Isosteviol Sodium Protects Against Permanent Cerebral Ischemia Injury in Mice via Inhibition of NF-κB–Mediated Inflammatory and Apoptotic Responses

ARTICLE IN PRESS

Isosteviol Sodium Protects Against Permanent Cerebral Ischemia Injury in Mice via Inhibition of NF-κB–Mediated Inflammatory and Apoptotic Responses Hao Zhang,*,1 Xiaoou Sun,*,1,† Yanxiang Xie,* Jie Zan,† and Wen Tan*,†

Background: Isosteviol sodium (STVNa) has been reported to have neuroprotective effects against ischemia/reperfusion (I/R) injury in rats. Furthermore, recanalization treatments, including thrombolytic therapy, have several limitations. Excessive inflammation and apoptosis contribute to the pathogenesis of ischemic brain damage. Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) is critical to these processes and is associated with cerebral ischemia. Therefore, we studied the potential therapeutic effects and mechanisms of STVNa on permanent cerebral ischemia in mice. Methods: Permanent middle cerebral artery occlusion (pMCAO) was established via the suture method, followed by intravenous STVNa (7.5, 15, 30, 45, and 60 mg/kg). Neurobehavioral deficits, infarct volume, and histology were examined 24 hours after cerebral ischemia. In addition, the messenger RNA (mRNA) expression of NF-κB–related genes was detected using real-time quantitative polymerase chain reaction (qPCR). Results: STVNa (30 mg/kg) had significant neuroprotective effects 24 hours after pMCAO, including the reduction of the infarct volume and the improvement of the neurological severity score. Immunohistochemistry demonstrated that STVNa significantly increased the number of restored neurons and decreased the number of astrocytes. qPCR also demonstrated that the mRNA expression of inhibitor of nuclear factor kappa-B kinase-α, inhibitor of nuclear factor kappa-B kinase-β, NF-κB, inhibitor of NF-κB-α, tumor necrosis factor-α, interleukin-1 beta, Bcl2-associated X protein, and caspase-3 were significantly downregulated, whereas B-cell CLL/lymphoma 2 mRNA was upregulated with STVNa treatment compared with vehicle. Conclusions: These findings demonstrate a neuroprotective role of STVNa during cerebral ischemia, which may result from interactions with the NF-κB signaling pathway and the associated inflammatory and apoptotic responses. Key Words: Permanent cerebral ischemia—STVNa—NF-κB—inflammatory—apoptosis. © 2017 Published by Elsevier Inc. on behalf of National Stroke Association.

Introduction From the *School of Bioscience and Bioengineering, South China University of Technology, Guangzhou 510006, China; and †Institute of Biomedical and Pharmaceutical Sciences, Guangdong University of Technology, Guangzhou 510005, China. Received April 8, 2017; revision received June 1, 2017; accepted June 9, 2017. Address correspondence to Wen Tan, MD, PhD, Institute of Biomedical and Pharmaceutical Sciences, Guangdong University of Technology, Guangzhou 510006, China. E-mail: [email protected]. 1 The authors equally contributed to this paper. 1052-3057/$ - see front matter © 2017 Published by Elsevier Inc. on behalf of National Stroke Association. http://dx.doi.org/10.1016/j.jstrokecerebrovasdis.2017.06.023

Stroke is 1 of 3 leading causes of human death, with ischemic stroke accounting for 70% of all strokes.1 Recanalization and neuroprotection are currently the primary treatment options for acute ischemic stroke. However, due to the narrow therapeutic time window and hemorrhagic complications associated with tissue plasminogen activator treatment,2 this option is only used in 3%-5% of U.S. patients with ischemic stroke. 3 The goal of neuroprotective strategies is to protect the penumbra brain tissue and attenuate clinical sequelae of stroke. Although a large number of neuroprotective interventions are efficacious in small animal preclinical studies, clinical

Journal of Stroke and Cerebrovascular Diseases, Vol. ■■, No. ■■ (■■), 2017: pp ■■–■■

1

ARTICLE IN PRESS H. ZHANG ET AL.

2

studies in humans have not yet demonstrated similar efficacy.4 Cerebral ischemia is a pathological condition characterized by an initial restriction of blood to the brain. Processes involved in cerebral ischemic damage include inflammation, excitotoxicity, mitochondrial dysfunction, and oxidative stress,5 with particularly harmful effects of inflammation and apoptosis.6-8 For example, numerous studies have demonstrated that the acute inflammatory response is initiated by neutrophil adherence to the ischemic endothel.9 Other studies have demonstrated that neuronal apoptosis is commonly induced during cerebral ischemia.10 These pathological changes have been observed during ischemic pathology in experimental animal models of stroke, as well as in humans.6 Numerous studies investigating the underlying mechanisms of inflammation and apoptosis demonstrate a critical role of nuclear factor kappa-light-chainenhancer of activated B cells (NF-κB) in the induction of these processes in conditions including arthritis,11 asthma,12 myocardial infarction,13 and cerebral ischemia.14-16 Stevioside, a natural sweetener isolated from the herb Stevia rebaudiana, has been used for decades in many countries as a food sweetener. Previous studies have shown that stevioside can reduce blood sugar and blood pressure,17,18 which may be beneficial during cerebral ischemia. Isosteviol is obtained by the acid hydrolysis of stevioside, a process which maintains the desirable pharmacological activities of stevioside. A previous study reported that pretreatment with isosteviol inhibits NFκB expression, thus reducing inflammation and apoptosis in a rat model of stroke.19 However, isosteviol is a beyerene diterpene and is therefore not suitable as an aqueous injection to treat ischemic diseases because it has poor solubility and low bioavailability.20 An injectable formulation of isosteviol sodium salt, STVNa, possesses much greater solubility and bioavailability; thus, STVNa has the potential to be widely applied as an emergency treatment.21 We previously demonstrated that STVNa effectively reduces the infarct volume and improves neurological deficits in ischemia/reperfusion (I/R) injury in rats.22 However, the detailed mechanisms underlying these protective effects of STVNa have not been fully elucidated. The present study further examined the neuroprotective effects of STVNa against permanent cerebral ischemia in mice, including investigating the possible mechanisms of these effects.

Materials and Methods Animals Male C57BL/6 mice (7-8 weeks of age), weighing 2025 g, were purchased from the Animal Research Centre of Guangzhou University of Chinese Medicine (Guangzhou, China). The mice were housed in a temperaturecontrolled environment (25°C ± 2°C), with a 12-hour light/ dark cycle and free access to food and water. All efforts were made to minimize animal suffering and reduce the

number of animals used. The experimental studies were approved by the Institutional Animal Care and Use Committee of Guangdong Pharmaceutical University.

Permanent Middle Cerebral Artery Occlusion The permanent middle cerebral artery occlusion (pMCAO) model was based on the method of Longa et al,23 via the neck arteries, as previously described. Male C57BL/6 mice were anesthetized with 4% isoflurane (Ruiwode, Shenzhen, China). Under an operating microscope, the right common carotid artery (CCA), and external and internal carotid arteries were surgically exposed through a neck incision. A 6-0 silicon-coated nylon filament was introduced into the CCA and advanced into the internal carotid artery until the tip reached the origin of the middle cerebral artery (MCA), which was detected by a mild increase in resistance. Sham-operated mice received the same experimental surgery without a filament being inserted into the MCA. The occlusion was maintained for 24 hours. The neck incision was then closed, and the mice were allowed to recover. Laser Doppler flowmetry (PeriFlux System 5000; Perimed AB, Stockholm, Sweden) was used to measure cerebral blood flow (CBF) both before and after MCA occlusion. A drop in ipsilateral CBF below 30% of the baseline was considered sufficient for the induction of focal cerebral ischemia. Body temperatures were monitored using a rectal thermometer and maintained within normal limits (36.5°C37.5°C) using a heating pad and a heating lamp. Heart rate, arterial oxygen saturation, and breathing rate were measured using a MouseOx Plus device (Starr Life Sciences, Inc., Oakmont, PA, USA). After surgery, mice were allowed free access to food and water.

STVNa Administration STVNa was obtained from the Chemical Development Laboratories of Key Biological Pharmaceutical Company (Dongguan, China). Edaravone was purchased from Simcere Pharmaceutical Co., Ltd. (Nanjing, China). Drugs were administered by intravenous injections immediately following the induction of ischemia via pMCAO. In the dose-response experiment, mice were assigned to 1 of the following 8 groups: sham (n = 8), vehicle (n = 8), STVNa (7.5, 15, 30, 45, and 60 mg/kg, n = 8 per group), and edaravone (3 mg/kg, n = 8). Dose volumes were maintained at approximately .12 mL. A single 30-mg/kg dose of STVNa was used for the histopathology and quantitative polymerase chain reaction (qPCR) experiments. In addition, the STVNa therapeutic window was investigated at a single dose of 30 mg/kg. In the pMCAO experiments, STVNa was administered at 0, 2, 4, 6 or 8 hours after pMCAO (ns = 8); vehicle was administered at the time of pMCAO (n = 8). Mice were randomly assigned to groups prior to pMCAO.

ARTICLE IN PRESS ISOSTEVIOL SODIUM PROTECTS AGAINST PERMANENT CEREBRAL ISCHEMIA INJURY

Neurological Deficits Analysis Several behavioral tests were used to evaluate neurological deficits 1 day after pMCAO. Behavioral tests were conducted by a researcher who was blinded to the experimental design. Each mouse completed a set of tests in order to obtain a modified Neurological Severity Score (mNSS), thus comprehensively evaluating neurological function 24 hours after pMCAO. The mNSS comprised motor, sensory, reflex, and balance tests; details of the points system can be found in previous studies.24-26 mNSS values are on a scale of 0-18 (normal score, 0; maximal deficit score, 18). In the severity scoring of injury, 1 point is assigned for inability to perform the test or for lack of a tested reflex. Scores indicate 3 levels of neurological damage, as follows: mild damage (1-6), moderate damage (7-12), and severe damage (13-18). In order to observe the sensory functions of animals more intuitively and clearly, we used the Bederson test, which assesses motor deficits and circling behavior.27 Motor and behavioral changes were assessed using a 5-point scale as follows: 0 = no observable neurological deficit, 1 = failure to extend left forepaw, 2 = decreased resistance to lateral push toward the paretic site (and forelimb flexion) without circling, 3 = same behavior as grade 2 with the addition of circling, and 4 = loss of spontaneous walking and a depressed level of consciousness.

Evaluation of Cerebral Infarct Volume Mice were sacrificed by intraperitoneal injection with 400 mg/kg of chloral hydrate after evaluating neurological deficits. Brains were removed and cut coronally into 4 consecutive 2-mm thick slices, with the aid of a brain matrix (JieKai Seiko Electronic Co., Ltd., Dongguan, China). We used 2% 2,3,5-triphenyltetrazolium chloride (TTC) staining to determine the success of cerebral infarctions. First, the slices were incubated in TTC (Sigma-Aldrich, Saint Louis, MO) at 37°C for 15 minutes28 and were transferred to 10% neutral buffered formalin. ImageJ software (National Institutes of Health, Bethesda, MD) was used to calculate the infarction area, as previously described.29

Tissue Preparation and Hemoxylin and Eosin Staining The preparation techniques are critical to histological procedures in brain tissue. Brains were dissected for histological analyses (n = 3) 24 hours after pMCAO.30 Brain tissue was immersed in 4% (v/v) paraformaldehyde for 4 hours, washed in .01-M phosphate buffered saline (PBS; pH 7.4), and subsequently transferred to 70% ethanol. Individual brain lobes were placed in processing cassettes, dehydrated using a serial alcohol gradient, and embedded in paraffin wax blocks. Standard paraffin blocks were obtained from the center of the lesion, corresponding to 2 mm anterior and posterior to bregma. A series of 5-µm thick coronal sections were cut using a rotary microtome (Leica RM2255 BLED, Wetzlar,

3

Germany), dewaxed in xylene, rehydrated with decreasing concentrations of ethanol, and washed in PBS. Sections were then stained with hemoxylin and eosin.

Immunohistochemical Assays Surviving neurons and reactive astrocytes in the brain tissue were detected by immunohistochemical staining procedures. After deparaffinization and rehydration, sections were placed in boiled citrate buffer (.01 M, pH 6.0) for 10 minutes at 96°C-98°C to accomplish antigen retrieval. After cooling to room temperature, sections were incubated for 10 minutes in 3% H2O2 (1% in .01 M PBS, v/v) to eliminate endogenous peroxidases, then placed in PBS and blocked with 5% albumin bovine serum (SigmaAldrich, St. Louis, MO) at 37°C for 30 minutes. The primary antibodies were mouse anti-NeuN (1:3000, v/v; Abcam, Cambridge, UK) and mouse anti-glial fibrillary acidic protein (GFAP) (1:5000, v/v; Abcam); sections were incubated at 4°C overnight. The following day, sections were first warmed to room temperature for 30 minutes and then incubated at 37°C for 30 minutes. Sections were then washed in PBS and incubated for 40 minutes at 37°C with secondary antibody (antimouse IgG antibody EnVision+ System-HRP; DAKO, Glostrup, Denmark). After a final wash in PBS, bound antibodies were visualized with 3,3‘diaminobenzidine using a diaminobenzidine-enhanced liquid substrate system (DAKO). All incubations were performed under humidified conditions. Finally, sections were counterstained in hematoxylin. To confirm the specificity of the immunostaining, a negative control test was conducted using Mouse (G3A1) mAb IgG1 Isotype Control (Cell Signaling Technology, Inc., Danvers, MA) in place of the primary antibodies. Neun- or GFAP-positive cells were observed and counted using a fluorescence microscope (Leica DM4000 BLED, Wetzlar, Germany).

Real-Time Polymerase Chain Reaction Total RNA samples were prepared from cerebral cortices isolated from mice using a standard trizol protocol (Generay, Shanghai, China), and quantitatively measured using ultraviolet spectroscopy. Total RNA was amplified by qPCR using a two-step real-time polymerase chain reaction (RT-PCR) kit (Vazyme, NanJing, China) according to the manufacturer’s protocol. Primers for inhibitor of nuclear factor kappa-B kinase-α (IKKα), inhibitor of nuclear factor kappa-B kinase-β (IKK-β), NF-κB, inhibitor of NF-κB-α (IκB-α), tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β), Bcl2-associated X protein (Bax), B-cell CLL/lymphoma 2 (Bcl-2), caspase-3, and glyceraldehyde-3-phosphate dehydrogenase were designed for qPCR by Generay (the oligo sequences are shown in Table 1). We performed qPCR for 40 cycles; each cycle consisted of predenaturation for 30 seconds at 95°C, denaturation for 10 seconds at 95°C, and extension for 30 seconds at 60°C. The results were analyzed with the

ARTICLE IN PRESS H. ZHANG ET AL.

4

Table 1. List of primers used for real-time polymerase chain reaction Primer

Symbol

Inhibitor of nuclear factor kappa-B kinase-α

IKK-α

Inhibitor of nuclear factor kappa-B kinase-β

IKK-β

Nuclear factor kappa-light-chain-enhancer of activated B cells

NF-κB p65

Inhibitor of NF-κB-α

IκB-α

Tumor necrosis factor-α

TNF-α

Interleukin-1 beta

IL-1β

Bcl2-associated X protein

Bax

B-cell CLL/lymphoma 2

Bcl-2

Caspase-3

Caspase-3

Glyceraldehyde-3-phosphate dehydrogenase

GAPDH

2-ΔΔCT method, using glyceraldehyde-3-phosphate dehydrogenase as an internal standard to normalize messenger RNA (mRNA).

Statistical Analyses Measurements are expressed as means ± standard errors of the mean. Data were analyzed using a one-way analysis of variance (ANOVA), with any differences between means assessed by post hoc analyses (Tukey’s multiple comparison test) to evaluate statistical significance. Statistical significance was indicated by P values of <.05.

Results CBF and Physiological Variables Laser Doppler flowmeter data demonstrated that the regional cerebral blood flow (rCBF) of mice in the STVNa

Sequence(5’-3’) Fwd: GTCAGGACCGTGTTCTCAAGG Rev: GCTTCTTTGATGTTACTGAGGGC Fwd: CGTGACGGAGGATGAGAGT Rev: CGTTTGTCTTGCTGTCTGAGA Fwd: ATGGCAGACGATGATCCCTAC Rev: TGTTGACAGTGGTATTTCTGGTG Fwd: GGTGTTTGAATGTATTGCTGG Rev: AGGCTGTTTGGCTGAGGT Fwd: CATGGATCTCAAAGACAACC Rev: GGTATATGGGCTCATACCAG Fwd: CCTGGGCTGTCCTGATGAGAG Rev: TCCACGGGAAAGACACAGGTA Fwd: GCTGATGGCAACTTCAACTG Rev: GATCAGCTCGGGCACTTTAG Fwd: CCAGCGTGTGTGTGCAAGTGTAAAT Rev: ATGTCAATCCGTAGGAATCCCAACC Fwd: AGATACCGGTGGAGGCTGACT Rev: TCTTTCGTGAGCATGGACACA Fwd: CACTCACGGCAAATTCAACGGCA Rev: GACTCCACGACATACTCAGCAC

and vehicle-treated groups was significantly reduced to less than 30% of baseline values; however, this effect did not occur in the sham group in the dose-response experiment (Fig 1). The rCBF in the STVNa-treated and vehicle groups did not significantly differ during surgery (Fig 1). In addition, all mice in this study had similar physiological parameters, including heart rate, breathing rate, temperature, and arterial oxygen saturation (Table 2).

STVNa Reduces Infarct Volume and Improves Neurological Deficits in Permanent Focal Ischemia To investigate the neuroprotective effects of STVNa in mice suffering from permanent cerebral focal ischemia, we calculated infarct volume 24 hours after surgery using TTC staining (Fig 2, A). No infarctions were detected in the sham group. Figure 2, B shows the effects of STVNa treatment

Figure 1. LDF was used for measuring rCBF at 2 time points: before MCAO and after MCAO. Rheograph of rCBF guaranteed that the permanent MCAO model in mice was successful. In this figure, it had 8 groups: sham group, vehicle group, the different treatment dosage groups of STVNa (7.5, 15, 30, 45, 60 mg/kg), the positive control medicine group of edaravone. Data were expressed as means ± SEM (n = 8). Abbreviations: LDF, Laser Doppler flowmeter; MCAO, middle cerebral artery occlusion; rCBF, regional cerebral blood flow; SEM, Standard Error of Mean; STVNa, isosteviol sodium.

ARTICLE IN PRESS 422.9 ± 27.9 104.9 ± 19.2 36.8 ± .3 97.0% ± .9% Abbreviations: BR, breathing rate; HR, heart rate; pMCAO, permanent middle cerebral artery occlusion; SpO2, arterial oxygen saturation; T, temperature.

468.9 ± 29.7 141.4 ± 2.9 36.9 ± .1 97.5% ± .1% 435.4 ± 23.1 96.1 ± 9.9 36.5 ± .1 95.7% ± 1.0% 425.6 ± 24.8 92.3 ± 10.0 36.6 ± .1 96.5% ± 1.2% 443.1 ± 30.2 99.6 ± 14.4 36.5 ± .3 96.2% ± .7%

448.5 ± 34.7 97 ± 18.2 36.5 ± .3 96.0% ± 1.2%

413.0 ± 41.3 111.4 ± 27.6 36.5 ± .3 96.6% ± 1.0%

443.0 ± 31.3 135.6 ± 15.1 37.0 ± .2 97.2% ± .5%

423.9 ± 30.6 102.3 ± 16.2 36.8 ± .2 96.7% ± .8% 480.5 ± 12.5 144.6 ± 6.6 36.9 ± .1 97.5% ± .2% 449.1 ± 31.0 135.9 ± 15.5 36.9 ± .2 97.2% ± .4% 433.0 ± 25.5 99.1 ± 12.3 36.5 ± .1 95.8% ± 1.0% 411.1 ± 43.8 109.4 ± 22.4 36.4 ± .2 96.8% ± .8% 434.3 ± 33.5 97 ± 5.5 36.6 ± .1 96.5% ± 1.0%

Before pMCAO (5 min) HR BR T SpO2 After pMCAO (5 min) HR BR T SpO2

442.4 ± 34.7 96.8 ± 17.3 36.5 ± .2 95.9% ± 1.1%

449.5 ± 38.4 100.8 ± 13.8 36.4 ± .3 96.2% ± 1.1%

30 mg/kg 15 mg/kg 7.5 mg/kg Vehicle Sham

STVNa

Table 2. Physiological variables in the dose–response study

45 mg/kg

60 mg/kg

Edaravone

ISOSTEVIOL SODIUM PROTECTS AGAINST PERMANENT CEREBRAL ISCHEMIA INJURY

5

on infarct size; STVNa doses of 15 mg/kg (45.80% ± 1.30%), 30 mg/kg (34.50% ± 2.50%), 45 mg/kg (39.15% ± 13.56%), and 60 mg/kg (36.55% ± 5.46%), but not 7.5 mg/kg (59.60% ± 2.38%), significantly reduced infarct size compared with the vehicle group (62.37% ± 2.27%). Furthermore, 30-, 45-, or 60-mg/kg doses did not contribute to greater alleviation of the infarct volume compared with the 15mg/kg dose (Fig 2, B). In this study, we used edaravone, a reactive oxygen species (ROS) scavenger, as a positive control for cerebral ischemia treatment. The results demonstrate that 30 mg/kg of STVNa significantly reduced the infarct volume compared with edaravone. Furthermore, 24 hours after treatment, we evaluated functional improvements in STVNa-treated animals, using the mNSS and the Bederson test. Figure 2, C,D shows that mice in the sham group had no neurological deficits, whereas mice in the vehicle group displayed the worst neurological deficits. Treatment doses of 30 mg/kg and 45 mg/kg of STVNa decreased mNSS values compared with the vehicle group (Fig 2, C). Moreover, the reduction in Bederson test scores in STVNa-treated animals demonstrates therapeutic effects of STVNa on sensory function (Fig 2, D). Therefore, 30 mg/kg of STVNa treatment significantly reduced infarct volumes and improved neurological function, and was therefore selected for the subsequent experiment.

Therapeutic Window Study We next aimed to define the time interval after permanent focal ischemia during which STVNa has neuroprotective effects; 30 mg/kg of STVNa or vehicle was administered at 0, 2, 4, 6, or 8 hours after pMCAO. Significant stroke volume reductions were observed when STVNa was administered at 0, 2 (23%-33%), or 4 hours (22%-34%) after pMCAO compared with the vehicle group, but not when administration was delayed to 6 and 8 hours following pMCAO (Fig 3). Consistently, a remarkable improvement in neurological scores was detected in the STVNA-treated group (Fig 3).

Histopathological Analyses To observe cell morphology in the ischemic boundary zone, formalin-fixed, paraffin-embedded tissue sections were subjected to hematoxylin and eosin staining (Fig 4, A,B). In the sham-operated group, the structures of most neurons were clear and showed no morphological abnormalities. Conversely, most neurons in the vehicle group showed shrinkage, nuclear pyknosis, vacuolization, disappearance, and enlarged intercellular spaces. When the mice were treated with STVNa, neurons in the ischemic boundary zone had a less extensive damage (Fig 4, C). Previous evidence has demonstrated neuronal death and overexpression of astrocytes in brain tissue after cerebral ischemia.31,32 We examined the number of neurons and astrocytes in the ischemic boundary zone using anti-NeuN

ARTICLE IN PRESS H. ZHANG ET AL.

6

Figure 2. Results of the dose–response relationship of STVNa were measured 24 hours after pMCAO in mice. (A) Using 2% TTC stained the brain sections to determine the infarct volume (red areas: normal tissue; pale areas: injured tissue). (B) Shows the distribution of percent area of infarct in serial brain sections stained with TTC 24 hours after pMCAO in vehicle-treated and STVNa-treated mice. (C) Neurological scores of mNSS 24 hours after pMCAO. (D) Neurological scores of the Bederson test 24 hours after pMCAO. Data were expressed as the mean ± the SEM (n = 8 per group). *P < .05 and **P < .01 versus the vehicle group; #P < .05 versus the edaravone group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: mNSS, modified Neurological Severity Score; pMCAO, permanent middle cerebral artery occlusion; SEM, Standard Error of Mean; STVNa, isosteviol sodium; TTC, triphenyltetrazolium chloride.

(Abcam) and anti-GFAP (Abcam) immunohistochemistry (Fig 4, C,D); there were large numbers of neurons, but few astrocytes, in the brain tissue of sham animals. In contrast, there was a decrease in neurons and astrocyte overexpression in pMCAO groups. Treatment with 30 mg/ kg of STVNa significantly increased the number of neurons and decreased the number of astrocytes compared with vehicle treatment (Fig 4, E,F). The morphological improvements and treatment effects of STVNa were improved compared with the effects of edaravone.

Intravenous STVNa Treatment Inhibited the Cerebral NF-κB Signaling Pathway To analyze whether STVNa treatment inhibits NF-κB activity, the mRNA expression of NF-κB-related genes

was measured using RT-PCR. The mRNA levels of IKK-α, IKK-β, NF-κB, and IκB-α in the ischemic cortex were markedly increased at 24 hours after pMCAO, and 30 mg/kg of STVNa significantly downregulated the mRNA expression for these genes (Fig 5). These results suggest that the neuroprotective effects of STVNa may be associated with the inhibition of the NF-κB signaling pathway.

STVNa Downregulates pMCAO-Induced Inflammatory Cytokines and Apoptosis Factors To evaluate the effects of STVNa on pMCAO-induced inflammation and apoptosis in the postischemic brain, we used qPCR to determine mRNA expression of inflammatory cytokines and apoptotic factors. The data

ARTICLE IN PRESS ISOSTEVIOL SODIUM PROTECTS AGAINST PERMANENT CEREBRAL ISCHEMIA INJURY

7

Figure 3. Effects of STVNa treatment in pMCAO. (A) The infarct volume of each group 24 hours after pMCAO. The volume was greatly decreased in mice treated with STVNa administered 4 hours after ischemia. (B) Neurological scores after pMCAO in different groups with STVNa administered at 0, 2, 4, 6 and 8 hours after ischemia. The neurological scores were greatly lowered in animals to which STVNa was administered 4 hours after ischemia. The data represent the mean ± SEM (n = 8 per group). *P < .05, **P < .01 versus the vehicle group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: mNSS, modified Neurological Severity Score; pMCAO, permanent middle cerebral artery occlusion; SEM, Standard Error of Mean; STVNa, isosteviol sodium.

demonstrated that mRNA expressions of inflammatory cytokines (TNF-α and IL-1β) and cell apoptosis-related genes (Bax, Bcl-2, and caspase-3) were significantly elevated following cerebral ischemia. STVNa treatment significantly reduced the mRNA expression of TNF-α,

IL-1β, Bax, and caspase-3 (Figs 6 and 7), suggesting that STVNa markedly alleviated inflammatory and apoptotic responses. Furthermore, Bcl-2 is a well-known antiapoptotic factor that binds to Bax.33 Our RT-PCR results demonstrate that 30 mg/kg of STVNa distinctly inhibited the

Figure 4. Effect of STVNa on the histopathology. (A) Brain sections stained by TTC. (B) The method of hematoxylin and eosin staining was used to observe the general form of the cells. We chose the ischemic boundary zone of the brain tissue after 24 hours of cerebral ischemia in the dose–response study groups (n = 3 per group). 30 mg/kg : 30 mg/kg STVNa group. Scale bar = 100 µm. (C) Effects of STVNa on neuronal immunoreactivity in pMCAO mice (n = 3 per group). Scale bar = 50 µm. (D) Effect of STVNa on GFAP immunoreactivity in the mice ischemic brain (n = 3 per group). Scale bar = 50 µm. (E) Number of NeuN-immunopositive cells/mm2 of the brain ischemic boundary zone. Histograms represent the mean ± the SEM. (F) Number of GFAP-immunopositive cells/mm2 of the brain ischemic boundary zone. Histograms represent the mean ± the SEM. *P < .05 versus the vehicle group and #P < .05 versus the edaravone group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: GFAP, glial fibrillary acidic protein; IP, ischemic penumbra; pMCAO, permanent middle cerebral artery occlusion; SEM, Standard Error of Mean; STVNa, isosteviol sodium; TTC, triphenyltetrazolium chloride.

ARTICLE IN PRESS H. ZHANG ET AL.

8

Figure 5. Effects of STVNa on NF-κB pathway activation. The mice were killed after 24 hours. Total mRNA was isolated from the cerebral cortex. The expressions of IKK-α, IKK-β, NF-κB, and IκB were measured by real-time polymerase chain reaction. (A) The expression of IKK-α mRNA in the cerebral cortex. (B) The expression of IKK-β mRNA in the cerebral cortex. (C) The expression of NF-κB mRNA in the cerebral cortex. (D) The expression of IκB mRNA in the cerebral cortex. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. Data represent the mean ± SEM of 3 independent experiments. *P < .05 versus the vehicle group and #P < .05 versus the sham group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: IκB, inhibitor of nuclear factor kappa-B; IKK-α, inhibitor of nuclear factor kappa-B kinase-α; IKK-β, inhibitor of nuclear factor kappa-B kinaseβ; mRNA, messenger RNA; NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells; SEM, Standard Error of Mean; STVNa, isosteviol sodium.

pMCAO-induced increase in Bax and upregulated Bcl-2 mRNA expression (Fig 7, A,B).

Discussion The present study demonstrates that STVNa treatment decreases infarct volume and improves neurological deficits when administered intravenously at 15-, 30-, 45-, or 60-mg/kg doses. These results are consistent with previous research, which demonstrates that STVNa has significant neuroprotective effects during cerebral ischemia in rats.22 In the present study, a moderate dose (30 mg/kg) resulted in optimal neuroprotection against pMCAO injury in the brain. The establishment of a replicable, stable, and reliable animal model of stroke is necessary to better understand the curative effects and underlying mechanisms of neuroprotective drugs in cerebral ischemia. The focal cerebral ischemia model creates similar symptoms to cerebral

infarction in humans. Compared with rats, mice are less expensive and more beneficial, particularly because the mouse is currently the most commonly used gene target animal.32,34 All clinically relevant cerebral ischemia models can be reproduced in mice, which provides a powerful means for investigating the complicated molecular mechanisms of cerebral infarction. Thus, in recent years, the use of the mouse cerebral ischemia model has increased. Moreover, the pMCAO model was selected for the present study because it has the following 4 major advantages compared with the temporary MCAO model: (1) Stroke Therapy Academic Industry Roundtable (STAIR) recommends persistent cerebral ischemia as the primary stroke model35; (2) the embolism line was not withdrawn after operation, thus effectively avoiding blunt injury to vessels and relevant nerves by overtraction; (3) mice undergoing temporary MCAO have a higher risk of subarachnoid or intraventricular hemorrhages following suture removal than animals undergoing pMCAO34; and (4) most patients

ARTICLE IN PRESS ISOSTEVIOL SODIUM PROTECTS AGAINST PERMANENT CEREBRAL ISCHEMIA INJURY

9

Figure 6. Effects of isosteviol sodium on relative mRNA expression of inflammatory cytokines. (A) The expression of TNF-α mRNA in the cerebral cortex. (B) The expression of IL-1β mRNA in the cerebral cortex. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. Data represent the mean ± SEM of 3 independent experiments. *P < .05 versus the vehicle group and #P < .05 versus the sham group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: IL-1β, interleukin-1 beta; mRNA, messenger RNA; SEM, Standard Error of Mean; STVNa, isosteviol sodium; TNF-α, tumor necrosis factor-α.

with stroke develop permanent cerebral infarction due to a lack of timely thrombolytic therapy. The pMCAO model is more similar to permanent human stroke; therefore, it is useful for observing the curative effects of drugs used for therapy and understanding the underlying mechanisms of focal cerebral ischemia. Astrocytes are responsible for the removal of excitotoxic neurotransmitters and biochemical material including glutamate, lactate, hydrogen, and potassium ions, which increase following ischemia and are associated with neuronal death.36,37 The present study confirms the relationship between astrocytes and neuronal death. Astrocyte activation induces neuronal death in the well-characterized pMCAO model of focal ischemia in the spontaneous hypertensive rat.38 Reactive astrocytes also induce an immune response during the delayed phase of I/R injury, which can result in further neuronal damage around the site of injury.39 In addition, numerous studies have verified that astrocytes are activated by hypertrophy and isch-

emia, which leads to the formation of glial scars and results in further damage.40 Furthermore, astrocytes, the most abundant glial cell population in the central nervous system, have an important role in the pathogenesis of cerebral ischemia and are activated by cerebral I/R. Reactive astrocytes begin to proliferate 1-2 days after I/R.41 These reactive astrocytes become hypertrophic and form a “glial scar” in the border zone of the injured tissue approximately 7-10 days after I/R.42 Excessive astrogliosis can produce neuronal damage through several biological processes, including producing potentially cytotoxic levels of molecules and forming a “glial scar.”43 Following activation, astrocytes express a cascade of secondary signals, which have an impact on both innate and adaptive immune responses.44 As reviewed in detail elsewhere, these reactive astrocytes can inhibit axonal regeneration and the secretion of extracellular matrix molecules, thereby preventing axonal regrowth.45 Suppression of astrocyte proliferation after I/R

Figure 7. Effects of isosteviol sodium on relative mRNA expression of cell apoptosis. (A) The expression of Bax mRNA in the cerebral cortex. (B) The expression of Bcl-2 mRNA in the cerebral cortex. (C) The expression of caspase-3 mRNA in the cerebral cortex. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. Data represent the mean ± SEM of 3 independent experiments. *P < .05 versus the vehicle group and #P < .05 versus the sham group by 1-way analysis of variance with Tukey’s multiple comparison test. Abbreviations: mRNA, messenger RNA; SEM, Standard Error of Mean.

ARTICLE IN PRESS 10

injury is associated with reduced neuronal death and enhanced neuronal survival in the penumbra in a rat model of stroke.42 In the present study, we found that the infarct volume was significantly reduced by treatment with STVNa. Therefore, we propose that the STVNa-induced reduction of infarct volume is mediated by the inhibition of astrogliosis. Reactive astrocytes are well-established as the major inhibitor of axonal regeneration after brain injury.46 It is possible that STVNa creates a specific environment that is suitable for neuronal repair via modulating astrogliosis at the site of the pMCAO injury. Our results also confirm that the inhibition of astrocyte proliferation can increase the survival rate of neurons; therefore, STVNa may have inhibited astrogliosis and promoted neuronal repair to achieve neuroprotection. In our study, 30 mg/kg of STVNa significantly reduced infarct volume, possibly protecting brain tissue by preventing the formation of glial scars. We also examined the relationship between neuronal death and astrocytic responses, finding that STVNa increased the number of restored neurons and decreased astrocyte overexpression, which is consistent with previous research. The results suggest that STVNa may be neuroprotective via the inhibition of the astrocyte activation associated with accelerated neuronal death. Previous studies have demonstrated that the NF-κB signaling pathway is crucial to cerebral ischemia. Many NFκB inhibitors are currently being developed as cancer treatments, and these same drugs are beginning to be tested for efficacy in animal models of neurodegenerative conditions, especially stroke.47 Isosteviol interferes with the NFκB pathway in lipopolysaccharide-stimulated RAW 264.7 macrophages to enable cellular immunity. In addition, stevioside significantly reduces the NF-κB/inhibitor of nuclear factor kappa-B,alpha ratio in the aortic arch of DKO mice and simultaneously decreases inflammatory responses.48-50 In the present study, we found that 30 mg/kg of STVNa significantly downregulated the mRNA expression of IKKa, IKK-β, NF-κB, and IκB-a. These results support that STVNa inhibits NF-κB activation via interference with these signaling pathway-related genes, thus attenuating the pMCAOinduced activation of NF-κB. Furthermore, inflammation and apoptosis have been increasingly recognized as crucial contributors to the pathophysiology of stroke.51,52 Inflammation is a continuous cell activity, with constant infiltration of circulating immune cells and activation of brainresident immune-responsive cells.53 Following cerebral ischemia, cells begin to initiate an inflammatory reaction by releasing cytotoxic factors and activating the NF-κB signaling pathway, which is a crucial mediator of inflammatory processes. Several proinflammatory NF-κB target genes, including TNF-α, interleukin-1, and interleukin-6, and inducible nitric oxide synthase mediate the deleterious effects on neurons under ischemic conditions.52 In the present study, STVNa treatment significantly inhibited the mRNA expression of TNF-α and IL-1β, which

H. ZHANG ET AL.

is consistent with previous reports. Furthermore, there is strong evidence that apoptosis is crucial to the pathophysiological effects of cerebral ischemia.54 Apoptosis factors, including Bax, caspase-3, and caspase-9, are induced by stroke. Unlike genes that promote cell apoptosis, Bcl2, an antiapoptosis factor, enhances the survival of ischemic neurons after cerebral ischemic injury. The antiapoptotic properties of Bcl-2 are associated with the suppressed accumulation of ROS, and a role of Bcl-2 has been suggested in lipid peroxidation inhibition in membranes.55 Moreover, Bcl-2 may interfere with the nuclear migration of NF-κB.56 In addition, the NF-κB signaling pathway may be regulated by different factors or stimulus signaling, such as TNF-α, caspase-3, ROS, and extracellular signalregulated kinases.57 Upon activation, NF-κB may induce the expression of several proinflammatory genes, including IL-1β, TNF-α, and proapoptosis genes such as caspase-3 and Bax.58 Previous studies have demonstrated that isosteviol specifically inhibits NF-κB activation,19 thereby reducing inflammatory responses and cell death. The present study demonstrates that STVNa treatment similarly inhibits NF-κB–related mRNA expression, suggesting that the activation of NF-κB promotes inflammation and apoptosis; therefore, inhibiting NF-κB activation is predicted to reduce inflammation and apoptosis. In addition, previous studies have demonstrated that IKK activity increases as soon as 30 minutes after the onset of ischemia in a mouse model of permanent cerebral ischemia, using a kinase pull-down assay.59 Furthermore, IKK is activated by hypoxia, which mediates NF-κB activation. Consistent with previous research, our results demonstrate that the mRNA expression of IKK-α and that of IKK-β are significantly upregulated following pMCAO, and that STVNa treatment downregulates the expression of these genes. Therefore, we propose that STVNa inhibits NF-κB activation probably by downregulating IKK. The present study also demonstrated that STVNa treatment inhibits the mRNA expression of Bax and caspase3, and increases Bcl-2 mRNA expression. Therefore, the evidence supports that STVNa attenuates ischemiainduced inflammatory and apoptotic responses through NF-κB signaling pathway inhibition. Hyperglycemia and hypertension are associated with exacerbating ischemic brain injury after acute stroke.60 Hyperglycemia and hypertension at admission are independent predictors of intracerebral hemorrhage and mortality after acute stroke.61,62 Furthermore, the persistence of these conditions during the first 48 hours after admission increases the risk of mortality. Strict glycemic controls decrease the incidence of bacteremia, polyneuropathy, and critical illness in patients with stroke who are treated in a surgical intensive care unit. STVNa treatment reduces blood sugar and blood pressure.17 Therefore, the neuroprotective effects of STVNa may occur via the reduction of blood sugar and blood pressure, in addition to NF-κB inhibition.

ARTICLE IN PRESS ISOSTEVIOL SODIUM PROTECTS AGAINST PERMANENT CEREBRAL ISCHEMIA INJURY

Conclusions In conclusion, the present study demonstrates the neuroprotective effects of STVNa against permanent cerebral ischemia in mice. In addition to an increase in neuronal survival rates, STVNa inhibits astrocyte activation, possibly through interference with the NF-κB signaling pathway, leading to a reduction in inflammatory and apoptotic responses. Therefore, STVNa has potential as a treatment for acute ischemic stroke; clinical development as a potential therapeutic agent to reduce ischemia-induced brain injury is therefore supported. Although additional studies are necessary to fully elucidate the neuroprotective mechanisms of STVNa, the present results are a foundation for further studies to explore the potential neuroprotective effects of STVNa in neurological diseases.

11.

12.

13.

14.

15.

16. Acknowledgments: We thank Dr. Hui Hu for his technical assistance with the pMCAO model experiments. This work was funded in part by the Science and Technology Planning Project of Guangdong Province (No. 2015B010109004), the National Natural Science Foundation of China (No. 31601089), the Fundamental Research Funds for the Central Universities (No. 2015ZM177), and the Open Project Program of Guangdong Key Laboratory of Fermentation and Enzyme Engineering, SCUT (No. FJ2015009).

17.

18.

19.

20.

References 1. Silvestrelli G, Corea F, Paciaroni M, et al. The Perugia hospital-based stroke registry: report of the 2nd year. Clin Exp Hypertens 2002;24:485-491. 2. Sacco RL, Ji YC, Prabhakaran S, et al. Experimental treatments for acute ischaemic stroke. Lancet 2007;369:331. 3. Gropen TI, Gagliano PJ, Blake CA, et al. Quality improvement in acute stroke: the New York State Stroke Center Designation Project. Neurology 2006;67:88-93. 4. Ginsberg MD. Neuroprotection for ischemic stroke: past, present and future. Neuropharmacology 2008;55:363-389. 5. Berti R, Williams AJ, Moffett JR, et al. Quantitative real-time RT-PCR analysis of inflammatory gene expression associated with ischemia-reperfusion brain injury. J Cereb Blood Flow Metab 2002;22:1068. 6. Dirnagl U, Iadecola C, Moskowitz MA. Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci 1999;22:391. 7. Gu JH, Ge JB, Li M, et al. Inhibition of NF-κB activation is associated with anti-inflammatory and anti-apoptotic effects of Ginkgolide B in a mouse model of cerebral ischemia/reperfusion injury. Eur J Pharm Sci 2012;47:652660. 8. Hüttemann M, Helling S, Sanderson TH, et al. Regulation of mitochondrial respiration and apoptosis through cell signaling: cytochrome c oxidase and cytochrome c in ischemia/reperfusion injury and inflammation. Biochim Biophys Acta 2012;1817:598-609. 9. Chou WH, Choi DS, Zhang H, et al. Neutrophil protein kinase Cδ as a mediator of stroke-reperfusion injury. J Clin Invest 2004;114:49-56. 10. Li Y, Chopp M, Jiang N, et al. Temporal profile of in situ DNA fragmentation after transient middle cerebral

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

11

artery occlusion in the rat. J Cereb Blood Flow Metab 1995;15:389-397. Han Z, Boyle DL, Manning AM, et al. AP-1 and NF-κB regulation in rheumatoid arthritis and murine collageninduced arthritis. Autoimmunity 1998;28:197-208. Hart LA, Krishnan VL, Adcock IM, et al. Activation and localization of transcription factor, nuclear factorkappa B, in asthma. Am J Respir Crit Care Med 1998;158: 1585. Pye J, Ardeshirpour F, McCain A, et al. Proteasome inhibition ablates activation of NF-κB in myocardial reperfusion and reduces reperfusion injury. Am J Physiol Heart Circ Physiol 2003;284:H919. Cui DR, Wang L, Jiang W, et al. Propofol prevents cerebral ischemia-triggered autophagy activation and cell death in the rat hippocampus through the NF-魏B/p53 signaling pathway. Neuroscience 2013;246:117-132. Li WL, Yu SP, Chen D, et al. The regulatory role of NF-κB in autophagy-like cell death after focal cerebral ischemia in mice. Neuroscience 2013;244:16. Ridder DA, Schwaninger M. NF-κB signaling in cerebral ischemia. Neuroscience 2009;158:995. Chan P, Xu DY, Liu JC, et al. The effect of stevioside on blood pressure and plasma catecholamines in spontaneously hypertensive rats. Life Sci 1998;63:1679-1684. Gregersen S, Jeppesen PB, Holst JJ, et al. Antihyperglycemic effects of stevioside in type 2 diabetic subjects. Metabolism 2004;53:73. Xu D, Du W, Zhao L, et al. The neuroprotective effects of isosteviol against focal cerebral ischemia injury induced by middle cerebral artery occlusion in rats. Planta Med 2008;74:816-821. Upreti M, Prakash I, Chen YL. Solubility enhanced terpene glycoside(S). EP, 2012. Lai W, Kang Q, Zou C, et al. Development of a liquid formulation of poorly water-soluble isosteviol sodium using the co-solvent technology. Pharm Dev Technol 2016;1. Hu H, Sun XO, Tian F, et al. Neuroprotective effects of isosteviol sodium injection on acute focal cerebral ischemia in rats. Oxid Med Cell Longev 2016;2016:1-10. Longa EZ, Weinstein PR, Carlson S, et al. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 1989;20:84. Chen J, Li Y, Wang L, et al. Therapeutic benefit of intravenous administration of bone marrow stromal cells after cerebral ischemia in rats. Stroke 2001;32:1005-1011. Chen Y, Constantini S, Trembovler V, et al. An experimental model of closed head injury in mice: pathophysiology, histopathology, and cognitive deficits. J Neurotrauma 1996;13:557-568. Schallert T, Kozlowski DA, Humm JL, et al. Usedependent structural events in recovery of function. Adv Neurol 1997;73:229. Bederson JB, Pitts LH, Tsuji M, et al. Rat middle cerebral artery occlusion: evaluation of the model and development of a neurologic examination. Stroke 1986;17:472. Isayama K, Pitts LH, Nishimura MC. Evaluation of 2,3,5-triphenyltetrazolium chloride staining to delineate rat brain infarcts. Stroke 1991;22:1394-1398. Swanson RA, Morton MT, Tsao-Wu G, et al. A semiautomated method for measuring brain infarct volume. J Cereb Blood Flow Metab 1990;10:290. Zhan X, Ander BP, Liao IH, et al. Recombinant Fv-Hsp70 protein mediates neuroprotection after focal cerebral ischemia in rats. Stroke 2010;41:538.

ARTICLE IN PRESS 12 31. Chen Y, Swanson RA. Astrocytes and brain injury. J Cereb Blood Flow Metab 2003;23:137-149. 32. Yang G, Chan PH, Chen J, et al. Human copper-zinc superoxide dismutase transgenic mice are highly resistant to reperfusion injury after focal cerebral ischemia. Stroke 1994;25:165. 33. Mahajan NP, Linder K, Berry G, et al. Bcl-2 and Bax interactions in mitochondria probed with green fluorescent protein and fluorescence resonance energy transfer. Nat Biotechnol 1998;16:547. 34. Mao Y, Yang GY, Zhou LF, et al. Focal cerebral ischemia in the mouse: description of a model and effects of permanent and temporary occlusion. Brain Res Mol Brain Res 1999;63:366. 35. Fisher M. New approaches to neuroprotective drug development. Stroke 2011;42:24-27. 36. Amédée T, Robert A, Coles JA. Potassium homeostasis and glial energy metabolism. Glia 1997;21:46. 37. Swanson RA, Ying W, Kauppinen TM. Astrocyte influences on ischemic neuronal death. Curr Mol Med 2004;4:193-205. 38. Clark RK, Lee EV, Fish CJ, et al. Development of tissue damage, inflammation and resolution following stroke: an immunohistochemical and quantitative planimetric study. Brain Res Bull 1993;31:565. 39. Dong Y, Benveniste EN. Immune function of astrocytes. Glia 2001;36:180-190. 40. Liu D, Smith CL, Barone FC, et al. Astrocytic demise precedes delayed neuronal death in focal ischemic rat brain. Brain Res Mol Brain Res 1999;68:29-41. 41. Petito CK, Morgello S, Felix JC, et al. The two patterns of reactive astrocytosis in postischemic rat brain. J Cereb Blood Flow Metab 1990;10:850-859. 42. Wang W, Redecker C, Yu ZY, et al. Rat focal cerebral ischemia induced astrocyte proliferation and delayed neuronal death are attenuated by cyclin-dependent kinase inhibition. J Clin Neurosci 2008;15:278. 43. Anderson MF, Blomstrand F, Blomstrand C, et al. Astrocytes and stroke: networking for survival? Neurochem Res 2003;28:293-305. 44. Jensen CJ, Massie A, Keyser JD. Immune players in the CNS: the astrocyte. J Neuroimmune Pharmacol 2013;8:824-839. 45. McGraw J, Hiebert G, Steeves JD. Modulating astrogliosis after neurotrauma. J Neurosci Res 2001;63:109-115. 46. Sofroniew MV. Reactive astrocytes in neural repair and protection. Neuroscientist 2005;11:400. 47. Mattson MP, Camandola S. NF-kappaB in neuronal plasticity and neurodegenerative disorders. J Clin Invest 2001;107:3.

H. ZHANG ET AL. 48. Chang SF, Chou BH, Yang LM, et al. Microbial transformation of isosteviol oxime and the inhibitory effects on NF-kappaB and AP-1 activation in LPSstimulated macrophages. Bioorg Med Chem 2009;17:63486353. 49. Geeraert B, Crombé F, Hulsmans M, et al. Stevioside inhibits atherosclerosis by improving insulin signaling and antioxidant defense in obese insulin-resistant mice. Int J Obes 2009;34:569. 50. Wang X, Qin ZH, Shi H, et al. Protective effect of Ginkgolids (A+B) is associated with inhibition of NIK/IKK/IκB/NF-κB signaling pathway in a rat model of permanent focal cerebral ischemia. Brain Res 2008;1234:8. 51. Broughton BR, Reutens DC, Sobey CG. Apoptotic mechanisms after cerebral ischemia. Stroke 2009;40:e331. 52. Iadecola C, Anrather J. The immunology of stroke: from mechanisms to translation. Nat Med 2011;17:796. 53. Muir KW, Tyrrell P, Sattar N, et al. Inflammation and ischaemic stroke. Curr Opin Neurol 2007;20:334-342. 54. Niizuma K, Yoshioka H, Chen H, et al. Mitochondrial and apoptotic neuronal death signaling pathways in cerebral ischemia. Biochim Biophys Acta 2010;1802:92-99. 55. Bruce-Keller AJ, Geddes JW, Knapp PE, et al. Anti-death properties of TNF against metabolic poisoning: mitochondrial stabilization by MnSOD. J Neuroimmunol 1999;93:53-71. 56. Albrecht H, Tschopp J, Jongeneel CV. Bcl-2 protects from oxidative damage and apoptotic cell death without interfering with activation of NF-κB by TNF. FEBS Lett 1994;351:45-48. 57. Hoesel B, Schmid JA. The complexity of NF-κB signaling in inflammation and cancer. Mol Cancer 2013;12:86. 58. Sun BZ, Chen L, Wu Q, et al. Suppression of inflammatory response by flurbiprofen following focal cerebral ischemia involves the NF-κB signaling pathway. Int J Clin Exp Med 2014;7:3087. 59. Herrmann O, Baumann B, De LR, et al. IKK mediates ischemia-induced neuronal death. Nat Med 2005;11:1322. 60. Wang JL, Liu H. Effect of admission hyperglycemia on hemorrhagic infarction in acute ischemic stroke. Med J West China 2010;22:1810-1812. 61. Bruno A, Biller J Jr, Adams HP, et al. Acute blood glucose level and outcome from ischemic stroke. Trial of ORG 10172 in Acute Stroke Treatment (TOAST) investigators. Neurology 1999;52:280. 62. Cucchiara B, Levine TSR, Demchuk AM, et al. Risk score to predict intracranial hemorrhage after recombinant tissue plasminogen activator for acute ischemic stroke. J Stroke Cerebrovasc Dis 2008;17:331.