4 cells were passaged twice a week, and cultures of up to 20 passages were used in this study.

21

Flow-cytometric analysis PC17C4 cells were suspended in ice-cold HBSS supplemented with 1 mg/ml BSA and 10 mM HEPES in a single-cell suspension of 2 × 107 cells/ml. The suspension was incubated for 30 min at 4°C with FITC-conjugated CD44 (1:10; Beckman Coulter Inc., Fullerton, CA, USA) or PE-conjugated CD90 (Thy1; 1:10; Beckman Coulter Inc.). The suspension was incubated for 30 min at 4°C with the NG2 antibody (1:10; Chemicon International Inc., Temecula, CA, USA). This was followed by 30 min incubation with PR-conjugated anti-rabbit IgG antibody (1:50; Southern Biotechnology Associates Inc., Birmingham, AL, USA). The cells were washed and resuspended in the media. Surface-labeled cells were analyzed using an EPICS ALTRA flow cytometer (Beckman Coulter Inc.) equipped with a laser, which provided excitation wavelengths tuned to 488 nm. The FITC and PE fluorescence signals to individual cells were set to 488 nm, and the resulting fluorescence emissions from each cell were collected using bandpass filters set at 525 ± 30 and 575 ± 25 nm, respectively. EXPO32 Flow Cytometry software (Beckman Coulter Inc.) was used to quantify the fluorescence signal intensities among the immunolabeled subpopulations, and to set logical electronic-gating parameters.

Preparation of reconstituted pericyte fibers String-shaped reconstituted pericyte fibers were prepared in rectangular wells, as described previously (Oishi et al., 2000). Briefly, PC17C4 cells (cultures from 10–20 passages were used unless otherwise indicated) were suspended in ice-cold collagen solution containing 3 × 106 cells/ml cultured cells and 2.4 mg/ml collagen type I (Nitta Gelatin Co., Japan) in DMEM. Aliquots (2 ml) of the collagen–cell suspension were poured into rectangular wells (0.8 × 5.0 × 0.5 cm), with two poles positioned 4 cm apart on the bottom of each well, and placed in a CO2 incubator (humidified 5% CO2/95% air atmosphere) at 37°C. The collagen–cell suspension gelled within 30 min. Subsequently, 15 ml DMEM was added to each Petri dish. The preparations were incubated until the cells shrank the gel and formed a string-shaped fiber.

Measurement of isometric force Antibodies Anti-rat nestin is a mouse monoclonal antibody specific for nestin (BD Biosciences Inc., NJ, USA). The anti-α-smooth-muscle isoform of actin is a monoclonal antibody raised against a synthetic NH2-terminal decapeptide of the smooth-muscle α-isoform of actin (Progen Biotechnik GmbH, Germany). Anti-PECAM-1 (M-20) and anti-aminopeptidase A (N-20) are affinitypurified goat polyclonal antibodies raised against peptides mapping at the carboxy (C)-terminus of the mouse PECAM-1 and the amino (N)-terminus of the human aminopeptidase A (Santa Cruz Biotechnology, Inc., CA, USA). Anti-GFAP is a rabbit polyclonal antibody raised against GFAP purified from bovine spinal cord (Dako Co., CA, USA). Anti-nestin is a mouse monoclonal antibody specific for nestin (BD Biosciences Inc.). We used a fluorescein isothyocianate (FITC)-conjugated anti-mouse immunoglobulin G (IgG) secondary antibody developed in the goat (Tago, Inc., CA, USA). The Cy5-conjugated anti-goat IgG secondary antibody was developed in donkeys (Chemicon Inc., CA, USA).

Immunocytochemistry Cultures grown on culture dishes were washed with phosphate-buffered saline (PBS) containing 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4·7H2O, and 1.4 mM KH2PO4 for 3 min, fixed in 4% paraformaldehyde for 15 min, and then incubated in PBS containing 0.1% Triton X-100 for 15 min at room temperature. For double-labeled immunofluorescent staining, primary antibodies developed in two different species were incubated together. They were then reacted with a combination of FITC-conjugated anti-mouse IgG antibody (1:500) and Cy5-conjugated anti-goat IgG antibody (1:500). After being washed with water, the cells were mounted in 70% glycerol containing 2.5% 1,4diazobicyclo-[2.2.2]-octane (DABCO) and photographed under a confocal laser-scanning microscope (Olympus, FluoView 500).

The pericyte fibers, prepared as described above, were cut into two pieces (each 20 mm in length) and mounted vertically in a 10-ml organ bath containing HEPES-buffered Tyrode's solution (pH 7.4) at 37°C. The fibers were equilibrated in the same medium for 1 h at a resting tension of 2 mN. The tension development was recorded isometrically with a force-displacement transducer (TB-612 T, Nihon Kohden, Tokyo, Japan). Contractile studies were performed by adding various chemical agents to the final desired concentrations. The HEPES-buffered Tyrode's solution had the following composition: 137 mM NaCl, 2. 7 mM KCl, 1. 8 mM CaCl2, 1.0 mM MgCl2, 5.6 mM glucose, and 4.2 mM HEPES (pH 7.4 at 37°C). The Ca2+-free solution had the same composition as the HEPES-buffered Tyrode's solution, with the exception that the CaCl2 was omitted. BAPTA-AM (50 μM) and BAPTA (1 mM) were added to the Ca2+-free solution to chelate cytosolic and extracellular Ca2+, respectively.

Immunocytochemistry on sectioned fibers The gel matrix including the cultured pericyte cells was fixed with freshly prepared 4% paraformaldehyde in PBS for at least 3 h at 4°C. This was followed by cryoprotection in 30% sucrose in PBS at 4°C for 24–48 h. The gels were immersed in Tissue-Tek OCT (Miles Inc., Elkhart, IN, USA) and frozen in liquid nitrogen. Longitudinal sections (10 μm) were cut using a cryostat and subjected to immunostaining. Briefly, the sections were washed with PBS for 3 min, fixed in 4% paraformaldehyde for 15 min, and incubated in PBS containing 0.5% Triton X-100 for 15 min at room temperature. After fixation, the cells were stained with primary antibodies for 60 min at room temperature. They were then incubated for 60 min at room temperature with biotinylated horse anti-mouse or anti-goat IgG secondary antibodies diluted in PBS (1:500). This was followed by 60 min incubation in an avidin–biotin solution (Vectastain ABC Elite kit; Vector

22

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

Lab. Inc., Burlingame, CA, USA). Both incubations were preceded by thorough rinses with PBS. The reaction products were visualized with 3′–3′ diaminobenzidine and hydrogen peroxide (DAB kit; Sigma Chemical Co., MO, USA). The cells were then washed three times with PBS, and the slides were mounted in Permount. The cells were viewed and photographed using an Olympus photomicroscope.

Reverse transcription-polymerase chain reaction (RT-PCR) analysis RT-PCR analysis of the cells or the reconstituted fibers was performed as described previously (Oishi et al., 2002a). Total RNA was isolated from 5 × 105 cells or reconstituted fibers (∼15 mm in total length) using an Isogen RNA purification kit (Nippon Gene, Tokyo, Japan) according to the manufacturer's protocol. Total RNA (1 μg) was reverse transcribed using the Superscript preamplification system (Life Tech., Inc., MD, USA) with oligo (dT) 12–18 primers (20 μg/ml) in a 25-μl reaction mixture, according to the manufacturer's protocol. The PCR was performed in 25-μl reaction mixtures using a Perkin-Elmer Thermocycler (Model 9600; PerkinElmer Japan Co., Ltd., Yokohama, Japan). Aliquots of the complementary DNA (cDNA) derived from 50 ng total RNA were subjected to PCR amplification with primer sets specific to the gene of interest. To ensure that the PCR signals were not caused by amplification of genomic DNA, control RT-PCR experiments were performed in which cDNA synthesis reactions were performed without reverse transcriptase. The oligonucleotide primers that were used are listed in Table 1. All primers were checked for cross homology using a DNA Data Bank of Japan (DDBJ) nucleotide database search (BLASTN) and were determined to be specific for each gene. Primers with minimal secondary structures or dimer formation were also checked using the OLIGO software (National Biosciences, Inc., MN, USA).

Intracellular Ca2+ concentration ([Ca2+]i) measurements The cultured cells were incubated for 30 min at 37°C in HEPES-buffered Tyrode's solution containing 10 μM Fluo-3 acetoxymethyl ester (Fluo-3-AM; Dojindo, Kumamoto, Japan) and 0.03% Cremophor EL (Sigma Chemical Co., MO, USA). A laser-scanning microscope was used to monitor the change of [Ca2+]i. The cells were illuminated at 488 nm, and fluorescent emissions of 516 nm were recorded at an intensity of Fluo-3. Digital Ca2+ images were normally collected for 60–90 s at 800–900 ms intervals, depending on the image size. After recording the intensity of the fluorescence, the [Ca2+]i in small regions of the cells was analyzed. During Ca2+ imaging, the temperature of the recording chamber was kept at 37°C using a bipolar temperature controller (Medical Systems Corp., NY, USA). The intensity of the Fluo-3 fluorescence was normalized in the temporal analysis by dividing the temporal

fluorescence intensity of the dyes (Ft) by the fluorescence intensity at the start (F0). These relative values represent the integrated [Ca2+]i.

Chemicals The chemicals used in the study were purchased from the following companies: acetylcholine (ACh; Ovisot) was from Daiichi Pharmaceutical Co., Ltd. (Tokyo, Japan); noradrenaline (NA), phenylephrine (Phe), serotonin (5-HT), histamine (His), and papaverine hydrochloride were from Wako Pure Chemicals (Osaka, Japan); prostaglandin F2α (PGF2α) and endothelin-1 (ET1) were from Sigma Chemical Co.. All other chemicals were of reagent grade.

Data analysis All data are presented as means ± standard error (SE). The standard unpaired Student's t-test was used to analyze significant differences among the data.

Results Characteristics of PC17C4 cells Unlike the fibroblasts, endothelial cells, and smooth-muscle cells, the PC17C4 cells in culture extended laterally, and showed a flattened or elongated configuration with irregular edges. They proliferated with a doubling time of approximately 2.1 days through at least 20 passages. At confluence, the PC17C4 cells showed out-growth and formed multicellular nodules. To quantify the percentage of pericytes present in the culture, the expression of CD44, CD90, and NG2 cell-surface antigens was determined by flow cytometry. Of the cultures in passage 10, 90.3, 93.7, and 81.2% were positive for CD44, CD90, and NG2, respectively (Fig. 1A). Immunocytochemical analyses of the cultures in passage 10 also showed that more than 90% of the cells expressed pericyte-marker proteins, including α-smoothmuscle actin, nestin, and aminopeptidase A, but not PECAM-1, which is a marker protein for endothelial cells (Fig. 1B). The cells were also negative for the astrocyte-marker protein GFAP, SM-1, SM-2, and SMemb myosin heavy chains (data not shown). RT-PCR experiments indicated the presence of

Table 1 PCR primers

GAPDH

a

α-smooth-muscle actin a Nestin a Desmin b Vimentin PECAM-1 a GFAP a a b

Oishi et al., 2004. Guma et al., 2001.

Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

Sequence (5′–3′)

Product size (bp)

Annealing temperature (°C)

Accession no.

GGCAAATTCAACGGCACAGT TTCACACCCATCACAAACAT ACTACTGCCGAGCGTGAGATT GTAGACAGCGAAGCCAAGATG TTAGAGGTGCAGCAGCTGCA CAGCAGAGTCCTGTATGTAGCC TCTCCCGTGTTCCCT ATACGAGCTAGAGTGGCT CCGCAGCCTCTATTCCTCATC CCTGCAGTTCTACCTTCTCGT GACCCAGCAACATTCACAGAT TCTTTCACAGAGCACCGAAGT TCCGCCAAGCCAAGCACGAAG CATCCCGCATCTCCACAGTCT

248

55.8

M32599

449

56.8

X13297

252

57.1

AF076623

572

56.7

L22550

179

57.9

M24849

203

55.1

L06039

429

59.5

AF332061

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

23

Fig. 1. Properties of the cloned pericyte PC17C4 cells isolated and cultured from adult mouse cerebral parenchyma microvessels. (A) Flow-cytometric analysis of the cell-surface expression of CD44, CD90 (Thy 1), and NG2 in PC17C4 cells. The filled histograms represent the test antibodies and the open histograms represent the isotope-matched control IgG antibodies. (B) The expression of several pericyte-marker proteins in fibers incubated for 7 days was examined by immunostaining longitudinal sections of the fibers with mouse monoclonal antibodies against (a) α-smooth-muscle actin and (b) nestin, goat polyclonal antibody against (c) aminopeptidase A, (d) control mouse IgG, and (e) control goat IgG. Confocal-microscopy images show the localization of α-smooth-muscle actin, but not the marker protein for endothelial cells PECAM-1. (a) Green denotes α-smooth-muscle actin. (b) Blue denotes PECAM-1. (c) Merged image with phase contrast. The colocalization of nestin and aminopeptidase A was also observed. (d) Green denotes nestin. (e) Blue denotes aminopeptidase A. (f) Merged image with phase contrast. Scale bars represent 100 μm. (C) The expression of several pericyte-marker proteins in PC17C4 cells was examined using RT-PCR. The total RNAs extracted from the passage 10 cultures were subjected to RT-PCR analysis using primers specific for (a) GAPDH, (b) α-smooth-muscle actin, (c) nestin, (d) desmin, (e) vimentin, and (f) PECAM-1. The number of PCR cycles was as follows: GAPDH, ×25; α-smooth-muscle actin, ×25; nestin, ×30; desmin, ×30; vimentin, ×25; and PECAM-1, ×30. The PCR products were resolved by electrophoresis on 2% agarose gels prestained with ethidium bromide. No signals were detected when samples had not been reverse transcribed. (g) An 100-base pair (bp) DNA ladder.

messenger RNAs (mRNAs) for α-smooth-muscle actin, nestin, and vimentin, whereas those for desmin and PECAM-1 were not present (Fig. 1C). The primers for desmin amplified PCR products in the adult mouse cerebral artery (data not shown). These results indicated that the PC17C4 cells were pericytes. There were no significant differences in the morphology or expression of these marker proteins in cell cultures between passages 10 and 20 (data not shown).

Reconstitution of pericyte fibers A collagen gel containing 3 × 106 PC17C4 cells/ml was prepared. The collagen–cell suspension gelled within 30 min after being inoculated and placed in a CO2 incubator. By 3 days after casting, PC17C4 cells began to contract the gel from an initial thickness of 5.0 mm to about 1.8 mm in diameter; this string shape was maintained for more than 7 days (Fig. 2A). We

24

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

Fig. 2. Properties of reconstituted pericyte fibers. (A) Photographs showing time-dependent contraction of collagen gels. A collagen gel suspension containing 3 × 106 PC17C4 cells/ml was poured into a rectangular well and placed in a CO2 incubator at 37°C in a humidified 5% CO2–95% air atmosphere. (a) The collagen–cell suspension gelled within 30 min. The preparations were incubated in DMEM supplemented with 50 U/ml penicillin, 50 μg/ml streptomycin, and 20% FBS for 7 days. (b) After 3 days of incubation. (c) After 7 days of incubation. Three days after the gels were cast, the diameter of the cross-section was markedly reduced and formed a stringshaped fiber. (B) Immunostaining of longitudinal sections of pericyte fibers for pericyte-marker proteins. The expression of several pericyte-marker proteins in fibers incubated for 7 days was examined by immunostaining longitudinal sections of the fibers with antibodies against (a) α-smooth-muscle actin, (b) nestin, and (c) aminopeptidase A. Scale bars represent 50 μm. (C) RT-PCR analysis of the total RNAs extracted from the fibers incubated for 7 days. RT-PCR was performed as described in Materials and methods using primers specific for (a) GAPDH, (b) α-smooth-muscle actin, (c) nestin, (d) desmin, (e) vimentin, (f) PECAM-1, and (g) GFAP. The number of PCR cycles was as follows: GAPDH, ×35; α-smooth-muscle actin, ×35; nestin, ×40; desmin, ×40; vimentin, ×35; PECAM-1, ×40; and GFAP, ×40. (h) An 100-bp DNA ladder. The PCR primers used are shown in Table 1.

examined the expression of pericyte-marker proteins in the fibers using immunocytochemistry and RT-PCR. Immunocytochemical analyses revealed that after incubation for 7 days, the PC17C4 cells in the fibers were immunoreactive for α-smooth-muscle actin, nestin, and aminopeptidase A (Fig. 2B), but not for SM-1, SM-2, and SMemb myosin heavy chains (data not shown). The RT-PCR also indicated the presence of mRNAs for pericyte-marker proteins, such as α-smooth-muscle actin, nestin, and vimentin, but not for desmin, PECAM-1, or GFAP (Fig. 2C). Immunostaining of the fiber section for α-smooth-muscle actin revealed that the PC17C4 cells exhibited elongated bipolar spindle shapes and were oriented parallel to the direction of the isometric axis (Fig. 2B). Agonist-induced contraction After 7 days in a CO2 incubator at 37°C, the isometric contractions of the fibers were studied. Fig. 3A shows representative

contractile responses to ACh, NA, and Phe. ACh at a concentration of 10 μM caused a sustained increase in tension, which was followed by a gradual decrease. Cumulative dose–response curves indicated that the maximal tension induced by ACh (100 μM) was 0.38 ± 0.02 mN (n = 4; Fig. 3B). NA also caused a dose-dependent contraction with a maximal force of 0.50 ± 0.03 mN at a concentration of 100 μM (n = 4). PGF2α at concentrations up to 10 μM did not evoke a significant contractile response (Fig. 3B). His, 5HT, and ET-1 showed no notable effects. The fibers pre-contracted by ACh (10 μM) and NA (10 μM) were completely relaxed by the addition of 10 μM papaverine. The ACh-induced contraction was decreased to −56.3 ± 15.5% (p < 0.01; n = 3) of the control, while the NA-induced contraction was decreased to −94.0 ± 19.2% (p < 0.01; n = 3), indicating that the cells in the fibers relaxed in response to papaverine. We next studied the Ca2+-dependence of the ACh-induced contraction. These experiments were performed in Ca2+-free

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

25

Fig. 3. Contractile responses of pericyte fibers to various agonists. (A) Representative traces showing the contractile responses of pericyte fibers to various agonists. Tension development was recorded isometrically with a force-displacement transducer. Contractions were induced by adding the following agonists: (a) ACh, 10 μM; (b) NA, 10 μM; (c) Phe, 10 μM; (d) PGF2α, 0.1–10 μM; (e) His, 10 μM; (f) 5-HT, 10 μM; and (g) ET-1, 100 nM. Representative traces of repeated experiments (n = 4). (B) Dose–response relationships for ACh (squares), NA (diamonds), and Phe (triangles). The contractions were induced by adding agonists cumulatively to achieve the final desired concentration. Data points and error bars represent the mean ± SE (n = 4). (C) Representative tracings showing inhibition of ACh-induced contraction by papaverine. The contraction was induced by adding 10 μM Ach, followed by 10 μM papaverine (a) or vehicle (b) 10 min later. The ACh-induced contraction 30 min after the addition of papaverine (A) was decreased to −78.6% of the control value (B). Representative traces of repeated experiments (n = 3).

HEPES-buffered Tyrode's solution, and the results are expressed as percentages of the control ACh-induced contraction in the presence of 1.8 mM Ca2+ elicited at the beginning of the experiment. When the external solution was changed to Ca2+-free solution (with 1 mM BAPTA) and ACh was added, the ACh-induced contraction was decreased to 41.6 ± 5.2% (n = 4) of the control, indicating that the contraction was partially dependent on extracellular Ca2+. When the fibers were pretreated with 50 μM BAPTA-AM for 15 min in Ca2+free solution, the ACh-induced contraction was decreased further to 15.3 ± 3.9% (n = 4), indicating that the intracellular

Ca2+ chelator BAPTA-AM can partially inhibit contraction that is independent of extracellular Ca2+. Calcium response Measurements using Fluo-3 revealed that ACh (100 μM) induced a sustained increase in [Ca2+]i in PC17C4 cells (Figs. 4A, B). Treatment with the muscarinic ACh receptor-antagonist atropine (Atp; 1 μM) inhibited the ACh-induced increase in calcium levels by decreasing the number of ACh-responsive cells from 59.3 ± 6.3% to 5.8 ± 2.7% (n = 6; Fig. 4C). NA

26

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

Fig. 4. Agonist-induced increases in [Ca2+]i in PC17C4 cells. (A) The PC17C4 cells in culture were incubated at 37 °C and then treated with ACh. (a) The fluorescence-intensity image showing [Ca2+]i at the three regions indicated by colored circles of the same preparation as that in panel a. Scale bar indicates 100 μm. (c) The time course of [Ca2+]i changes after treatment with ACh (100 μM). The yellow, red, and blue lines represent the changes in the three regions that included cells responsive to ACh with an increased [Ca2+]i shown in panels a and b. Ft/Fo represents the temporal fluorescence intensity of the dyes/ fluorescence intensity at the start. (B) Effect of Atp on the elevation of [Ca2+]i in PC17C4 cells. To quantify the cells that responded to agonists with an increased [Ca2+]i, Fluo-3-fluorescent cells that also increased the fluorescent intensity following the addition of ACh (100 μM) or NA (10 μM) were counted in six or seven visual fields. Cells were pretreated with Atp (1 μM) for 10 min before the addition of ACh. Data points and error bars represent the mean ± SE (n = 6–7). **p < 0.001, compared between groups.

(10 μM) also increased the [Ca2+]i in PC17C4 cells to a frequency of 27.6 ± 8.6% (n = 6) of the total Fluo-3-fluorescent cells (Fig. 4C). These results indicate that the cells in culture exhibited [Ca2+]i responses to the contractile agonists. Discussion This study reports the first quantitative measurement of the contractions produced by cultured microvascular pericytes from mouse brain parenchyma. These findings were made possible through the use of our previously established techniques for

reconstituted hybrid smooth-muscle fibers (Oishi et al., 2000). The results of the present study suggest that the pericytes contract isometrically in response to typical contractile agonists, such as ACh and NA. The role of pericytes in controlling the tone and permeability of the microvessels is an area of active investigation. A substantial body of indirect evidence suggests that the pericytes of the microvascular systems have a contractile function (Das et al., 1988; Kelley et al., 1987, 1988). In most cases, pericyte contraction has been assessed on cells grown on deformable substrates, rather than directly on non-deformable plastic dishes, thus permitting cell shortening. The magnitude of the cellular force in these experiments has been inferred from the degree of wrinkling of the substrates. However, the extent to which pericyte contractility contributes to the physiological regulation of capillary blood flow has remained unclear. In our current system, the contractile force can be measured both directly and quantitatively. Given that the contractile function of pericytes might contribute to their critical regulatory role, this technique represents an important step towards an improved understanding of pericyte reactivity. Our method offers several advantages for studies of pericyte contraction. For example, investigators can measure the contraction of a single cell type isolated from various microvessel tissues. Furthermore, cell culture allows biochemical and genetic manipulations to be performed in an attempt to dissect the molecular pathways that are involved in the control of mechanical functions. The major disadvantage of this system is that the cells are modified compared with their in vivo counterparts. Nevertheless, this approach provides a powerful tool for functional and developmental studies of pericytes. The PC17C4 cells were isolated and cultured from adult mouse cerebral parenchyma microvessels. In culture, these cells were morphologically distinct from fibroblasts, endothelial cells, and smooth-muscle cells. At the molecular level, they expressed CD44 (Sarugaser et al., 2005), CD90 (Sarugaser et al., 2005), NG2 (Song et al., 2005), α-smooth-muscle actin (Bandopadhyay et al., 2001), nestin (Alliot et al., 1999), aminopeptidase A (Alliot et al., 1999), and vimentin (Bandopadhyay et al., 2001); these products are expressed in pericytes, although they are not specific to this cell type. By contrast, the PC17C4 cells did not express the marker proteins for endothelial cells, PECAM-1, or marker proteins for smoothmuscle cells (SM-1, SM-2, and SMemb myosin heavy chains and desmin). Fibroblasts do not express nestin and NG2, which were co-expressed in the PC17C4 cells. Finally, when the PC17C4 cells were cultured three-dimensionally with basic fibroblast growth factor (bFGF) according to the method described previously (Oishi et al., 2004), vascular tube-like structures were formed in the gel (Oishi et al., unpublished data). The formation of luminal structures is a reported characteristic of pericytes (Nico et al., 2004), and was not observed when skin fibroblasts or cerebral artery smoothmuscle cells were used. Taken together, these results indicate that the cells in culture were, indeed, pericytes. There were no significant differences in the morphology, marker-protein expression, growth patterns, or contractile

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

responses of the PC17C4 cells that were passaged 2, 10, or 20 times. These results indicate that the phenotypic change that takes place during the culture process is negligible. Pericytes regulate microcirculation by capillary-configuration maintenance and through altering contractility. In the current study, the reconstituted preparation produced by embedding the PC17C4 cells in the collagen gel showed isometric contractions evoked by typical contractile agonists, such as ACh and NA. Pericytes express muscarinic ACh receptors and adrenergic receptors (Elfont et al., 1989; FerrariDileo et al., 1992); in addition, in retinal microvessels, the stimulation of muscarinic ACh receptors causes the elevation of [Ca2+]i in pericytes and leads to Ca2+-dependent contraction (Wu et al., 2003). We observed that fibers that were reconstituted by the mouse cerebral parenchyma microvessel pericytes produced isometric contraction that was accompanied by an increase in [Ca2+]i. NA also caused contraction in PC17C4 cells. In pericytes, stimulation of the β-adrenergic receptor is thought to induce relaxation, whereas stimulation of the α2-adrenergic receptor inhibits this activity (Ferrari-Dileo et al., 1992; Kelley et al., 1988). The reconstructed preparation containing PC17C4 cells contracted in response to an α1-adrenergic receptor agonist (Phe), but not in response to the α2-adrenergic receptor agonist clonidine (data not shown). Therefore, it is likely that the NAinduced contraction was due to the stimulation of the α1adrenergic receptor. By contrast, 5-HT, His, and ET-1 yielded no contractile responses. 5-HT and His are reportedly contractile agonists for pericytes (Kelley et al., 1988). ET-1 is a strong vasoconstrictor peptide released from vascular endothelial cells. Pericytes are thought to have contractile activity because they have endothelin receptors (Dehouck et al., 1997; Yamagishi et al., 1993). mRNAs for ETA and ETB receptors were not detected in the passage 10 culture or the fibers of PC17C4 cells (data not shown). These results suggest that the loss of response of ET-1 is due to a lack of expression of ET receptors. Pericytes are known to be functionally codependent on endothelial cells. Each different cell type influences the mitotic rate and probably the phenotypic expression of the others (Sims, 2000). Moreover, ET receptor expression in vascular smooth-muscle cells is reportedly endothelium-dependent (Redmond et al., 1997). One explanation for the lack of expression of ET receptors is therefore that the clonally isolated and cultured pericytes were free from endothelial cells, so that these receptors were downregulated during the culture process. The pericyte population is known to vary greatly between different tissues and organs (Sims, 2000). An alternative explanation is that we isolated a subpopulation of pericytes that had no ET receptors. The use of carefully separated pericyte populations and a flow-cytometric strategy will address these issues. To compare the isometric-force values produced by PC17C4 cells with those produced by smooth-muscle cells, we calculated the cellular cross-sectional areas of the collagen fibers. The measurements were performed by computing the percentages of the collagen fiber cross-sectional areas that were occupied by cells within the sections. Cultured PC17C4

27

cells in collagen fibers that had been incubated for 7 days and exposed to 10− 5 M NA and 10− 5 M NA produced isometric forces of 2.01 ± 0.07 and 2.20 ± 0.05 mN/mm2, respectively (n = 4); these values were 43.9 and 48.0% of the NA-triggered response seen in guinea pig stomach smooth-muscle fibers (Oishi et al., 2000). Pericytes have been reported to transform into smoothmuscle cells and fibroblasts (Collett and Canfield, 2005; Nehls and Drenckhahn, 1993). One question that therefore arises is whether the mechanical stress placed on the pericytes when they are loaded in the collagen gel might change their phenotype such that they become smooth-muscle cells and fibroblasts. We thus examined the expression of pericyte-marker proteins in the fibers. Immunocytochemical analyses revealed that the PC17C4 cells in fibers that had been incubated for 7 days were immunoreactive for pericyte-marker proteins, such as αsmooth-muscle actin, nestin, and aminopeptidase A (Fig. 2B), but not for the smooth-muscle-marker proteins SM-1, SM-2, or SMemb myosin heavy chains. The RT-PCR results also indicated the presence of mRNAs for pericyte-marker proteins, including α-smooth-muscle actin, nestin, and vimentin. In addition, we could not detect the endothelial cell marker PECAM-1 or the astrocyte marker GFAP, indicating that any phenotypic change into smooth-muscle cells, endothelial cells, and astrocytes was also negligible. These results confirm that the PC17C4 cells in the gel were, indeed, pericytes. In conclusion, string-shaped reconstituted pericyte fibers were prepared in rectangular wells by the thermal gelation of a mixed solution of collagen and pericyte clones, which were derived from the microvessels of mouse brain parenchyma. The fibers contracted isometrically in response to ACh and NA in a dose-dependent manner. The fibers that were precontracted by ACh were completely relaxed by papaverine. These findings indicate that cerebroparenchymal pericytes show isometric contraction in response to typical contractile agonists in a dose-dependent manner, thereby regulating microcirculation in the cerebral parenchyma. This technique will allow us to directly address questions relating to the characteristics of the contraction of cerebroparenchymal pericytes. Acknowledgments This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan. This work was also supported, in part, by a grant for the promotion of the advancement of education and research in graduate schools from the Ministry of Education, Culture, Sports and Technology of Japan. References Alliot, F., Rutin, J., Leenen, P.J., Pessac, B., 1999. Pericytes and periendothelial cells of brain parenchyma vessels co-express aminopeptidase N, aminopeptidase A, and nestin. J. Neurosci. Res. 58, 367–378. Bandopadhyay, R., Orte, C., Lawrenson, J.G., Reid, A.R., De Silva, S., Allt, G., 2001. Contractile proteins in pericytes at the blood–brain and blood–retinal barriers. J. Neurocytol. 30, 35–44.

28

K. Oishi et al. / Microvascular Research 73 (2007) 20–28

Bao, J., Oishi, K., Yamada, T., Liu, L., Nakamura, A., Uchida, M.K., Kohama, K., 2002. Role of the short isoform of myosin light chain kinase in the contraction of cultured smooth muscle cells as examined by its downregulation. Proc. Natl. Acad. Sci. U. S. A. 99, 9556–9561. Collett, G.D., Canfield, A.E., 2005. Angiogenesis and pericytes in the initiation of ectopic calcification. Circ. Res. 96, 930–938. Das, A., Frank, R.N., Weber, M.L., Kennedy, A., Reidy, C.A., Mancini, M.A., 1988. ATP causes retinal pericytes to contract in vitro. Exp. Eye Res. 46, 349–362. Dehouck, M.P., Vigne, P., Torpier, G., Breittmayer, J.P., Cecchelli, R., Frelin, C., 1997. Endothelin-1 as a mediator of endothelial cell-pericyte interactions in bovine brain capillaries. J. Cereb. Blood Flow Metab. 17, 464–469. Elfont, R.M., Sundaresan, P.R., Sladek, C.D., 1989. Adrenergic receptors on cerebral microvessels: pericyte contribution. Am. J. Physiol. 256, R224–R230. Ferrari-Dileo, G., Davis, E.B., Anderson, D.R., 1992. Effects of cholinergic and adrenergic agonists on adenylate cyclase activity of retinal microvascular pericytes in culture. Invest. Ophthalmol. Visual Sci. 33, 42–47. Guma, F.C.R., Mello, T.G., Mermelstein, C.S., Fortuna, V.A., Wofchuk, S.T., Gottfried, C., Guaragna, R.M., Costa, M.L., Borojevic, R., 2001. Intermediate filaments modulation in an in vitro model of the hepatic stellate cell activation or conversion into the lipocyte phenotype. Biochem. Cell Biol. 79, 409–417. Hirschi, K.K., D'Amore, P.A., 1996. Pericytes in the microvasculature. Cardiovasc. Res. 32, 687–698. Kelley, C., D'Amore, P., Hechtman, H.B., Shepro, D., 1987. Microvascular pericyte contractility in vitro: comparison with other cells of the vascular wall. J. Cell Biol. 104, 483–490. Kelley, C., D'Amore, P., Hechtman, H.B., Shepro, D., 1988. Vasoactive hormones and cAMP affect pericyte contraction and stress fibres in vitro. J. Muscle Res. Cell Motil. 9, 184–194. Nehls, V., Drenckhahn, D., 1993. The versatility of microvascular pericytes: from mesenchyme to smooth muscle? Histochemistry 99, 1–12. Nico, B., Ennas, M.G., Crivellato, E., Frontino, A., Mangieri, D., DeGiogis, M.,

Ribatti, D., 2004. Desmin-positive pericytes in the chick embryo chorioallantoic membrane in response to basic fibroblast growth factor (bFGF). Microvasc. Res. 68, 13–19. Oishi, K., Itoh, Y., Isshiki, Y., Kai, C., Takeda, Y., Yamaura, K., TakanoOhmuro, H., Uchida, M.K., 2000. Agonist-induced isometric contraction of smooth muscle cell-populated collagen gel fiber. Am. J. Physiol.: Cell Physiol. 279, C1432–C1442. Oishi, K., Ogawa, Y., Gamoh, S., Uchida, M.K., 2002a. Contractile responses of smooth muscle cells differentiated from rat neural stem cells. J. Physiol. 540, 139–152. Oishi, K., Takatoh, Y., Bao, J., Uchida, M.K., 2002b. Contractile responses and myosin phosphorylation in reconstituted fibers of smooth muscle cells from the rat cerebral artery. Jpn. J. Pharmacol. 90, 36–50. Oishi, K., Kobayashi, A., Fujii, K., Kanehira, D., Ito, Y., Uchida, M.K., 2004. Angiogenesis in vitro: vascular tube formation from the differentiation of neural stem cells. J. Pharmacol. Sci. 96, 208–218. Redmond, E.M., Cahill, P.A., Sitzmann, J.V., 1997. Flow-mediated regulation of endothelin receptors in cocultured vascular smooth muscle cells: an endothelium-dependent effect. J. Vasc. Res. 34, 425–435. Rhodin, J.A., 1967. The ultrastructure of mammalian arterioles and precapillary sphincters. J. Ultrastruct. Res. 18, 181–223. Sarugaser, R., Lickorish, D., Baksh, D., Hosseini, M.M., Davies, J.E., 2005. Human umbilical cord perivascular (HUCPV) cells: a source of mesenchymal progenitors. Stem Cells 23, 220–229. Sims, D.E., 2000. Diversity within pericytes. Clin. Exp. Pharmacol. Physiol. 27, 842–846. Song, S., Ewald, A.J., Stallcup, W., Werb, Z., Bergers, G., 2005. PDGFRbeta+ perivascular progenitor cells in tumours regulate pericyte differentiation and vascular survival. Nat. Cell Biol. 7, 870–879. Wu, D.M., Kawamura, H., Sakagami, K., Kobayashi, M., Puro, D.G., 2003. Cholinergic regulation of pericyte-containing retinal microvessels. Am. J. Physiol.: Heart Circ. Physiol. 284, H2083–H2090. Yamagishi, S., Hsu, C.C., Kobayashi, K., Yamamoto, H., 1993. Endothelin 1 mediates endothelial cell-dependent proliferation of vascular pericytes. Biochem. Biophys. Res. Commun. 191, 840–846.