- Email: [email protected]
Isorhamnetin alleviates esophageal mucosal injury in a chronic model of reflux esophagitis
European Journal of Pharmacology 864 (2019) 172720
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Full length article
Isorhamnetin alleviates esophageal mucosal injury in a chronic model of reflux esophagitis
T
Gang Liu1, Chuanshen Jiang1, Dazhou Li, Lijia Yao, Yanfang Lin, Baoshan Wang, Jianting Qiu, Weisi Wang, Wen Wang∗ Department of Digestive Diseases, 900 Hospital of the Joint Logistics Team, Fuzhou, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Isorhamnetin Reflux esophagitis Inflammation Nitric oxide Oxidative stress
Gastro-esophageal reflux disease is one of the most common disorders in gastroenterology. The aim of this work was to investigate the protection of isorhamnetin against esophageal mucosal injury in rats with chronic reflux esophagitis (RE). Chronic RE model was established through fundus ligation and partial obstruction of the pylorus in rats. Then, the rats were treated with isorhamnetin (5 mg/kg) daily for a period of 14 days. Through histological and gross assessment, it was found that administration of isorhamnetin alleviated esophageal mucosal injury in RE rats. Treatment of RE rats with isorhamnetin improved esophageal barrier function, through upregulating proteins expression of occludin and zonula occludens-1 (ZO-1) and downregulating proteins expression of matrix matalloproteinases-3 (MMP3) and -9. Administration of isorhamnetin decreased CD68-positive cells and mRNA levels of IL-6, TNF-α, and IL-1β in the esophagus of RE rats. Administration of isorhamnetin downregulated inducible nitric oxide synthase (iNOS) protein expression and decreased production of nitric oxide (NO) and 3-nitrotyrosin in the esophagus of RE rats. Administration of isorhamnetin enhanced heme oxygenase-1 (HO-1) activities and reduced malondialdehyde (MDA) levels in esophagus of RE rats. Additionally, treatment with isorhamnetin inhibited p38 MAPK and NFκB activation in RE esophagus. In conclusion, isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE, possibly by suppressing formation of cytokines and infiltration of inflammatory cells, inhibiting p38 and NFκB pathways, and enhancing HO-1 activity.
1. Introduction Reflux esophagitis (RE), as one of the prevalent gastrointestinal diseases, is defined as reflux of the gastric contents into the esophagus, which results in mucosal erosions or ulcers in the esophagus. With the change of diet structure and lifestyle in modern society, chronic RE are recognized as a significant health problem increasingly (He et al., 2010; Fock et al., 2016; Tan et al., 2016). Current therapy of RE relies predominantly on the use of proton pump inhibitors (PPIs), which suppresses gastric acid secretion. However, a number of RE individuals have inadequate response to the treatment of PPIs (Weijenborg et al., 2012). Accordingly, additional treatment options are needed. It was reported that flavonoids including kaempferol, omeprazole, quercetin, and rutin protected against experimentally induced gastroesophageal reflux disease in rats (Gupta et al., 2017; Kumar et al., 2014; Wu et al., 2015). Isorhamnetin is not only a naturally occurring flavonoid, but also an intermediate metabolite of quercetin (Saleh et al.,
1990). Isorhamnetin had antioxidant and anti-inflammatory properties, and could attenuate chemically induced inflammatory bowel disease (Dou et al., 2014). Isorhamnetin blocked LPS-induced NF-κB activation and significantly reduced inflammatory cell infiltration and pro-inflammatory gene expression in rats with paw swelling (Yang et al., 2013). Isorhamnetin attenuated concanavalin A-induced acute fulminant hepatitis in mice via suppressing p38 pathway (Lu et al., 2018). Treatment of experimental stroke mice with isorhamnetin activated HO-1, suppressed iNOS, upregulated gene expression of tight junction proteins including occludin, ZO-1, and claudin-5, and led to reduced formation of MDA and 3-NT in cortex (Zhao et al., 2016). The purpose of the present study was to test the protection of isorhamnetin against esophageal mucosal injury in rats with chronic RE, and investigate the underlying mechanism.
∗
Corresponding author. Department of Digestive Diseases, 900 Hospital of the Joint Logistics Team, Xi'er Huan Northern Road 156, Fuzhou, 350025, China. E-mail address: [email protected] (W. Wang). 1 The first two authors (Gang Liu and Chuanshen Jiang) contributed equally to the work. https://doi.org/10.1016/j.ejphar.2019.172720 Received 24 May 2019; Received in revised form 2 October 2019; Accepted 2 October 2019 Available online 03 October 2019 0014-2999/ © 2019 Elsevier B.V. All rights reserved.
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
2. Materials and methods
2.6. Measurement of transepithelial electrical resistance (TER)
2.1. Animals
In chamber studies, esophageal epithelial tissue was dissected and immersed in oxygenated Ringer solution (4 °C) for mounting mucosalside-up in mini-Ussing chambers (Jovov et al., 2007) using Lucite rings (0.0314 × cm2) with an aperture of 2-mm-diameter. The esophageal epithelial samples were bathed with normal Ringer solution on both sides and gassed with 5% CO2 and 95% O2 at control temperature of 37 °C. Two sets of electrodes connected voltage current clamps (Model MC6, Physiologic Instruments, San Diego, CA, USA) to the solution in chamber, which directly recorded the transmural electrical potential difference (PD) and short-circuit current (Isc) by passage of current. After 20-min equilibration, basal electrical readings of Isc and PD were recorded every 15 min for 120 min. The total electrical resistance (RT) of each sample was calculated by using the Ohm's law (RT = PD/Isc).
Sprague-Dawley (SD, 220-250 g, male) rats obtained from the SinoBritish SIPPR/BK Lab Animal Ltd (Shanghai, China), were kept under standard temperature (22 ± 2 °C) with a 12-h light/dark cycle, and free access to tap water and food. All experiments were conducted according to the Guidance Suggestions for the Care and Use of Laboratory Animals, formulated by the Ministry of Science and Technology of China. The study was reviewed and approved by institutional ethics committee of 900 Hospital of the Joint Logistics Team (#2018053).
2.2. Chronic RE model and treatment After being fasted overnight, the rats were anesthetized with a mixture of 100 mg/kg ketamine and 10 mg/kg xylazine via intraperitoneal injection. The chronic RE model (gastroesophagal reflux/ acid reflux) was established according to the methods described previously (Omura et al., 1999; Zhang et al., 2015). The animals were divided into 3 groups randomly as follows: sham-operated group (Sham, treated with vehicle), RE group (RE, treated with vehicle), and RE + ISO group (treated with isorhamnetin). The isorhamnetin-treated group was treated with isorhamnetin (5 mg/kg/day) via intraperitoneal injection (Sun et al., 2013) 12 h after surgery. Isorhamnetin was dissolved in dimethyl sulfoxide and then diluted in phosphate buffer saline (PBS) to the final concentration of 2 g/l. An equal volume of vehicle was injected in both sham-operated group and RE group. 2 weeks after surgery, the rats were killed and the esophagus were removed for biochemical measurements and histological analysis.
2.7. Quantitative RT-PCR Total RNA from esophageal samples was extracted by using the Trizol method (Beyotime Biotechnology). Reaction was performed in a real-time PCR thermocycler (iQ5; Bio-Rad, Hercules, CA, USA). Expression value of each sample was calculated relative to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH, house keeping control gene) using the method of comparative threshold cycle (2-△△Ct). The primers of TNF-α, GAPDH, occludin, IL-6, IL-1β, and zonula occludens1 (ZO-1) were presented in Table 1.
2.8. ELISA Sera samples were obtained from blood by centrifugation at 800×g for 15 min. Levels of IL-6 (Abcam), TNF-α (R&D Systems, Minneapolis, MN, USA), and IL-1β (R&D Systems) in sera were measured with kits. The content of Nitrite/nitrate (NOx), the stable end products of nitric oxide (NO), was detected in esophageal tissue extracts with a Total Nitrite/Nitrate Assay kit (Beyotime Biotechnology). The levels of 3-NT (Northwest Life Science Specialties, Vancouver, WA, USA) and MDA (Beyotime Biotechnology) in esophageal tissue extracts were detected with kits.
2.3. Measurement of gastric content pH At the end of experiment, the gastric content of rats was collected from stomach, and then centrifuged at 3000×g for 0.5 h at room temperature. The supernatant of each sample was used for measurement of pH (Toledo 320, Mettler, Switzerland).
2.4. Immunohistochemical analysis 2.9. Statistical analysis
Paraffin sections (5-μm-thick) of esophagus were stained with hematoxylin and eosin (H&E) for histological evaluation. The slices of middlelower esophagus were incubated with primary antibodies including p38 MAPK (Abcam, Cambridge, MA, USA, ab31828), p-p38 MAPK (Abcam, ab4822), CD68 (Abcam, ab125212), matrix metalloproteinase 3 (MMP3, Abcam, ab52915) or MMP9 (Abcam, ab38898) overnight at 4 °C. The slices of mucosa of 3 groups were analyzed by 2 pathologists who were blinded to the study design.
GraphPad Prism 5.0 (GraphPad Software, CA, USA) was used for statistical analysis. The data in the work were expressed as mean ± standard deviations. Inter-group variation was calculated by One-way analysis of variance testing, followed by Bonferroni's correction. Value of P less than 0.05 was considered statistically significant. Table 1 Sequences of oligonucleotides used as primers.
2.5. Western blotting analysis
Target gene
The whole esophageal tissues were dissected and homogenated with RIPA buffer (Beyotime Biotechnology, Shanghai, China) and then centrifuged at 22,500×g at 4 °C for 15 min. Equal protein samples (20 μg) were separated on a SDS-polyacrylamide gel (12%), and then transferred to a polyvinylidene fluoride membrane. After being blocked with non-fat dry milk (50 g/l) at room temperature for 5 h, the membrane was incubated with primary antibody at room temperature for 4 h. The antibodies used in the present work was shown as follows: p38 (1:1000, Abcam, ab31828), phospho-p38 (1:2000, Abcam, ab4822), IκBα (1:1000, Abcam, ab32518), and NFκB p65 (1:1000, Abcam, ab16502). The ECL chemiluminescent detection system (Beyotime Biotechnology) was used for evaluation.
IL-1β TNF-α IL-6 occludin ZO-1 GAPDH
Sequence (5′-3′) Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC CCAGGAGAAAGTCAGCCTCCT TCATACCAGGGCTTGAGCTCA TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC AGTACATGGCTGCTGCTGATG CCCACCATCCTCTTGAT GTGT AAGGCAATTCCGTATCGTTG CCACAGCTGAAGGACTCACA GAGCTGAATGGGAAGCTCAC AAAGGTGGAGGAGTGGGAGT
ZO-1, zona occluden-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. 2
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 1. Isorhamnetin attenuated esophageal mucosal damage in RE rats. Gastric content pH (A), gross appearance (B) and histological assessment (C, hematoxylin and eosin, scale bar = 100 μm) of esophageal mucosa of sham-operated rats, RE rats, and RE + KMP rats. RE, reflux esophagitis; ISO, isorhamnetin. n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group.
Fig. 2. Isorhamnetin attenuated esophageal barrier dysfunction in RE rats. A: transepithelial electrical resistance; B, C: RT-PCR results of occludin and ZO-1. Immunohistochemical staining for MMP3 (D) and MMP9 (E) was shown (scale bar = 50 μm). RE, reflux esophagitis; ISO, isorhamnetin; TER, transepithelial electrical resistance; ZO-1, zonula occludens-1; RT-PCR, Real-time quantitative polymerase chain reaction; MMP, matrix metalloproteinase. n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
3. Results
RE exhibited vascular congestion, basal layer thickening, and infiltration of inflammatory cells (Fig. 1C). But, the esophagus of RE rats treated with isorhamnetin had less damage than the RE group. It has been known that isorhamnetin was a substrate of 3-methylquercetin 7-O-methyltransferase, and the enzyme generated S-adenosyl-L-homocysteine and rhamnazin. However, treatment with Sadenosyl-L-homocysteine or rhamnazin had no significant effect on pH value of gastric content and esophageal mucosal injury in rats with chronic RE (Fig. S1, shown in supplementary data).
3.1. Isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE The pH value of gastric content was lower in RE rats than that in Sham group. Treatment of RE rats with isorhamnetin for 14 days had no significant effect on the pH value of gastric content (Fig. 1A). Gross examination revealed that rats with chronic RE had esophageal mucosal congestion and erosion, and the RE rats treated with isorhamnetin had less damage (Fig. 1B). Histological results revealed that the esophagus of rats with chronic 3
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 3. Isorhamnetin suppressed inflammation in esophagus of RE rats. Immunohistochemical staining for CD68 (A, scale bar = 50 μm) was shown. The mRNA levels of IL-1β (B), IL-6 (C), and TNF-α (D) in esophagus were determined by RT-PCR. The levels of IL-1β (E), IL-6 (F), and TNF-α (G) in sera were determined by ELISA. RE, reflux esophagitis; ISO, isorhamnetin; RT-PCR, Real-time quantitative polymerase chain reaction; n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
Fig. 4. Isorhamnetin suppressed iNOS/NO pathway and abated oxidative stress in esophagus of RE rats. Immunohistochemical staining for iNOS (A, scale bar = 50 μm) was shown. Graphs showed the NOx (B, NO2- + NO3–), 3-NT (C) levels, activity of HO-1 (D), and MDA levels (E) of esophagus. RE, reflux esophagitis; ISO, isorhamnetin; iNOS, inducible nitric oxide synthase; NO, nitric oxide; 3-NT, 3-nitrotyrosine; MDA, malondialdehyde; HO-1, heme oxygenase-1; n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
4
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 5. Isorhamnetin suppressed p38 MAPK activation in esophagus post injury. Immunohistochemical staining (A) for p38 MAPK and phosphorylated p38 MAPK; Western blotting results and quantification analysis (B) of p38 MAPK and phosphorylated p38 MAPK. RE, reflux esophagitis; MAPK, mitogen-activated protein kinase; ISO, isorhamnetin; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
MPO activity, as an indicator of polymorphonuclear leukocyte accumulation, reflected the number of neutrophils in injured tissues. MPO activity was higher in injured esophagus, and treatment with isorhamnetin decreased MPO activity in esophagus of rats with RE (Fig. S2, shown in supplementary data).
3.2. Isorhamnetin improved esophageal barrier function in rats with chronic RE Fourteen days after surgery, TER (Fig. 2A) in the esophageal epithelium of RE rats was lower than that in sham-operated rats. Furthermore, the mRNA expression of occludin (Fig. 2B) and ZO-1 (Fig. 2C) was downregulated in esophagus of RE, when compared to sham-operated rats. Treatment with isorhamnetin increased mRNA expression of occludin and ZO-1 in esophagus and enhanced TER in rats with chronic RE. Immunohistochemical results revealed that MMP-3-positive (Fig. 2D) and MMP-9-positive cells (Fig. 2E) were increased in the esophageal epithelium of rats with chronic RE, which was reversed partly by administration of isorhamnetin.
3.4. Isorhamnetin abated oxidative stress in esophagus of rats with chronic RE Immunohistochemical staining (Fig. 4A) results revealed a significant increase of staining intensity of iNOS-positive cells in esophagus of rats with chronic RE, which was attenuated by administration of isorhamnetin. The levels of NOx (NO2− + NO3−, Figs. 4B) and 3-NT (Fig. 4C) were markedly increased 14 days after surgery. Administration of isorhamnetin decreased the production of NOx and 3-NT from esophagus of rats with chronic RE. HO-1 activities (Fig. 4D) and MDA levels (Fig. 4E) were significantly increased in esophagus mucosa of rats 14 days after surgery. Administration of isorhamnetin enhanced HO-1 activities and reduced MDA levels in esophagus of rats with chronic RE.
3.3. Isorhamnetin inhibited inflammatory response in esophagus of rats with chronic RE Immunohistochemical results revealed that CD68-positive cells were markedly increased in esophagus of rats with chronic RE (Fig. 3A), indicating the infiltration of many inflammatory cells into esophagus mucosa after surgery. 14 days after surgery, RT-PCR results revealed that mRNA expression of IL-1β (Fig. 3B), IL-6 (Fig. 3C), and TNF-α (Fig. 3D) in esophagus was upregulated, and ELISA results revealed that IL-1β (Fig. 3E), IL-6 (Fig. 3F), and TNF-α (Fig. 3G) levels in sera were enhanced. Treatment of RE rats with isorhamnetin reduced infiltration of many inflammatory cells into esophagus, downregulated mRNA expression of TNF-α, IL-6, and IL-1β in esophagus, and decreased IL-6, TNF-α, and IL-1β levels in sera.
3.5. Isorhamnetin suppressed p38 MAPK and NF-κB in esophagus post injury Immunohistochemical staining and Western blotting results revealed that the phosphorylation of p38 was significantly enhanced in esophagus of rats with chronic RE (Fig. 5A & B), which was partly reversed by administration of isorhamnetin. Western blotting results revealed that the IκBα expression was lower 5
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
HO-1, as a stress-inducible enzyme, conferred protection against inflammatory diseases in both upper and lower gastrointestinal tract including esophagus, stomach, and small and large intestine (Chang et al., 2015). HO-1 induction was usually associated with a protective response; its upregulation and subsequent production of carbon monoxide (CO) and biliverdin exhibited anti-apoptotic, anti-inflammatory, and anti-oxidant activities (Nath et al., 1992). The anti-inflammatory activity of CO was proposed to be mediated via p38 signaling (Otterbein et al., 2000; Lee and Chau, 2002). Biliverdin, as a reducing agent with antioxidant property, could scavenge proxyl radicals and attenuated lipid peroxidation efficiently (Stocker et al., 1987). Biliverdin treatment attenuated transplantation-induced injury in small bowels through decreasing expression of iNOS and the inflammatory cytokines IL-6 and IL-1β (Nakao et al., 2004). In this work, administration of isorhamnetin enhanced HO-1 activities, which contributed to the antioxidant and anti-inflammatory of isorhamnetin against RE. In human esophageal epithelial cells, p38 signalling was activated in response to chenodeoxycholic acid, acidic deoxycholic acid, and bile acids (Shan et al., 2013; Rafiee et al., 2009). The p38 signaling also acted downstream of cytokines such as TNF-α, and partly mediated their pro-inflammatory effects (Schieven, 2005). Our previous report revealed that inhibition of p38 not only suppressed inflammation, but also attenuated esophageal mucosal injury in rats with chronic RE (Zhang et al., 2015). In addition, excessive activation of NF-κB led to serious inflammation through promoting the transcription of target genes such as TNF-α and IL-6, and regulating the expression of inducible enzymes such as iNOS (Souza, 2017). In this work, administration of isorhamnetin suppressed the activation of p38 and NF-κB in esophagus, which contributed to protection of isorhamnetin against RE. Limitation of our work should be noted that it was unknown whether a direct molecular target (e.g. receptor) of isorhamnetin mediated its protective effects in RE, which required further investigation. In conclusion, isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE, possibly by suppressing formation of cytokines and infiltration of inflammatory cells, inhibiting p38 and NF-κB pathways, and enhancing HO-1 activity.
Fig. 6. Isorhamnetin suppressed NF-κB activation in esophagus post injury. Western blotting results (A) and quantification analysis (B, C) of IκBα and NFκB were shown. RE, reflux esophagitis; ISO, isorhamnetin; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
and NFκB p65 expression was higher in esophagus of rats with RE (Fig. 6), when compared to Sham group. Administration of isorhamnetin enhanced IκBα expression and reduced NFκB p65 expression in injured esophagus.
Funding 4. Discussion This study was supported by the Natural Science Foundation of Fujian Province (2016J01473). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Our work firstly demonstrated that administration of isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE. When compared to that of healthy individuals, larger amounts of various cytokines including IL-6, TNF-α, and IL-1β were produced in the mucosa of patients with gastroesophageal reflux disease (GERD) (Isomoto et al., 2003; Mönkemüller et al., 2009; Rieder et al., 2007), which promoted recruitment and migration of inflammatory cells and contributed to GERD complications including fibrosis, motility abnormalities, and carcinogenesis (Altomare et al., 2013). Isorhamnetin has been reported to have anti-inflammatory effect in several pathological models (Dou et al., 2014; Qi et al., 2018; Li et al., 2016, 2017). In this work, administration of isorhamnetin attenuated inflammatory cell infiltration and suppressed expression of proinflammatory cytokines, which contributed to the protection of isorhamnetin agaisnt RE in rats. Chronic inflammation resulted in the activation of “prosurvival genes,” including cyclooxygenase-2 (COX-2) and iNOS (van der Woude et al., 2004). The upregulation of iNOS and subsequent excessive production of NO were related with the progression of RE in patients (Inamori et al., 2006). Enhanced expression of iNOS was also observed in esophageal adenocarcinoma and Barrett's esophagus (Wilson et al., 1998; Lee et al., 2001). It was reported that reflux components including bile acids and stomach acid induced DNA damage in esophageal cells, which was dependent on iNOS and NO generation (McAdam et al., 2012). In our work, isorhamnetin downregulated expression of iNOS and suppressed generation of NO, which also contributed to the protection of isorhamnetin agaisnt RE in rats.
Declaration of competing interest No competing interests declared. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ejphar.2019.172720. References Altomare, A., Guarino, M.P., Cocca, S., Emerenziani, S., Cicala, M., 2013. Gastroesophageal reflux disease: update on inflammation and symptom perception. World J. Gastroenterol. 19, 6523–6528. Chang, M., Xue, J., Sharma, V., Habtezion, A., 2015. Protective role of hemeoxygenase-1 in gastrointestinal diseases. Cell. Mol. Life Sci. 72, 1161–1173. Dou, W., Zhang, J., Li, H., Kortagere, S., Sun, K., Ding, L., Ren, G., Wang, Z., Mani, S., 2014. Plant flavonol isorhamnetin attenuates chemically induced inflammatory bowel disease via a PXR-dependent pathway. J. Nutr. Biochem. 25, 923–933. Fock, K.M., Talley, N., Goh, K.L., Sugano, K., Katelaris, P., Holtmann, G., Pandolfino, J.E., Sharma, P., Ang, T.L., Hongo, M., Wu, J., Chen, M., Choi, M.G., Law, N.M., Sheu, B.S., Zhang, J., Ho, K.Y., Sollano, J., Rani, A.A., Kositchaiwat, C., Bhatia, S., 2016. AsiaPacific consensus on the management of gastro-oesophageal reflux disease: an update focusing on refractory reflux disease and Barrett's oesophagus. Gut 65, 1402–1415. Gupta, S.S., Azmi, L., Mohapatra, P.K., Rao, C.V., 2017. Flavonoids from whole plant of
6
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
34, 948–953. Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Lu, H.T., Wysk, M., Davis, R.J., Flavell, R.A., Choi, A.M., 2000. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat. Med. 6, 422–428. Qi, F., Sun, J.H., Yan, J.Q., Li, C.M., Lv, X.C., 2018. Anti-inflammatory effects of isorhamnetin on LPS-stimulated human gingival fibroblasts by activating Nrf2 signaling pathway. Microb. Pathog. 120, 37–41. Rafiee, P., Nelson, V.M., Manley, S., Wellner, M., Floer, M., Binion, D.G., Shaker, R., 2009. Effect of curcumin on acidic pH-induced expression of IL-6 and IL-8 in human esophageal epithelial cells (HET-1A): role of PKC., MAPKs., and NF-kappaB. Am. J. Physiol. Gastrointest. Liver Physiol. 296, G388–G398. Rieder, F., Cheng, L., Harnett, K.M., Chak, A., Cooper, G.S., Isenberg, G., Ray, M., Katz, J.A., Catanzaro, A., O'Shea, R., Post, A.B., Wong, R., Sivak, M.V., McCormick, T., Phillips, M., West, G.A., Willis, J.E., Biancani, P., Fiocchi, C., 2007. Gastroesophageal reflux disease-associated esophagitis induces endogenous cytokine production leading to motor abnormalities. Gastroenterology 132, 154–165. Saleh, N.A., Mansour, R.M., Markham, K.R., 1990. An acylated isorhamnetin glycoside from Aerva javanica. Phytochemistry 29, 1344–1345. Schieven, G.L., 2005. The biology of p38 kinase: a central role in inflammation. Curr. Top. Med. Chem. 5, 921–928. Shan, J., Oshima, T., Fukui, H., Watari, J., Miwa, H., 2013. Acidic deoxycholic acid and chenodeoxycholic acid induce interleukin-8 production through p38 mitogen-activated protein kinase and protein kinase A in a squamous epithelial model. J. Gastroenterol. Hepatol. 28, 823–828. Souza, R.F., 2017. Reflux esophagitis and its role in the pathogenesis of Barrett's metaplasia. J. Gastroenterol. 52, 767–776. Stocker, R., Yamamoto, Y., McDonagh, A.F., Glazer, A.N., Ames, B.N., 1987. Bilirubin is an antioxidant of possible physiological importance. Science 235, 1043–1046. Sun, J., Sun, G., Meng, X., Wang, H., Luo, Y., Qin, M., Ma, B., Wang, M., Cai, D., Guo, P., Sun, X., 2013. Isorhamnetin protects against doxorubicin-induced cardiotoxicity in vivo and in vitro. PLoS One 8, e64526. Tan, V.P., Wong, B.C., Wong, W.M., Leung, W.K., Tong, D., Yuen, M.F., Fass, R., 2016. Gastroesophageal reflux disease: cross-sectional study demonstrating rising prevalence in a Chinese population. J. Clin. Gastroenterol. 50, e1–7. van der Woude, C.J., Kleibeuker, J.H., Jansen, P.L., Moshage, H., 2004. Chronic inflammation., apoptosis and (pre-)malignant lesions in the gastro-intestinal tract. Apoptosis 9, 123–130. Weijenborg, P.W., Cremonini, F., Smout, A.J., Bredenoord, A.J., 2012. PPI therapy is equally effective in well-defined non-erosive reflux disease and in reflux esophagitis: a meta-analysis. Neuro Gastroenterol. Motil. 24, 747–757 e350. Wilson, K.T., Fu, S., Ramanujam, K.S., Meltzer, S.J., 1998. Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett's esophagus and associated adenocarcinomas. Cancer Res. 58, 2929–2934. Wu, P., Zhou, L., Li, Y.J., Luo, B., Yi, L.S., Chen, S.F., Sun, H.H., Chen, Y., Cao, Z.J., Xu, S.C., 2015. Protective effects of quercetin against chronic mixed reflux esophagitis in rats by inhibiting the nuclear factor-κB p65 and interleukin-8 signaling pathways. J. Dig. Dis. 16, 319–326. Yang, J.H., Kim, S.C., Shin, B.Y., Jin, S.H., Jo, M.J., Jegal, K.H., Kim, Y.W., Lee, J.R., Ku, S.K., Cho, I.J., Ki, S.H., 2013. O-Methylated flavonol isorhamnetin prevents acute inflammation through blocking of NF-κB activation. Food Chem. Toxicol. 59, 362–372. Zhang, L., Liu, G., Han, X., Liu, J., Li, G.X., Zou, D.W., Li, Z.S., 2015. Inhibition of p38 MAPK activation attenuates esophageal mucosal damage in a chronic model of reflux esophagitis. Neuro Gastroenterol. Motil. 27, 1648–1656. Zhao, J.J., Song, J.Q., Pan, S.Y., Wang, K., 2016. Treatment with isorhamnetin protects the brain against ischemic injury in mice. Neurochem. Res. 41, 1939–1948.
Euphorbia hirta and their evaluation against experimentally induced gastroesophageal reflux disease in rats. Pharmacogn. Mag. 13 (Suppl. 1), S127–S134. He, J., Ma, X., Zhao, Y., Wang, R., Yan, X., Yan, H., Yin, P., Kang, X., Fang, J., Hao, Y., Li, Q., Dent, J., Sung, J.J., Zou, D., Wallander, M.A., Johansson, S., Liu, W., Li, Z., 2010. A population-based survey of the epidemiology of symptoms-defined gastroesophageal reflux disease: the systematic investigation of gastrointestinal disease in China. BMC Gastroenterol. 10, 94. Inamori, M., Shimamura, T., Nagase, H., Abe, Y., Umezawa, T., Nakajima, A., Saito, T., Ueno, N., Tanaka, K., Sekihara, H., Togawa, J., Kaifu, H., Tsuboi, H., Kayama, H., Tominaga, S., 2006. mRNA expression of inducible nitric oxide synthase., endothelial nitric oxide synthase and vascular endothelial growth factor in esophageal mucosa biopsy specimens from patients with reflux esophagitis. Hepato-Gastroenterology 53, 361–365. Isomoto, H., Wang, A., Mizuta, Y., Akazawa, Y., Ohba, K., Omagari, K., Miyazaki, M., Murase, K., Hayashi, T., Inoue, K., Murata, I., Kohno, S., 2003. Elevated levels of chemokines in esophageal mucosa of patients with reflux esophagitis. Am. J. Gastroenterol. 98, 551–556. Jovov, B., Van Itallie, C.M., Shaheen, N.J., Carson, J.L., Gambling, T.M., Anderson, J.M., Orlando, R.C., 2007. Claudin-18: a dominant tight junction protein in Barrett's esophagus and likely contributor to its acid resistance. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G1106–G1113. Kumar, S., Singh, M., Rawat, J.K., Gautam, S., Saraf, S.A., Kaithwas, G., 2014. Effect of rutin against gastric esophageal reflux in experimental animals. Toxicol. Mech. Methods 24, 666–671. Lee, J.S., Oh, T.Y., Ahn, B.O., Cho, H., Kim, W.B., Kim, Y.B., Surh, Y.J., Kim, H.J., Hahm, K.B., 2001. Involvement of oxidative stress in experimentally induced reflux esophagitis and Barrett's esophagus: clue for the chemoprevention of esophageal carcinoma by antioxidants. Mutat. Res. 480–1, 189–200. Lee, T.S., Chau, L.Y., 2002. Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. Nat. Med. 8, 240–246. Li, J., Wu, R., Qin, X., Liu, D., Lin, F., Feng, Q., 2017. Isorhamnetin inhibits IL-1β-induced expression of inflammatory mediators in human chondrocytes. Mol. Med. Rep. 16, 4253–4258. Li, Y., Chi, G., Shen, B., Tian, Y., Feng, H., 2016. Isorhamnetin ameliorates LPS-induced inflammatory response through downregulation of NF-κB signaling. Inflammation 39, 1291–1301. Lu, X., Liu, T., Chen, K., Xia, Y., Dai, W., Xu, S., Xu, L., Wang, F., Wu, L., Li, J., Li, S., Wang, W., Yu, Q., Feng, J., Fan, X., Zhou, Y., Niu, P., Guo, C., 2018. Isorhamnetin: a hepatoprotective flavonoid inhibits apoptosis and autophagy via P38/PPAR-α pathway in mice. Biomed. Pharmacother. 103, 800–811. McAdam, E., Haboubi, H.N., Forrester, G., Eltahir, Z., Spencer-Harty, S., Davies, C., Griffiths, A.P., Baxter, J.N., Jenkins, G.J., 2012. Inducible nitric oxide synthase (iNOS) and nitric oxide (NO) are important mediators of reflux-induced cell signalling in esophageal cells. Carcinogenesis 33, 2035–2043. Mönkemüller, K., Wex, T., Kuester, D., Fry, L.C., Peitz, U., Beyer, M., Roessner, A., Malfertheiner, P., 2009. Interleukin-1beta and interleukin-8 expression correlate with the histomorphological changes in esophageal mucosa of patients with erosive and non-erosive reflux disease. Digestion 79, 186–195. Nakao, A., Otterbein, L.E., Overhaus, M., Sarady, J.K., Tsung, A., Kimizuka, K., Nalesnik, M.A., Kaizu, T., Uchiyama, T., Liu, F., Murase, N., Bauer, A.J., Bach, F.H., 2004. Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127, 595–606. Nath, K.A., Balla, G., Vercellotti, G.M., Balla, J., Jacob, H.S., Levitt, M.D., Rosenberg, M.E., 1992. Induction of heme oxygenase is a rapid., protective response in rhabdomyolysis in the rat. J. Clin. Investig. 90, 267–270. Omura, N., Kashiwagi, H., Chen, G., Suzuki, Y., Yano, F., Aoki, T., 1999. Establishment of surgically induced chronic acid reflux esophagitis in rats 10. Scand. J. Gastroenterol.
7
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Full length article
Isorhamnetin alleviates esophageal mucosal injury in a chronic model of reflux esophagitis
T
Gang Liu1, Chuanshen Jiang1, Dazhou Li, Lijia Yao, Yanfang Lin, Baoshan Wang, Jianting Qiu, Weisi Wang, Wen Wang∗ Department of Digestive Diseases, 900 Hospital of the Joint Logistics Team, Fuzhou, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Isorhamnetin Reflux esophagitis Inflammation Nitric oxide Oxidative stress
Gastro-esophageal reflux disease is one of the most common disorders in gastroenterology. The aim of this work was to investigate the protection of isorhamnetin against esophageal mucosal injury in rats with chronic reflux esophagitis (RE). Chronic RE model was established through fundus ligation and partial obstruction of the pylorus in rats. Then, the rats were treated with isorhamnetin (5 mg/kg) daily for a period of 14 days. Through histological and gross assessment, it was found that administration of isorhamnetin alleviated esophageal mucosal injury in RE rats. Treatment of RE rats with isorhamnetin improved esophageal barrier function, through upregulating proteins expression of occludin and zonula occludens-1 (ZO-1) and downregulating proteins expression of matrix matalloproteinases-3 (MMP3) and -9. Administration of isorhamnetin decreased CD68-positive cells and mRNA levels of IL-6, TNF-α, and IL-1β in the esophagus of RE rats. Administration of isorhamnetin downregulated inducible nitric oxide synthase (iNOS) protein expression and decreased production of nitric oxide (NO) and 3-nitrotyrosin in the esophagus of RE rats. Administration of isorhamnetin enhanced heme oxygenase-1 (HO-1) activities and reduced malondialdehyde (MDA) levels in esophagus of RE rats. Additionally, treatment with isorhamnetin inhibited p38 MAPK and NFκB activation in RE esophagus. In conclusion, isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE, possibly by suppressing formation of cytokines and infiltration of inflammatory cells, inhibiting p38 and NFκB pathways, and enhancing HO-1 activity.
1. Introduction Reflux esophagitis (RE), as one of the prevalent gastrointestinal diseases, is defined as reflux of the gastric contents into the esophagus, which results in mucosal erosions or ulcers in the esophagus. With the change of diet structure and lifestyle in modern society, chronic RE are recognized as a significant health problem increasingly (He et al., 2010; Fock et al., 2016; Tan et al., 2016). Current therapy of RE relies predominantly on the use of proton pump inhibitors (PPIs), which suppresses gastric acid secretion. However, a number of RE individuals have inadequate response to the treatment of PPIs (Weijenborg et al., 2012). Accordingly, additional treatment options are needed. It was reported that flavonoids including kaempferol, omeprazole, quercetin, and rutin protected against experimentally induced gastroesophageal reflux disease in rats (Gupta et al., 2017; Kumar et al., 2014; Wu et al., 2015). Isorhamnetin is not only a naturally occurring flavonoid, but also an intermediate metabolite of quercetin (Saleh et al.,
1990). Isorhamnetin had antioxidant and anti-inflammatory properties, and could attenuate chemically induced inflammatory bowel disease (Dou et al., 2014). Isorhamnetin blocked LPS-induced NF-κB activation and significantly reduced inflammatory cell infiltration and pro-inflammatory gene expression in rats with paw swelling (Yang et al., 2013). Isorhamnetin attenuated concanavalin A-induced acute fulminant hepatitis in mice via suppressing p38 pathway (Lu et al., 2018). Treatment of experimental stroke mice with isorhamnetin activated HO-1, suppressed iNOS, upregulated gene expression of tight junction proteins including occludin, ZO-1, and claudin-5, and led to reduced formation of MDA and 3-NT in cortex (Zhao et al., 2016). The purpose of the present study was to test the protection of isorhamnetin against esophageal mucosal injury in rats with chronic RE, and investigate the underlying mechanism.
∗
Corresponding author. Department of Digestive Diseases, 900 Hospital of the Joint Logistics Team, Xi'er Huan Northern Road 156, Fuzhou, 350025, China. E-mail address: [email protected] (W. Wang). 1 The first two authors (Gang Liu and Chuanshen Jiang) contributed equally to the work. https://doi.org/10.1016/j.ejphar.2019.172720 Received 24 May 2019; Received in revised form 2 October 2019; Accepted 2 October 2019 Available online 03 October 2019 0014-2999/ © 2019 Elsevier B.V. All rights reserved.
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
2. Materials and methods
2.6. Measurement of transepithelial electrical resistance (TER)
2.1. Animals
In chamber studies, esophageal epithelial tissue was dissected and immersed in oxygenated Ringer solution (4 °C) for mounting mucosalside-up in mini-Ussing chambers (Jovov et al., 2007) using Lucite rings (0.0314 × cm2) with an aperture of 2-mm-diameter. The esophageal epithelial samples were bathed with normal Ringer solution on both sides and gassed with 5% CO2 and 95% O2 at control temperature of 37 °C. Two sets of electrodes connected voltage current clamps (Model MC6, Physiologic Instruments, San Diego, CA, USA) to the solution in chamber, which directly recorded the transmural electrical potential difference (PD) and short-circuit current (Isc) by passage of current. After 20-min equilibration, basal electrical readings of Isc and PD were recorded every 15 min for 120 min. The total electrical resistance (RT) of each sample was calculated by using the Ohm's law (RT = PD/Isc).
Sprague-Dawley (SD, 220-250 g, male) rats obtained from the SinoBritish SIPPR/BK Lab Animal Ltd (Shanghai, China), were kept under standard temperature (22 ± 2 °C) with a 12-h light/dark cycle, and free access to tap water and food. All experiments were conducted according to the Guidance Suggestions for the Care and Use of Laboratory Animals, formulated by the Ministry of Science and Technology of China. The study was reviewed and approved by institutional ethics committee of 900 Hospital of the Joint Logistics Team (#2018053).
2.2. Chronic RE model and treatment After being fasted overnight, the rats were anesthetized with a mixture of 100 mg/kg ketamine and 10 mg/kg xylazine via intraperitoneal injection. The chronic RE model (gastroesophagal reflux/ acid reflux) was established according to the methods described previously (Omura et al., 1999; Zhang et al., 2015). The animals were divided into 3 groups randomly as follows: sham-operated group (Sham, treated with vehicle), RE group (RE, treated with vehicle), and RE + ISO group (treated with isorhamnetin). The isorhamnetin-treated group was treated with isorhamnetin (5 mg/kg/day) via intraperitoneal injection (Sun et al., 2013) 12 h after surgery. Isorhamnetin was dissolved in dimethyl sulfoxide and then diluted in phosphate buffer saline (PBS) to the final concentration of 2 g/l. An equal volume of vehicle was injected in both sham-operated group and RE group. 2 weeks after surgery, the rats were killed and the esophagus were removed for biochemical measurements and histological analysis.
2.7. Quantitative RT-PCR Total RNA from esophageal samples was extracted by using the Trizol method (Beyotime Biotechnology). Reaction was performed in a real-time PCR thermocycler (iQ5; Bio-Rad, Hercules, CA, USA). Expression value of each sample was calculated relative to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH, house keeping control gene) using the method of comparative threshold cycle (2-△△Ct). The primers of TNF-α, GAPDH, occludin, IL-6, IL-1β, and zonula occludens1 (ZO-1) were presented in Table 1.
2.8. ELISA Sera samples were obtained from blood by centrifugation at 800×g for 15 min. Levels of IL-6 (Abcam), TNF-α (R&D Systems, Minneapolis, MN, USA), and IL-1β (R&D Systems) in sera were measured with kits. The content of Nitrite/nitrate (NOx), the stable end products of nitric oxide (NO), was detected in esophageal tissue extracts with a Total Nitrite/Nitrate Assay kit (Beyotime Biotechnology). The levels of 3-NT (Northwest Life Science Specialties, Vancouver, WA, USA) and MDA (Beyotime Biotechnology) in esophageal tissue extracts were detected with kits.
2.3. Measurement of gastric content pH At the end of experiment, the gastric content of rats was collected from stomach, and then centrifuged at 3000×g for 0.5 h at room temperature. The supernatant of each sample was used for measurement of pH (Toledo 320, Mettler, Switzerland).
2.4. Immunohistochemical analysis 2.9. Statistical analysis
Paraffin sections (5-μm-thick) of esophagus were stained with hematoxylin and eosin (H&E) for histological evaluation. The slices of middlelower esophagus were incubated with primary antibodies including p38 MAPK (Abcam, Cambridge, MA, USA, ab31828), p-p38 MAPK (Abcam, ab4822), CD68 (Abcam, ab125212), matrix metalloproteinase 3 (MMP3, Abcam, ab52915) or MMP9 (Abcam, ab38898) overnight at 4 °C. The slices of mucosa of 3 groups were analyzed by 2 pathologists who were blinded to the study design.
GraphPad Prism 5.0 (GraphPad Software, CA, USA) was used for statistical analysis. The data in the work were expressed as mean ± standard deviations. Inter-group variation was calculated by One-way analysis of variance testing, followed by Bonferroni's correction. Value of P less than 0.05 was considered statistically significant. Table 1 Sequences of oligonucleotides used as primers.
2.5. Western blotting analysis
Target gene
The whole esophageal tissues were dissected and homogenated with RIPA buffer (Beyotime Biotechnology, Shanghai, China) and then centrifuged at 22,500×g at 4 °C for 15 min. Equal protein samples (20 μg) were separated on a SDS-polyacrylamide gel (12%), and then transferred to a polyvinylidene fluoride membrane. After being blocked with non-fat dry milk (50 g/l) at room temperature for 5 h, the membrane was incubated with primary antibody at room temperature for 4 h. The antibodies used in the present work was shown as follows: p38 (1:1000, Abcam, ab31828), phospho-p38 (1:2000, Abcam, ab4822), IκBα (1:1000, Abcam, ab32518), and NFκB p65 (1:1000, Abcam, ab16502). The ECL chemiluminescent detection system (Beyotime Biotechnology) was used for evaluation.
IL-1β TNF-α IL-6 occludin ZO-1 GAPDH
Sequence (5′-3′) Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC CCAGGAGAAAGTCAGCCTCCT TCATACCAGGGCTTGAGCTCA TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC AGTACATGGCTGCTGCTGATG CCCACCATCCTCTTGAT GTGT AAGGCAATTCCGTATCGTTG CCACAGCTGAAGGACTCACA GAGCTGAATGGGAAGCTCAC AAAGGTGGAGGAGTGGGAGT
ZO-1, zona occluden-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. 2
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 1. Isorhamnetin attenuated esophageal mucosal damage in RE rats. Gastric content pH (A), gross appearance (B) and histological assessment (C, hematoxylin and eosin, scale bar = 100 μm) of esophageal mucosa of sham-operated rats, RE rats, and RE + KMP rats. RE, reflux esophagitis; ISO, isorhamnetin. n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group.
Fig. 2. Isorhamnetin attenuated esophageal barrier dysfunction in RE rats. A: transepithelial electrical resistance; B, C: RT-PCR results of occludin and ZO-1. Immunohistochemical staining for MMP3 (D) and MMP9 (E) was shown (scale bar = 50 μm). RE, reflux esophagitis; ISO, isorhamnetin; TER, transepithelial electrical resistance; ZO-1, zonula occludens-1; RT-PCR, Real-time quantitative polymerase chain reaction; MMP, matrix metalloproteinase. n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
3. Results
RE exhibited vascular congestion, basal layer thickening, and infiltration of inflammatory cells (Fig. 1C). But, the esophagus of RE rats treated with isorhamnetin had less damage than the RE group. It has been known that isorhamnetin was a substrate of 3-methylquercetin 7-O-methyltransferase, and the enzyme generated S-adenosyl-L-homocysteine and rhamnazin. However, treatment with Sadenosyl-L-homocysteine or rhamnazin had no significant effect on pH value of gastric content and esophageal mucosal injury in rats with chronic RE (Fig. S1, shown in supplementary data).
3.1. Isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE The pH value of gastric content was lower in RE rats than that in Sham group. Treatment of RE rats with isorhamnetin for 14 days had no significant effect on the pH value of gastric content (Fig. 1A). Gross examination revealed that rats with chronic RE had esophageal mucosal congestion and erosion, and the RE rats treated with isorhamnetin had less damage (Fig. 1B). Histological results revealed that the esophagus of rats with chronic 3
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 3. Isorhamnetin suppressed inflammation in esophagus of RE rats. Immunohistochemical staining for CD68 (A, scale bar = 50 μm) was shown. The mRNA levels of IL-1β (B), IL-6 (C), and TNF-α (D) in esophagus were determined by RT-PCR. The levels of IL-1β (E), IL-6 (F), and TNF-α (G) in sera were determined by ELISA. RE, reflux esophagitis; ISO, isorhamnetin; RT-PCR, Real-time quantitative polymerase chain reaction; n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
Fig. 4. Isorhamnetin suppressed iNOS/NO pathway and abated oxidative stress in esophagus of RE rats. Immunohistochemical staining for iNOS (A, scale bar = 50 μm) was shown. Graphs showed the NOx (B, NO2- + NO3–), 3-NT (C) levels, activity of HO-1 (D), and MDA levels (E) of esophagus. RE, reflux esophagitis; ISO, isorhamnetin; iNOS, inducible nitric oxide synthase; NO, nitric oxide; 3-NT, 3-nitrotyrosine; MDA, malondialdehyde; HO-1, heme oxygenase-1; n = 8 in each group; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
4
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
Fig. 5. Isorhamnetin suppressed p38 MAPK activation in esophagus post injury. Immunohistochemical staining (A) for p38 MAPK and phosphorylated p38 MAPK; Western blotting results and quantification analysis (B) of p38 MAPK and phosphorylated p38 MAPK. RE, reflux esophagitis; MAPK, mitogen-activated protein kinase; ISO, isorhamnetin; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
MPO activity, as an indicator of polymorphonuclear leukocyte accumulation, reflected the number of neutrophils in injured tissues. MPO activity was higher in injured esophagus, and treatment with isorhamnetin decreased MPO activity in esophagus of rats with RE (Fig. S2, shown in supplementary data).
3.2. Isorhamnetin improved esophageal barrier function in rats with chronic RE Fourteen days after surgery, TER (Fig. 2A) in the esophageal epithelium of RE rats was lower than that in sham-operated rats. Furthermore, the mRNA expression of occludin (Fig. 2B) and ZO-1 (Fig. 2C) was downregulated in esophagus of RE, when compared to sham-operated rats. Treatment with isorhamnetin increased mRNA expression of occludin and ZO-1 in esophagus and enhanced TER in rats with chronic RE. Immunohistochemical results revealed that MMP-3-positive (Fig. 2D) and MMP-9-positive cells (Fig. 2E) were increased in the esophageal epithelium of rats with chronic RE, which was reversed partly by administration of isorhamnetin.
3.4. Isorhamnetin abated oxidative stress in esophagus of rats with chronic RE Immunohistochemical staining (Fig. 4A) results revealed a significant increase of staining intensity of iNOS-positive cells in esophagus of rats with chronic RE, which was attenuated by administration of isorhamnetin. The levels of NOx (NO2− + NO3−, Figs. 4B) and 3-NT (Fig. 4C) were markedly increased 14 days after surgery. Administration of isorhamnetin decreased the production of NOx and 3-NT from esophagus of rats with chronic RE. HO-1 activities (Fig. 4D) and MDA levels (Fig. 4E) were significantly increased in esophagus mucosa of rats 14 days after surgery. Administration of isorhamnetin enhanced HO-1 activities and reduced MDA levels in esophagus of rats with chronic RE.
3.3. Isorhamnetin inhibited inflammatory response in esophagus of rats with chronic RE Immunohistochemical results revealed that CD68-positive cells were markedly increased in esophagus of rats with chronic RE (Fig. 3A), indicating the infiltration of many inflammatory cells into esophagus mucosa after surgery. 14 days after surgery, RT-PCR results revealed that mRNA expression of IL-1β (Fig. 3B), IL-6 (Fig. 3C), and TNF-α (Fig. 3D) in esophagus was upregulated, and ELISA results revealed that IL-1β (Fig. 3E), IL-6 (Fig. 3F), and TNF-α (Fig. 3G) levels in sera were enhanced. Treatment of RE rats with isorhamnetin reduced infiltration of many inflammatory cells into esophagus, downregulated mRNA expression of TNF-α, IL-6, and IL-1β in esophagus, and decreased IL-6, TNF-α, and IL-1β levels in sera.
3.5. Isorhamnetin suppressed p38 MAPK and NF-κB in esophagus post injury Immunohistochemical staining and Western blotting results revealed that the phosphorylation of p38 was significantly enhanced in esophagus of rats with chronic RE (Fig. 5A & B), which was partly reversed by administration of isorhamnetin. Western blotting results revealed that the IκBα expression was lower 5
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
HO-1, as a stress-inducible enzyme, conferred protection against inflammatory diseases in both upper and lower gastrointestinal tract including esophagus, stomach, and small and large intestine (Chang et al., 2015). HO-1 induction was usually associated with a protective response; its upregulation and subsequent production of carbon monoxide (CO) and biliverdin exhibited anti-apoptotic, anti-inflammatory, and anti-oxidant activities (Nath et al., 1992). The anti-inflammatory activity of CO was proposed to be mediated via p38 signaling (Otterbein et al., 2000; Lee and Chau, 2002). Biliverdin, as a reducing agent with antioxidant property, could scavenge proxyl radicals and attenuated lipid peroxidation efficiently (Stocker et al., 1987). Biliverdin treatment attenuated transplantation-induced injury in small bowels through decreasing expression of iNOS and the inflammatory cytokines IL-6 and IL-1β (Nakao et al., 2004). In this work, administration of isorhamnetin enhanced HO-1 activities, which contributed to the antioxidant and anti-inflammatory of isorhamnetin against RE. In human esophageal epithelial cells, p38 signalling was activated in response to chenodeoxycholic acid, acidic deoxycholic acid, and bile acids (Shan et al., 2013; Rafiee et al., 2009). The p38 signaling also acted downstream of cytokines such as TNF-α, and partly mediated their pro-inflammatory effects (Schieven, 2005). Our previous report revealed that inhibition of p38 not only suppressed inflammation, but also attenuated esophageal mucosal injury in rats with chronic RE (Zhang et al., 2015). In addition, excessive activation of NF-κB led to serious inflammation through promoting the transcription of target genes such as TNF-α and IL-6, and regulating the expression of inducible enzymes such as iNOS (Souza, 2017). In this work, administration of isorhamnetin suppressed the activation of p38 and NF-κB in esophagus, which contributed to protection of isorhamnetin against RE. Limitation of our work should be noted that it was unknown whether a direct molecular target (e.g. receptor) of isorhamnetin mediated its protective effects in RE, which required further investigation. In conclusion, isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE, possibly by suppressing formation of cytokines and infiltration of inflammatory cells, inhibiting p38 and NF-κB pathways, and enhancing HO-1 activity.
Fig. 6. Isorhamnetin suppressed NF-κB activation in esophagus post injury. Western blotting results (A) and quantification analysis (B, C) of IκBα and NFκB were shown. RE, reflux esophagitis; ISO, isorhamnetin; Data are means ± S.D., *P < 0.05 versus the sham-operated group; #P < 0.05 versus the RE group.
and NFκB p65 expression was higher in esophagus of rats with RE (Fig. 6), when compared to Sham group. Administration of isorhamnetin enhanced IκBα expression and reduced NFκB p65 expression in injured esophagus.
Funding 4. Discussion This study was supported by the Natural Science Foundation of Fujian Province (2016J01473). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Our work firstly demonstrated that administration of isorhamnetin attenuated esophageal mucosal injury in rats with chronic RE. When compared to that of healthy individuals, larger amounts of various cytokines including IL-6, TNF-α, and IL-1β were produced in the mucosa of patients with gastroesophageal reflux disease (GERD) (Isomoto et al., 2003; Mönkemüller et al., 2009; Rieder et al., 2007), which promoted recruitment and migration of inflammatory cells and contributed to GERD complications including fibrosis, motility abnormalities, and carcinogenesis (Altomare et al., 2013). Isorhamnetin has been reported to have anti-inflammatory effect in several pathological models (Dou et al., 2014; Qi et al., 2018; Li et al., 2016, 2017). In this work, administration of isorhamnetin attenuated inflammatory cell infiltration and suppressed expression of proinflammatory cytokines, which contributed to the protection of isorhamnetin agaisnt RE in rats. Chronic inflammation resulted in the activation of “prosurvival genes,” including cyclooxygenase-2 (COX-2) and iNOS (van der Woude et al., 2004). The upregulation of iNOS and subsequent excessive production of NO were related with the progression of RE in patients (Inamori et al., 2006). Enhanced expression of iNOS was also observed in esophageal adenocarcinoma and Barrett's esophagus (Wilson et al., 1998; Lee et al., 2001). It was reported that reflux components including bile acids and stomach acid induced DNA damage in esophageal cells, which was dependent on iNOS and NO generation (McAdam et al., 2012). In our work, isorhamnetin downregulated expression of iNOS and suppressed generation of NO, which also contributed to the protection of isorhamnetin agaisnt RE in rats.
Declaration of competing interest No competing interests declared. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ejphar.2019.172720. References Altomare, A., Guarino, M.P., Cocca, S., Emerenziani, S., Cicala, M., 2013. Gastroesophageal reflux disease: update on inflammation and symptom perception. World J. Gastroenterol. 19, 6523–6528. Chang, M., Xue, J., Sharma, V., Habtezion, A., 2015. Protective role of hemeoxygenase-1 in gastrointestinal diseases. Cell. Mol. Life Sci. 72, 1161–1173. Dou, W., Zhang, J., Li, H., Kortagere, S., Sun, K., Ding, L., Ren, G., Wang, Z., Mani, S., 2014. Plant flavonol isorhamnetin attenuates chemically induced inflammatory bowel disease via a PXR-dependent pathway. J. Nutr. Biochem. 25, 923–933. Fock, K.M., Talley, N., Goh, K.L., Sugano, K., Katelaris, P., Holtmann, G., Pandolfino, J.E., Sharma, P., Ang, T.L., Hongo, M., Wu, J., Chen, M., Choi, M.G., Law, N.M., Sheu, B.S., Zhang, J., Ho, K.Y., Sollano, J., Rani, A.A., Kositchaiwat, C., Bhatia, S., 2016. AsiaPacific consensus on the management of gastro-oesophageal reflux disease: an update focusing on refractory reflux disease and Barrett's oesophagus. Gut 65, 1402–1415. Gupta, S.S., Azmi, L., Mohapatra, P.K., Rao, C.V., 2017. Flavonoids from whole plant of
6
European Journal of Pharmacology 864 (2019) 172720
G. Liu, et al.
34, 948–953. Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Lu, H.T., Wysk, M., Davis, R.J., Flavell, R.A., Choi, A.M., 2000. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat. Med. 6, 422–428. Qi, F., Sun, J.H., Yan, J.Q., Li, C.M., Lv, X.C., 2018. Anti-inflammatory effects of isorhamnetin on LPS-stimulated human gingival fibroblasts by activating Nrf2 signaling pathway. Microb. Pathog. 120, 37–41. Rafiee, P., Nelson, V.M., Manley, S., Wellner, M., Floer, M., Binion, D.G., Shaker, R., 2009. Effect of curcumin on acidic pH-induced expression of IL-6 and IL-8 in human esophageal epithelial cells (HET-1A): role of PKC., MAPKs., and NF-kappaB. Am. J. Physiol. Gastrointest. Liver Physiol. 296, G388–G398. Rieder, F., Cheng, L., Harnett, K.M., Chak, A., Cooper, G.S., Isenberg, G., Ray, M., Katz, J.A., Catanzaro, A., O'Shea, R., Post, A.B., Wong, R., Sivak, M.V., McCormick, T., Phillips, M., West, G.A., Willis, J.E., Biancani, P., Fiocchi, C., 2007. Gastroesophageal reflux disease-associated esophagitis induces endogenous cytokine production leading to motor abnormalities. Gastroenterology 132, 154–165. Saleh, N.A., Mansour, R.M., Markham, K.R., 1990. An acylated isorhamnetin glycoside from Aerva javanica. Phytochemistry 29, 1344–1345. Schieven, G.L., 2005. The biology of p38 kinase: a central role in inflammation. Curr. Top. Med. Chem. 5, 921–928. Shan, J., Oshima, T., Fukui, H., Watari, J., Miwa, H., 2013. Acidic deoxycholic acid and chenodeoxycholic acid induce interleukin-8 production through p38 mitogen-activated protein kinase and protein kinase A in a squamous epithelial model. J. Gastroenterol. Hepatol. 28, 823–828. Souza, R.F., 2017. Reflux esophagitis and its role in the pathogenesis of Barrett's metaplasia. J. Gastroenterol. 52, 767–776. Stocker, R., Yamamoto, Y., McDonagh, A.F., Glazer, A.N., Ames, B.N., 1987. Bilirubin is an antioxidant of possible physiological importance. Science 235, 1043–1046. Sun, J., Sun, G., Meng, X., Wang, H., Luo, Y., Qin, M., Ma, B., Wang, M., Cai, D., Guo, P., Sun, X., 2013. Isorhamnetin protects against doxorubicin-induced cardiotoxicity in vivo and in vitro. PLoS One 8, e64526. Tan, V.P., Wong, B.C., Wong, W.M., Leung, W.K., Tong, D., Yuen, M.F., Fass, R., 2016. Gastroesophageal reflux disease: cross-sectional study demonstrating rising prevalence in a Chinese population. J. Clin. Gastroenterol. 50, e1–7. van der Woude, C.J., Kleibeuker, J.H., Jansen, P.L., Moshage, H., 2004. Chronic inflammation., apoptosis and (pre-)malignant lesions in the gastro-intestinal tract. Apoptosis 9, 123–130. Weijenborg, P.W., Cremonini, F., Smout, A.J., Bredenoord, A.J., 2012. PPI therapy is equally effective in well-defined non-erosive reflux disease and in reflux esophagitis: a meta-analysis. Neuro Gastroenterol. Motil. 24, 747–757 e350. Wilson, K.T., Fu, S., Ramanujam, K.S., Meltzer, S.J., 1998. Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett's esophagus and associated adenocarcinomas. Cancer Res. 58, 2929–2934. Wu, P., Zhou, L., Li, Y.J., Luo, B., Yi, L.S., Chen, S.F., Sun, H.H., Chen, Y., Cao, Z.J., Xu, S.C., 2015. Protective effects of quercetin against chronic mixed reflux esophagitis in rats by inhibiting the nuclear factor-κB p65 and interleukin-8 signaling pathways. J. Dig. Dis. 16, 319–326. Yang, J.H., Kim, S.C., Shin, B.Y., Jin, S.H., Jo, M.J., Jegal, K.H., Kim, Y.W., Lee, J.R., Ku, S.K., Cho, I.J., Ki, S.H., 2013. O-Methylated flavonol isorhamnetin prevents acute inflammation through blocking of NF-κB activation. Food Chem. Toxicol. 59, 362–372. Zhang, L., Liu, G., Han, X., Liu, J., Li, G.X., Zou, D.W., Li, Z.S., 2015. Inhibition of p38 MAPK activation attenuates esophageal mucosal damage in a chronic model of reflux esophagitis. Neuro Gastroenterol. Motil. 27, 1648–1656. Zhao, J.J., Song, J.Q., Pan, S.Y., Wang, K., 2016. Treatment with isorhamnetin protects the brain against ischemic injury in mice. Neurochem. Res. 41, 1939–1948.
Euphorbia hirta and their evaluation against experimentally induced gastroesophageal reflux disease in rats. Pharmacogn. Mag. 13 (Suppl. 1), S127–S134. He, J., Ma, X., Zhao, Y., Wang, R., Yan, X., Yan, H., Yin, P., Kang, X., Fang, J., Hao, Y., Li, Q., Dent, J., Sung, J.J., Zou, D., Wallander, M.A., Johansson, S., Liu, W., Li, Z., 2010. A population-based survey of the epidemiology of symptoms-defined gastroesophageal reflux disease: the systematic investigation of gastrointestinal disease in China. BMC Gastroenterol. 10, 94. Inamori, M., Shimamura, T., Nagase, H., Abe, Y., Umezawa, T., Nakajima, A., Saito, T., Ueno, N., Tanaka, K., Sekihara, H., Togawa, J., Kaifu, H., Tsuboi, H., Kayama, H., Tominaga, S., 2006. mRNA expression of inducible nitric oxide synthase., endothelial nitric oxide synthase and vascular endothelial growth factor in esophageal mucosa biopsy specimens from patients with reflux esophagitis. Hepato-Gastroenterology 53, 361–365. Isomoto, H., Wang, A., Mizuta, Y., Akazawa, Y., Ohba, K., Omagari, K., Miyazaki, M., Murase, K., Hayashi, T., Inoue, K., Murata, I., Kohno, S., 2003. Elevated levels of chemokines in esophageal mucosa of patients with reflux esophagitis. Am. J. Gastroenterol. 98, 551–556. Jovov, B., Van Itallie, C.M., Shaheen, N.J., Carson, J.L., Gambling, T.M., Anderson, J.M., Orlando, R.C., 2007. Claudin-18: a dominant tight junction protein in Barrett's esophagus and likely contributor to its acid resistance. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G1106–G1113. Kumar, S., Singh, M., Rawat, J.K., Gautam, S., Saraf, S.A., Kaithwas, G., 2014. Effect of rutin against gastric esophageal reflux in experimental animals. Toxicol. Mech. Methods 24, 666–671. Lee, J.S., Oh, T.Y., Ahn, B.O., Cho, H., Kim, W.B., Kim, Y.B., Surh, Y.J., Kim, H.J., Hahm, K.B., 2001. Involvement of oxidative stress in experimentally induced reflux esophagitis and Barrett's esophagus: clue for the chemoprevention of esophageal carcinoma by antioxidants. Mutat. Res. 480–1, 189–200. Lee, T.S., Chau, L.Y., 2002. Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. Nat. Med. 8, 240–246. Li, J., Wu, R., Qin, X., Liu, D., Lin, F., Feng, Q., 2017. Isorhamnetin inhibits IL-1β-induced expression of inflammatory mediators in human chondrocytes. Mol. Med. Rep. 16, 4253–4258. Li, Y., Chi, G., Shen, B., Tian, Y., Feng, H., 2016. Isorhamnetin ameliorates LPS-induced inflammatory response through downregulation of NF-κB signaling. Inflammation 39, 1291–1301. Lu, X., Liu, T., Chen, K., Xia, Y., Dai, W., Xu, S., Xu, L., Wang, F., Wu, L., Li, J., Li, S., Wang, W., Yu, Q., Feng, J., Fan, X., Zhou, Y., Niu, P., Guo, C., 2018. Isorhamnetin: a hepatoprotective flavonoid inhibits apoptosis and autophagy via P38/PPAR-α pathway in mice. Biomed. Pharmacother. 103, 800–811. McAdam, E., Haboubi, H.N., Forrester, G., Eltahir, Z., Spencer-Harty, S., Davies, C., Griffiths, A.P., Baxter, J.N., Jenkins, G.J., 2012. Inducible nitric oxide synthase (iNOS) and nitric oxide (NO) are important mediators of reflux-induced cell signalling in esophageal cells. Carcinogenesis 33, 2035–2043. Mönkemüller, K., Wex, T., Kuester, D., Fry, L.C., Peitz, U., Beyer, M., Roessner, A., Malfertheiner, P., 2009. Interleukin-1beta and interleukin-8 expression correlate with the histomorphological changes in esophageal mucosa of patients with erosive and non-erosive reflux disease. Digestion 79, 186–195. Nakao, A., Otterbein, L.E., Overhaus, M., Sarady, J.K., Tsung, A., Kimizuka, K., Nalesnik, M.A., Kaizu, T., Uchiyama, T., Liu, F., Murase, N., Bauer, A.J., Bach, F.H., 2004. Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127, 595–606. Nath, K.A., Balla, G., Vercellotti, G.M., Balla, J., Jacob, H.S., Levitt, M.D., Rosenberg, M.E., 1992. Induction of heme oxygenase is a rapid., protective response in rhabdomyolysis in the rat. J. Clin. Investig. 90, 267–270. Omura, N., Kashiwagi, H., Chen, G., Suzuki, Y., Yano, F., Aoki, T., 1999. Establishment of surgically induced chronic acid reflux esophagitis in rats 10. Scand. J. Gastroenterol.
7