Itaconic acid derivatives and diketopiperazine from the marine-derived fungus Aspergillus aculeatus CRI322-03

Phytochemistry 72 (2011) 816–820

Contents lists available at ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Itaconic acid derivatives and diketopiperazine from the marine-derived fungus Aspergillus aculeatus CRI322-03 Bassey S. Antia a,b, Thammarat Aree c, Chairut Kasettrathat a, Suthep Wiyakrutta d, Okon D. Ekpa b, Udofot J. Ekpe b, Chulabhorn Mahidol a,e,f, Somsak Ruchirawat a,e,f, Prasat Kittakoop a,e,⇑ a

Chulabhorn Research Institute, Vibhavadi-Rangsit Road, Bangkok 10210, Thailand Department of Pure and Applied Chemistry, University of Calabar, Calabar, Nigeria Department of Chemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand d Department of Microbiology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand e Chulabhorn Graduate Institute and the Center for Environmental Health, Toxicology and Management of Chemicals (ETM), Chemical Biology Program, Vibhavadi-Rangsit Road, Bangkok 10210, Thailand f Chulabhorn Research Centre, Institute of Molecular Biosciences, Mahidol University, Bangkok, Thailand b c

a r t i c l e

i n f o

Article history: Received 16 July 2010 Received in revised form 27 December 2010 Accepted 14 February 2011 Available online 10 March 2011

a b s t r a c t Three metabolites, pre-aurantiamine (1), ()-9-hydroxyhexylitaconic acid (4) and ()-9-hydroxyhexylitaconic acid-4-methyl ester (5), together with two known compounds, paraherquamide E (6) and secalonic acid D (7), were isolated from the marine-derived fungus, Aspergillus aculeatus. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Aspergillus aculeatus Marine-derived fungi Diketopiperazine Itaconic acid derivatives

1. Introduction Marine-derived fungi are rich sources of bioactive compounds (Parvatkar et al., 2009; Prachyawarakorn et al., 2008; Trisuwan et al., 2008, 2009). Our continuing search for bioactive compounds from marine-derived fungi isolated from Thai marine invertebrates has led to the discovery of many bioactive compounds (Ingavat et al., 2009; Kasettrathat et al., 2008; Prachyawarakorn et al., 2008). In our experience, these fungi could grow rapidly in salt containing media (seawater), but most of them hardly grow in media without salt supplements, and sometimes, those that do grow in non-saline media change their morphology when cultured under such conditions. We define these fungi as ‘‘marine-derived fungi’’ rather than marine fungi which obligately require seawater for their growth. Recently, we reported a new tyrosine-derived aglucosidase inhibitor, aspergillusol A, obtained on a gram scale from the marine-derived fungus Aspergillus aculeatus CRI323-04 (Ingavat et al., 2009). Interestingly, we found that another strain of A. aculeatus, designated as CRI322-03, produced different classes of secondary metabolites. Fungal strain CRI322-03 was isolated ⇑ Corresponding author at: Chulabhorn Research Institute, Vibhavadi-Rangsit Road, Bangkok 10210, Thailand. Tel.: +66 86 9755777; fax: +66 2 5740622x1513. E-mail address: [email protected] (P. Kittakoop). 0031-9422/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.phytochem.2011.02.013

from a marine sponge, Stylissa flabelliformis, while the strain CRI323-04 was isolated from a different sponge (Xestospongia testudinaria). Herein, we report isolation of three new compounds; pre-aurantiamine (1), ()-9-hydroxyhexylitaconic acid (4), and ()-9-hydroxyhexylitaconic acid-4-methyl ester (5), as well as two known metabolites, paraherquamide E (6) (Liesch and Wichmann, 1990) and secalonic acid D (7) (Andersen et al., 1977) (Fig. 1), from A. aculeatus CRI322-03.

2. Results and discussion 2.1. Structural determination Separation of a crude broth extract of the marine-derived fungus, A. aculeatus CRI322-03, by Sephadex LH-20 and silica gel chromatographic techniques yielded pre-aurantiamine (1), ()-9hydroxyhexylitaconic acid (4), and ()-9-hydroxyhexylitaconic acid-4-methyl ester (5). Similar separation of the corresponding mycelial extract provided pre-aurantiamine (1), paraherquamide E (6), and secalonic acid D (7). Identification of known fungal metabolites 6 and 7 was achieved by analysis of spectroscopic data, as well as by data comparison with those reported in the literature (Andersen et al., 1977; Liesch and Wichmann, 1990). The structure

817

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820 14 13 15

O

O 9

8

NH

10

HN 12

3

7

O

N 6

1, R = H 2, R = CH3

2

NR

4 5

1

OR3 NH

HN

N NH

10

9

O

5

1 2

6 11

O 3, Aurantiamine

8

7

3

4

OR1 OR2

O 4, R1 = H, R2 = H, R3 = H 4a, R1 = CH3, R2 = CH3, R3 = H 4b, R1 = CH3, R2 = CH3, R3 = (S)-MTPA 4c, R1 = CH3, R2 = CH3, R3 = (R)-MTPA 5, R1 = H, R2 = CH3, R3 = H

Fig. 1. Structure of compounds 1–5.

of paraherquamide E (6) was also confirmed by a single X-ray crystallographic analysis (Aree et al., 2010). Pre-aurantiamine (1) exhibited a molecular formula C11H14N4O2, as indicated by APCI-TOF MS data. Its IR spectrum exhibited characteristic stretching frequencies of an amide NH (3193 cm1) and amide carbonyls (1660 and 1634 cm1). The presence of amide carbonyls in 1 was further supported by the 13C NMR spectroscopic resonances at dC 160.3 and 165.3. The 1H NMR spectrum (acetone-d6) of pre-aurantiamine (1) showed signals for three exchangeable NH protons, three sp2 methines, two sp3 methines, and two methyl groups. The 13C NMR and DEPT data for 1 indicated the presence of two methyl, five methine, and four non-protonated carbons in 1. The 1H–1H COSY spectrum of pre-aurantiamine (1) displayed correlations between H-10 and H-13; H-13 and H3-14; and H-13 and H3-15, which established a possible valine unit in 1. The 1H–1H COSY spectrum of 1 also demonstrated allylic coupling between H-5 and H-6. The HMBC spectrum exhibited correlations from H-2 to C-4 and C-5; H-5 to C-2, C-4, and C-6; H-6 to C-4, C-5, and C-12; H-10 to C-9, C-12, C-14, and C-15; H-13 to C-9, and both H3-14 and H315 to C-10. Interestingly, the HMBC spectrum of 1 also showed a four-bond correlation (4JCH coupling) from H-5 to C-7, and from H6 to C-9. The HMBC correlations from 1-NH to C-2 and C-5, and from 8-NH to C-7 and C-9 established the positions of 1-NH and 8-NH, respectively. Based upon these spectroscopic data, the structure of pre-aurantiamine (1) was established. Assignments of proton and carbon signals for pre-aurantiamine (1) are shown in Table 1. The NOESY spectrum of pre-aurantiamine (1) showed a correlation between H-5 and H-6, indicating that these olefinic protons are in close proximity, and thus establishing the Z geometry of the 6,7-double bond in 1. Additionally, crystals of pre-aurantiamine (1) were obtained and subsequently subjected to a single X-ray crystallographic analysis (ORTEP plot in Fig. 2). The structure of pre-aurantiamine (1) was therefore conclusively confirmed, and indeed, the 6,7-double bond in 1 has the Z-configuration. In the solid state of 1, a hydrogen bond between the 8-NH proton and the N-3 was observed (Fig. 2). Methylation of pre-aurantiamine (1) with MeI/K2CO3 in DMF afforded a monomethylated product 2. Pre-aurantiamine (1) is structurally related to ()-aurantiamine (3) (Larsen et al., 1992), which is an isomeric derivative of viridamine (Holzapfel and Marsh, 1977). Preaurantiamine (1) exhibited a negative specific rotation (160) similar to those of aurantiamine (3) (116) (Larsen et al., 1992) and viridamine (95) (Holzapfel and Marsh, 1977; Larsen et al., 1992), suggesting that these diketopiperazines likely share the same absolute configuration at C-10. A total synthesis of aurantiamine established that valine in ()-aurantiamine (3) was L-amino acid (Hayashi et al., 2000), therefore, pre-aurantiamine (1) should also have L-valine in its molecule. A cyclodipeptide synthase and prenyltransferase are possibly involved in the biosynthesis of ()-aurantiamine (3). Cyclodipeptide synthase catalyzes the formation of a

diketopiperazine unit (e.g. 1), and a prenyltransferase can transfer an isoprene unit to furnish 3. Both enzymes are known in the biosynthesis of several natural products (Gondry et al., 2009; Li, 2009; Saleh et al., 2009). The APCI-TOF MS data established the molecular formula C11H18O5 for compound 4. The IR absorption bands at 1702 and 1628 cm1 suggested the presence of carbonyl groups, and the 13 C NMR spectrum showed resonances at dC 174.1 and 167.3, further supporting the presence of carbonyl carbons in 4. The 1H NMR spectrum of compound 4 exhibited signals for exo-methylene protons at dH 5.79 and 6.32, two sp3 methines at dH 3.49 and 3.70, four methylenes at dH 1.33–1.91, and a methyl group at dH 1.09. Analysis of 13C NMR and HMQC spectra of 4 established that the methine at dH 3.70 (dC 67.0) corresponded to an oxygen-bonded sp3 methine, while the signal at dH 3.49 (dC 46.7) did not. The DEPT spectrum of 4 demonstrated the presence of one methyl, five methylene, two methine, and three non-protonated carbons. According to the molecular formula, together with the data described above, compound 4 has one hydroxyl group and two carboxylic acid units. The 1H–1H COSY spectrum of 4 showed coupling between H-2 and H2-5, and also established a partial structure from H2-5 along the chain through H3-10 of a hydroxyhexyl moiety in 4. The HMBC spectrum exhibited correlations from H-2 to C-1, C-3, C-4, C-5, C-6, and C-11, from H2-5 to C-1, C-2, and C-3, and from H2-11 to C-2, C-3, and C-4. On the basis of these data, compound 4 was identified as 9-hydroxyhexylitaconic acid. The 1H and 13C NMR resonances for 4 are assigned as shown in Table 1. Compound 4 exhibited a negative rotation, therefore, it likely has the same configuration as that of its derivative, ()-9-hydroxyhexylitaconic acid-1-methyl ester (Klemke et al., 2004). However, based upon available spectroscopic data, the configuration at C-2 in 4 could not be defined. Attempts to clarify the configuration of the C-9 hydroxyl group in 4 were carried out using Mosher’s method (Dale and Mosher, 1973). First, both carboxylic acid groups in 4 were protected by methylation to yield the dimethylated 4a, which was esterified with Mosher’s acid to give (S)- and (R)-MTPA esters (4b and 4c). Unfortunately, this method could not establish the C-9 configuration in 4 due to identical chemical shift differences at H3-10 and H2-8 for the S- and R-Mosher ester derivatives. Similarly, the Mosher’s method previously failed to clarify the C-9 configuration in ()-9-hydroxyhexylitaconic acid-1-methyl ester (Klemke et al., 2004), which is a closely related derivative of 4. Compound 5 had a molecular formula C12H20O5, deduced from APCI-TOF MS data. In general, the 1H and 13C NMR spectra of compound 5 shared a great deal of similarity to those of ()-9hydroxyhexylitaconic acid (4). One additional signal for a methoxy group (dH 3.71 and dC 52.0) was observed in the 1H and 13C NMR spectra of 5. Analysis of the 1H and 13C NMR spectra of compound

818

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820

Table 1 1 H and 13C NMR spectroscopic data for compounds 1, 4 and 5. Position

1 (Acetone-d6)

4 (Acetone-d6)

dH (J in Hz)

dC

dH (J in Hz)

dC

dH (J in Hz)

dC

1 2 3 4 5 6 7 8 9 10 11 OMe 12 13 14 15 1-NH 8-NH 11-NH

– 7.88 (s) – – 7.44 (s) 6.60 (s) – – – 4.04 (d, 3.0) – – – 2.31 (m) 1.05 (d, 7.1) 0.93 (d, 6.8) 11.75 (br s) 11.65 (br s) 7.41 (br s)

– 136.6 – 138.0 118.4 103.9 125.8 – 165.3 61.4 – – 160.3 34.2 18.3 16.5 – – –

– 3.49 – – 1.68 1.33 1.40 1.40 3.70 1.09 5.79 – – – – – – – –

174.1 46.7 139.9 167.3 31.5 27.9 25.7 39.4 67.0 23.3 126.0 – – – – – – – –

– 3.48 – – 1.65 1.33 1.40 1.37 3.67 1.09 5.80 3.71 – – – – – – –

175.0 47.5 140.2 167.2 31.9 28.2 26.2 39.8 67.2 23.8 126.2 52.0 – – – – – – –

(t, 7.3)

(m); 1.87 (m) (m) (m) (m) (m) (d, 6.2) (s); 6.32 (s)

5 (CDCl3)

(t, 7.2)

(m); 1.87 (m) (m) (m) (m) (m) (d, 6.2) (s); 6.27 (s) (s)

3. Experimental 3.1. General experimental procedures

Fig. 2. ORTEP plot of pre-aurantiamine (1).

5, together with the molecular formula, indicated that compound 5 was an O-methyl derivative of ()-9-hydroxyhexylitaconic acid (4). The HMBC spectrum of 5 indicated that the methoxy group was attached to the C-4 carbonyl by the following correlations: from OMe protons to C-4, and from H2-11 to C-2, C-3, and C-4. The HMBC correlations from H2-5 to C-1, C-2, and C-3 unambiguously assigned the position of C-1 carbonyl in 5. Compound 5 showed a negative rotation as did 4; therefore, it was identified as ()-9-hydroxyhexylitaconic acid-4-methyl ester. Again, Mosher’s method failed to clarify the C-9 configuration in 5, because there were no differences in chemical shifts at H3-10 and H2-8 of the S- and R-Mosher esters. Assignments of 1H and 13C NMR resonances for 5 are in Table 1.

2.2. Concluding remarks A new diketopiperazine, pre-aurantiamine (1), and two new itaconic acid derivatives, ()-9-hydroxyhexylitaconic acid (4) and ()-9-hydroxyhexylitaconic acid-4-methyl ester (5), together with two known compounds, paraherquamide E (6) and secalonic acid D (7), were isolated from the marine-derived fungus, A. aculeatus CRI322-03. While another marine-derived isolate of A. aculeatus (CRI323-04) produced a tyrosine-derived metabolite, aspergillusol A (Ingavat et al., 2009), A. aculeatus CRI322-03 produced different classes of secondary metabolites (1 and 4–7).

Melting points were measured on a digital Electrothermal 9100 Melting Point Apparatus and reported without correction. Optical rotations were measured using the sodium D line (590 nm) on a JASCO DIP-370 digital polarimeter. UV–Vis spectra were obtained using a Shimadzu UV-1700 PharmaSpec Spectrophotometer. FT-IR data were obtained using a universal attenuated total reflectance (UATR) attachment on a Perkin-Elmer Spectrum One spectrometer. 1 H and 13C NMR spectra were recorded on a Bruker AM 400 NMR instrument (operating at 400 MHz for 1H and 100 MHz for 13C) and a Bruker AVANCE 600 NMR spectrometer (operating at 600 MHz for 1H and 150 MHz for 13C). APCI-TOF MS were determined using a Bruker MicroTOFLC spectrometer. 3.2. Fungal material and identification A. aculeatus CRI322-03 was isolated from a marine sponge, S. flabelliformis (specimen No. CRI322), which was collected in November 2006, by SCUBA diving at 35–40 feet, from Ton Sai Bay, Phi Phi Islands, Krabi province, Thailand. The fungal isolate was identified based on morphological characteristics and analysis of sequences of the ITS1-5.8S-ITS2 ribosomal RNA gene region and the calmodulin gene, and their DNA sequences were deposited in GenBank under accession numbers of HM055488 and HM055489, respectively. Culture of the CRI322-03 fungus grew rapidly on Czapek solution agar at 25 °C reached a colony diameter of 5.5 cm in 6 days. Morphological characteristics were only suggestive of A. aculeatus which is very close to A. aculeatinus and A. japonicus. Molecular phylogenetic analysis was required for a more definite identification of this fungus. 3.2.1. DNA sequence-based identification The CRI322-03 fungus was cultured in potato dextrose broth for 4 days and total cellular DNA was extracted from the washed fungal mycelium using FTAÒ Plant Kit (WhatmanÒ, USA) according to the manufacturer’s instructions. 3.2.2. Identification based on ribosomal RNA gene sequence The ITS1-5.8S-ITS2 of the ribosomal RNA gene region was amplified from the fungal genomic DNA by PCR (GoTaqÒ Colorless

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820

Master Mix, Promega) using the ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers (White et al., 1990) as previously described (Prachya et al., 2007). The PCR amplified ITS1-5.8S-ITS2 fragment was purified and directly subjected to DNA sequencing reactions on both strands using the primers ITS5 and ITS4. The DNA sequence obtained was submitted to BLASTN 2.2.23+ (Zhang et al., 2000) to search for similar sequences in GenBank. Sequence identities at 99–100% were found with many reference strains of A. aculeatus and A. japonicus. A phylogenetic tree constructed from these analyses showed that the CRI322-03 associated with the A. aculeatus cluster. However, since the ITS1-5.8S-ITS2 region was so highly conserved, separation between A. aculeatus and A. japonicus was not well supported based on these sequences. 3.2.3. Identification based on calmodulin (cmdA) gene sequence DNA sequences of the calmodulin gene are more variable than the ribosomal RNA gene and thus giving higher discriminative power in separating closely related fungal species. The calmodulin gene of the CRI322-03 fungus was amplified by PCR from genomic DNA using the cmd5 (CCGAGTACAAGGAGGCCTTC) and cmd6 (CCGATAGAGGTCATAACGTGG) primers (Hong et al., 2006). The amplified calmodulin fragments were purified and directly subjected to DNA sequencing on both strands using the cmd5 and cmd6 primers. BLASTN 2.2.23+ (Zhang et al., 2000) search against GenBank established that the cmdA gene of the CRI322-03 fungus was homologous with reference strains of A. aculeatus (95–100% identity), A. aculeatinus (95% identity), and A japonicus (93% identity). Phylogenetic analysis was performed using the neighborjoining method with 1000 replications bootstrap. The CRI322-03 was placed in the same clade with A. aculeatus, well separated from the A. aculeatinus and A. japonicus clusters. Based on macroscopic and microscopic morphological characteristics, phylogenetic analyses of the ITS1-5.8S-ITS2, and calmodulin gene sequences, this marine-derived fungus was identified as A. aculeatus CRI322-03. DNA sequences of the ITS1-5.8S-ITS2 and the partial cmdA gene of the CRI322-03 fungus have been submitted to GenBank with the accession numbers of HM055488 and HM055489, respectively. A subculture of CRI322-03 has been deposited at Chulabhorn Research Institute (CRI) and MIM Laboratory, Department of Microbiology, Mahidol University, Thailand. 3.3. Extraction and isolation The fungus A. aculeatus CRI322-03 was grown on PDA agar and then transferred to potato dextrose broth (PDB) constituted seawater instead of distilled H2O. The fungus was inoculated into 1 L Erlenmeyer flasks (20 flasks), each containing 250 mL of PDB, and incubated under static conditions for 30 days. The fermentation culture (5 L) was separated into mycelia and broth by filtration. The broth was extracted with an equal volume of EtOAc four times. The EtOAc layers were combined and evaporated to yield a crude broth extract (954 mg). The mycelia (cells) were extracted sequentially in MeOH and CH2Cl2, each for two times at room temperature. The MeOH and CH2Cl2 extracts were combined, suspended with distilled H2O (600 mL), and partitioned with hexane (400 mL; 4 times) to remove fatty acids and triglycerides. The aqueous extract obtained was further partitioned with an equal volume of EtOAc (4 times) and evaporated, yielding a crude cell extract (1.1 g). The crude broth extract was separated by Sephadex LH-20 column chromatography (CC) eluting with MeOH. Thirty-six fractions were combined on the basis of TLC pattern (developed with EtOAc: CH2Cl2, 1:1, v/v), giving 22 fractions (B1 to B22). Fractions B5 to B7 (143 mg) were combined and subjected to Sephadex LH-20 CC, eluting with MeOH to yield 11 fractions (B57.1 to B57.11). Fractions B57.9 and B57.10 were combined (57.6 mg) and further puri-

819

fied by silica gel CC, eluting with MeOH:CH2Cl2 (0.5:9.5, v/v) to yield ()-9-hydroxyhexylitaconic acid-4-methyl ester (5) (18.6 mg). Fractions B10 and B11 (144.0 mg) were combined and further separated by Sephadex LH-20 CC (eluted with MeOH) to yield ()-9-hydroxyhexylitaconic acid (4) (42.3 mg). Fraction B14 (195.8 mg) was separated by Sephadex LH-20 CC, and nine fractions (B14.1 to B14.9) were obtained. Fractions B14.6 and B14.7 were combined (74.0 mg) and further separated by Sephadex LH20 CC, eluted with MeOH, to obtain 12 fractions (B14.67.1 to B14.67.12). Fractions B14.67.5 to B14.67.10 were combined (58.0 mg) and subjected to silica gel CC using a mixture of MeOH:CH2Cl2 (0.5:9.5, v/v) as eluent to furnish 12 mg of pre-aurantiamine (1). The crude cell extract was suspended in MeOH (40 mL), and filtered, giving soluble and insoluble portions. The insoluble residue was extracted with acetone, and the acetone-soluble portion was evaporated to yield secalonic acid D (7) (40.5 mg). The crude MeOH-soluble extract was separated by Sephadex LH-20 CC to afford eleven fractions (C1 to C11). Fraction C4 (164.0 mg) was further purified by Sephadex LH-20 CC to yield eight fractions (C4.1 to C4.8). Fractions C4.5 and C4.6 were combined (38.8 mg) and purified by preparative TLC developed with a mixture of MeOH:CH2Cl2 (3:97, v/v) to furnish paraherquamide E (6) (10 mg). Fraction C6 (127.4 mg) was separated by Sephadex LH-20 CC, eluted with MeOH, to give eight fractions (C6.1 to C6.8). Fractions C6.5 and C6.6 were combined (40.0 mg) and further purified by silica gel CC, eluted with a mixture of MeOH:CH2Cl2 (0.5:9.5, v/v), to afford pre-aurantiamine (1) (10.3 mg). 3.4. Spectroscopic data of compounds 3.4.1. Pre-aurantiamine (1) Colorless crystals (from MeOH:hexane, 9:1); m.p. 212–215 °C; [a]27D 160 (c 0.24, MeOH); UV (MeOH) kmax (log e) 307 (3.97) and 230 (3.52) nm; IR (UATR) mmax 3193, 2963, 2926, 1660, 1634, 1551, 1432, 1378, 1276, 857 and 773 cm1; APCI-TOF MS: m/z 235.1183 [M+H]+ (calcd. for C11H15N4O2, 235.1195); for 1H and 13 C NMR spectroscopic data, see Table 1. 3.4.2. ()-9-Hydroxyhexylitaconic acid (4) Pale brown viscous oil; [a]27D 8.4 (c 0.39, MeOH); UV (MeOH) kmax (log e) 219 (3.63) nm; IR (UATR) mmax 3401, 2933, 2860, 1702, 1628, 1409, 1376, 1263, 1220, 1156, 958 and 825 cm1; APCI-TOF MS: m/z 231.1228 [M+H]+ (calcd. for C11H19O5, 231.1232); for 1H and 13C NMR spectroscopic data, see Table 1. 3.4.3. ()-9-Hydroxyhexylitaconic acid-4-methyl ester (5) Pale brown viscous oil; [a]27D 9.3 (c 0.38, MeOH); UV (MeOH) kmax (log e) 219 (3.50) nm; IR (UATR) mmax 3406, 2929, 2853, 1709, 1575, 1405, 1220 and 820 cm1; APCI-TOF MS: m/z 245.1387 [M + H]+ (calcd. for C12H21O5, 245.1389); for 1H and 13C NMR spectroscopic data, see Table 1. 3.5. Methylation of pre-aurantiamine (1) To a solution of pre-aurantiamine (1) (10.0 mg) in DMF (1.5 mL) was added K2CO3 (118.0 mg) and MeI (0.5 mL). A reaction mixture was left stirring at room temperature for 20 h, dried under vacuum. The mixture was dissolved in EtOAc (30 mL) and subsequently washed with distilled H2O (4  30 mL). The EtOAc layer was dried to give a crude reaction mixture (15.8 mg), which was purified by Sephadex LH-20 eluted with MeOH, to obtain the methylated derivative 2 (7.0 mg). Methylated derivative 2: [a]27D 65 (c 0.10, MeOH); 1H NMR (600 MHz, acetone-d6) d 11.54 (1H, br s, 11-NH), 11.50 (1H, br s, 8-NH), 7.73 (1H, s, H-2), 7.33 (1H, s, H5), 6.51 (1H, s, H-6), 4.14 (1H, d, J = 2.9 Hz), 3.79 (3H, s, 1-NCH3),

820

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820

2.26–2.34 (1H, m, H-10), 1.04 (3H, d, J = 7.1 Hz), 0.92 (3H, d, J = 6.8 Hz); 13C NMR (150 MHz, acetone-d6) d 165.4 (C, C-9), 160.2 (C, C-12), 139.1 (CH, C-2), 138.7 (C, C-4), 126.2 (C, C-7), 122.5 (CH, C-5), 103.6 (CH, C-6), 61.5 (CH, C-10), 34.3 (CH2, C13), 33.5 (C, 1-NCH3), 18.3 (CH3, C-14), 16.6 (CH3, C-15); APCITOF MS: m/z 249.1353 [M+H]+ (calcd. for C12H17N4O2, 249.1352). 3.6. Methylation of 4 To a solution of compound 4 (23.1 mg) in DMF (2 mL) were added K2CO3 (26.8 mg) and MeI (0.13 mL), and the mixture was stirred for 20 h. The mixture was dried, dissolved in EtOAc (8 mL), and washed with H2O (5  8 mL), to afford a dimethylated derivative 4a (15.5 mg). 1H NMR (CDCl3, 400 MHz) d 6.38 (1H, s, H11a), 5.77 (1H, s, H-11b), 3.78 (4H, s, 4-OMe and H-9), 3.69 (3H, s, 1-OMe), 3.51 (1H, t, J = 8.0 Hz, H-2), 1.90–1.27 (8H, m, H2-5 to H28), 1.20 (3H, d, J = 8.0 Hz, H3-10). 3.7. Preparation of (R)- and (S)-MTPA esters of 4a The reaction mixture containing compound 4a (6.5 mg), (R)-(+)-

a-methoxy-a-(trifluoromethyl)phenylacetic acid (MTPA; 9.9 mg), N,N0 -dicyclohexylcarbodiimine (15.6 mg), and a catalytic amount of N,N-(dimethylamino)pyridine was dissolved in CH2Cl2 (2 mL), and stirred at room temperature for 20 h. The reaction mixture was added to H2O (5 mL) and extracted with CHCl3 (5 mL). The mixture was purified by preparative TLC, eluted with 10% EtOAc in hexane, to give the (R)-MTPA ester (4c; 5.7 mg). The (S)-MTPA ester was prepared in the same manner; compound 4a was reacted with (S)-()-a-methoxy-a-(trifluoromethyl)phenylacetic acid (MTPA), to give the (S)-MTPA ester (4b; 5.8 mg). (S)-MTPA ester (4b); 1H NMR (CDCl3, 400 MHz) d 7.52 (2H, m, aromatic signals of MTPA), 7.40 (3H, m, aromatic signals of MTPA), 6.35 (1H, s, H11a), 5.72 (1H, s, H-11b), 5.12 (1H, sext, J = 5.9 Hz, H-9), 3.77 (3H, s, 4-OMe), 3.68 (3H, s, 1-OMe), 3.55 (3H, br d, OMe of MTPA), 3.48 (1H, t, J = 7.2 Hz, H-2), 2.50–0.50 (8H, m, H2-5 to H2-8), 1.33 (3H, d, J = 6 Hz, H3-10). (R)-MTPA ester (4c); 1H NMR (CDCl3, 400 MHz) d 7.52 (2H, m, aromatic signals of MTPA), 7.40 (3H, m, aromatic signals of MTPA), 6.35 (1H, s, H-11a), 5.72 (1H, s, H11b), 5.12 (1H, sext, J = 6.2 Hz, H-9), 3.77 (3H, s, 4-OMe), 3.68 (3H, s, 1-OMe), 3.55 (3H, br d, OMe of MTPA), 3.45 (1H, t, J = 7.4, H-2), 2.00–0.90 (8H, m, H2-5 to H2-8), 1.33 (3H, d, J = 6.3, H3-10). 3.8. X-ray crystal structure of pre-aurantiamine (1) Crystals of pre-aurantiamine (1) were obtained from slow solvent evaporation of MeOH–hexane solution (9:1 v/v) without solvent of crystallization as C11H14N4O2 in the trigonal space group P31 or P32 (No. 144 or 145) with unit cell constants a = 9.0535(3) Å, c = 12.2765(4) Å, V = 871.44(5) Å3, Z = 3, Dcalc = 1.339 g/cm3, MW = 234.26. A colorless block-like single crystal of 1 with dimensions 0.20  0.25  0.42 mm3 was mounted with epoxy glue on the tip of a glass fiber. The X-ray diffraction experiment was performed at 298(2) K using a Bruker X8 APEX2 Kappa CCD area-detector diffractometer with MoKa radiation (k = 0.71073 Å). A total of 3914 reflections were collected, integrated, reduced by SAINT+, corrected for Lorentz polarization and absorption effects, and scaled by SADABS (Bruker Software Suite, APEX2, SAINT+ and SADABS. Bruker AXS Inc., Madison, Wisconsin, USA, 2005) to yield 2191 independent reflections (Rint = 0.018). The structure was solved by direct methods and refined with full-matrix least squares on F2 using SHELXL-97 (Sheldrick, G.M., 1997. University of Gottingen, Gottingen, Germany). The final R1(F2) = 0.055 and wR(F2) = 0.129 for 1644 data with F2 > 2r(F2). Data have been deposited with the Cambridge Crystallographic Data Centre (CCDC 784196). Copies of these data can be obtained, free of charge, on application

to the CCDC via www.ccdc.cam.ac.uk/conts/retrieving.html (or 12 Union Road, Cambridge CB2 1EZ, UK, fax: +44 1223 336033, email: [email protected]). Acknowledgements P.K. is grateful to The Thailand Research Fund (Grant No. DBG5180014) and the Center for Environmental Health, Toxicology and Management of Chemicals (ETM) for financial support. S.W. is supported by a Mahidol University research grant. T.A. is grateful to the Thai Government Stimulus Package 2 (TKK2555) and the Centre for Petroleum, Petrochemicals and Advanced Materials, Chulalongkorn University. References Andersen, R., Buechi, G., Kobbe, B., Demain, A.L., 1977. Secalonic acids D and F are toxic metabolites of Aspergillus aculeatus. J. Org. Chem. 42, 352–353. Aree, T., Antia, B.S., Ekpa, O.D., Kittakoop, P., 2010. Paraherquamide E. Acta Crystallogr. E66, o2227. Dale, J.A., Mosher, H.S., 1973. Nuclear magnetic resonance enantiomer reagents. Configurational correlations via nuclear magnetic resonance chemical shifts of diastereomeric mandelate, O-methylmandelate, and amethoxy-a-trifluoromethylphenylacetate (MTPA) esters. J. Am. Chem. Soc. 95, 512–519. Gondry, M., Sauguet, L., Belin, P., Thai, R., Amouroux, R., Tellier, C., Tuphile, K., Jacquet, M., Braud, S., Courcon, M., Masson, C., Dubois, S., Lautru, S., Lecoq, A., Hashimoto, S., Genet, R., Pernodet, J.L., 2009. Cyclodipeptide synthases are a family of tRNA-dependent peptide bond-forming enzymes. Nat. Chem. Biol. 5, 414–420. Hayashi, Y., Orikasa, S., Tanaka, K., Kanoh, K., Kiso, Y., 2000. Total synthesis of antimicrotubule diketopiperazine derivatives: phenylahistin and aurantiamine. J. Org. Chem. 65, 8402–8405. Holzapfel, C.W., Marsh, J.J., 1977. Isolation and structure of viridamine, a new nitrogenous metabolite of Penicillium viridicatum Westling. South Afr. J. Chem. 30, 197–204. Hong, S.B., Cho, H.S., Shin, H.D., Frisvad, J.C., Samson, R.A., 2006. Novel Neosartorya species isolated from soil in Korea. Int. J. Syst. Evol. Microbiol. 56, 477–486. Ingavat, N., Dobereiner, J., Wiyakrutta, S., Mahidol, C., Ruchirawat, S., Kittakoop, P., 2009. Aspergillusol A, an alpha-glucosidase inhibitor from the marine-derived fungus Aspergillus aculeatus. J. Nat. Prod. 72, 2049–2052. Kasettrathat, C., Ngamrojanavanich, N., Wiyakrutta, S., Mahidol, C., Ruchirawat, S., Kittakoop, P., 2008. Cytotoxic and antiplasmodial substances from marinederived fungi, Nodulisporium sp. and CRI247-01. Phytochemistry 69, 2621– 2626. Klemke, C., Kehraus, S., Wright, A.D., Konig, G.M., 2004. New secondary metabolites from the marine endophytic fungus Apiospora montagnei. J. Nat. Prod. 67, 1058– 1063. Larsen, T.O., Frisvad, J.C., Jensen, S.R., 1992. Aurantiamine, a diketopiperazine from two varieties of Penicillium aurantiogriseum. Phytochemistry 31, 1613–1615. Li, S.M., 2009. Evolution of aromatic prenyltransferases in the biosynthesis of indole derivatives. Phytochemistry 70, 1746–1757. Liesch, J.M., Wichmann, C.F., 1990. Novel antinematodal and antiparasitic agents from Penicillium charlesii. II. Structure determination of paraherquamides B, C, D, E, F, and G. J. Antibiot. 43, 1380–1386. Parvatkar, R.R., D’Souza, C., Tripathi, A., Naik, C.G., 2009. Aspernolides A and B, butenolides from a marine-derived fungus Aspergillus terreus. Phytochemistry 70, 128–132. Prachya, S., Wiyakrutta, S., Sriubolmas, N., Ngamrojanavanich, N., Mahidol, C., Ruchirawat, S., Kittakoop, P., 2007. Cytotoxic mycoepoxydiene derivatives from an endophytic fungus Phomopsis sp. isolated from Hydnocarpus anthelminthicus. Planta Med. 73, 1418–1420. Prachyawarakorn, V., Mahidol, C., Sureram, S., Sangpetsiripan, S., Wiyakrutta, S., Ruchirawat, S., Kittakoop, P., 2008. Diketopiperazines and phthalides from a marine derived fungus of the order Pleosporales. Planta Med. 74, 69–72. Saleh, O., Haagen, Y., Seeger, K., Heide, L., 2009. Prenyl transfer to aromatic substrates in the biosynthesis of aminocoumarins, meroterpenoids and phenazines: the ABBA prenyltransferase family. Phytochemistry 70, 1728– 1738. Trisuwan, K., Rukachaisirikul, V., Sukpondma, Y., Preedanon, S., Phongpaichit, S., Rungjindamai, N., Sakayaroj, J., 2008. Epoxydons and a pyrone from the marinederived fungus Nigrospora sp. PSU-F5. J. Nat. Prod. 71, 1323–1326. Trisuwan, K., Rukachaisirikul, V., Sukpondma, Y., Preedanon, S., Phongpaichit, S., Sakayaroj, J., 2009. Pyrone derivatives from the marine-derived fungus Nigrospora sp. PSU-F18. Phytochemistry 70, 554–557. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315–322. Zhang, Z., Schwartz, S., Wagner, L., Miller, W., 2000. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7, 203–214.