- Email: [email protected]
ITS-based detection and quantification of Aspergillus ochraceus and Aspergillus westerdijkiae in grapes and green coffee beans by real-time quantitative PCR
International Journal of Food Microbiology 131 (2009) 162–167
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o
ITS-based detection and quantification of Aspergillus ochraceus and Aspergillus westerdijkiae in grapes and green coffee beans by real-time quantitative PCR Jéssica Gil-Serna a, Amaia González-Salgado b, Ma Teresa González-Jaén b, Covadonga Vázquez a, Belén Patiño a,⁎ a b
Department of Microbiology III, Faculty of Biology, University Complutense of Madrid, José Antonio Novais 2, E 28040 Madrid, Spain Department of Genetics, Faculty of Biology, University Complutense of Madrid, José Antonio Novais 2, E 28040 Madrid, Spain
a r t i c l e
i n f o
Article history: Received 9 June 2008 Received in revised form 12 January 2009 Accepted 9 February 2009 Keywords: Aspergillus ochraceus Aspergillus westerdijkiae Real-time qPCR OTA Grapes Green coffee beans ITS
a b s t r a c t Aspergillus ochraceus and A. westerdijkiae are considered the most important Ochratoxin A (OTA) producing species included in Aspergillus section Circumdati which contaminate foodstuffs and beverages for human consumption. In this work a real-time quantitative PCR protocol was developed to detect both species using SYBR® Green and primers designed on the basis of the multicopy ITS1 region of the rDNA. The assay had high efficiency (94%) and showed no inhibition by host or fungal DNA other than the target species. The lower detection limit of the target DNA was 2.5 pg/reaction. Accuracy of detection and quantification by qPCR were tested with genomic DNA obtained from green coffee beans and grapes artificially contaminated with spore suspensions of known concentrations. Spore concentrations equal or higher than 106 spore/ml could be detected by the assay directly without prior incubation of the samples and a positive relationship was observed between incubation time and qPCR values. The assay developed would allow rapid, specific, accurate and sensitive detection and quantification of A. ochraceus and A. westerdijkiae to be directly used in a critical point of the food chain, before harvesting green coffee and grape berries, to predict and control fungal growth and OTA production. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Ochratoxin A (OTA) is a widespread mycotoxin with nephrotoxic, inmunotoxic, genotoxic and teratogenic properties towards several animal species (Pfohl-Leszkowicz and Manderville, 2007) and has been classified by the International Agency for Research on Cancer as a possible human carcinogen (group 2B) (IARC, 1993). The maximum OTA limits allowed in several food and raw agro-products for human consumption are under legal regulation in the European Union (Commission Regulation, 2006). This mycotoxin occurs in various foodstuffs including cereals and derivatives (Rizzo et al., 2002), coffee (Taniwaki et al., 2003), grapes and grape-products (Varga and Kozakiewicz, 2006), dried fruits (Zinedine et al., 2007) and spices (Rizzo et al., 2002). OTA is a secondary metabolite produced by several fungal species belonging to the Aspergillus and Penicillium genera. Aspergillus ochraceus was the first OTA-producing species described (Van der Merwe et al., 1965) and it is considered an important species contributing to OTA contamination of coffee, grapes and cereals (Taniwaki et al., 2003; Magnoli et al., 2007). Other important OTA-producing
⁎ Corresponding author. E-mail address: [email protected] (B. Patiño). 0168-1605/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2009.02.008
species of the Section Circumdati are the more recently described A. westerdijkiae and A. steynii (Frisvad et al., 2004; Samson et al., 2006). Discrimination among these species and from other closely related species is difficult when conventional methods based mainly on morphological features are used and requires considerable expertise. The application of DNA-based techniques permits rapid, sensitive and specific detection, necessary to devise strategies to control or reduce fungal mass and toxin production at early and critical stages of the food chain, and they are replacing traditional methods in many areas related with food analyses (Niessen et al., 2005). Real-time quantitative PCR (qPCR) has solved the limitations of conventional PCR, providing a tool to accurate and sensitive quantification of target DNA. The most common chemistries, DNA-associating dyes (SYBR Green I) or fluorescently labelled sequence-specific oligoprobes (TaqMan® oligoprobes) are being widely used to develop qPCR assays (Mackay et al., 2007). The lower cost of qPCR based on SYBR Green is an advantage of this method for detection and quantification protocols used in routine analyses of commodities, but it may involve a loss of specificity if primers-dimers or nonespecific fragments are present (Kubista et al., 2006). Because of this, additional controls should be done such as analyzing the reaction products with a melting curve (Ririe et al., 1997). The target sequence used to design the primers is also relevant, because it will condition the power of discrimination and the sensitivity of the assay. Several qPCR assays to detect and quantify ochratoxigenic fungi have been developed using as target
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
constitutive genes (Mulè et al., 2006; Morello et al., 2007) or genes involved in toxin biosynthesis (Schmidt et al., 2004; Atoui et al., 2007; Selma et al., 2008). Sensitivity and specificity of qPCR assays are enhanced when multicopy sequences are used to design specific primers (Suarez et al., 2005). However, none of the qPCR protocols reported so far was designed using the multicopy ITS regions to detect ochratoxigenic fungi. The applicability of the assay to detect fungi in natural samples need special consideration since food matrices are usually very complex (Hanna et al., 2005) and some of the matrix-associated compounds can inhibit qPCR or reduce its efficiency, such as phenolic compounds which may cause problems in real-time reaction by binding or denaturing the polymerase (Wilson, 1997). Early detection of OTA-producing species is critical to prevent mycotoxin entering the food chain (Dao et al., 2005) and OTA concentration can be correlated with the levels of ochratoxigenic fungus detected on naturally contaminated samples (Lund and Frisvad, 2003). Hence, identification and quantification of A. ochraceus and A. westerdijkiae in raw products could predict potential risk of OTA contamination of foodstuffs. The aim of the present work was to develop a sensitive and specific assay not inhibited by matrix effects to detect and quantify A. ochraceus and A. westerdijkiae in green coffee beans and grapes. An efficient protocol for extraction of fungal DNA from foodstuffs was developed and the effect of exogenous DNA on the qPCR efficiency was also evaluated. 2. Materials and methods 2.1. Organisms, media and culture conditions All the isolates used in this study are given in Table 1. Fungal strains were maintained by regular subculturing on Potato Dextrose Agar (PDA) (Pronadisa, Madrid, Spain) at 25 + 1 °C for 4–5 days and then stored as spore suspension in 15% glycerol at −80 °C. Fungal strains were cultured for DNA extraction in Erlenmeyer flasks containing 20 ml of Sabouraud Broth (Pronadisa, Madrid, Spain) and incubated at 28 + 1 °C in an orbital shaker (140 rpm) for 3 days. 2.2. DNA extraction DNeasy Plant Mini Kit (Qiagen, Valencia, Spain) was used according to manufacturer's instructions starting from 20 mg of filtered mycelium frozen with liquid nitrogen and grinded using a mortar and pestle. This protocol was also used for DNA extraction from green coffee beans. The yield of the method was evaluated in five independent extractions of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF. In the case of DNA extraction from grapes, 0.33% Polyvinylpyrrolidone (PVP) (Sygma-Aldrich, Steinheim, Germany) was added to AP1 and AP2 buffers. In all cases, purified DNA was eluted from the DNeasy spin column using elution buffer (TE) and optimal results were obtained by eluting twice (2 × 75 µl). DNA concentrations were determined using a NanoDrop® ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA).
163
Table 1 Fungal strains used in this study to validate the quantitative PCR assay designed. Strain
Species
Source
Amplification with OCRAQ1/OCRAQ2
178a 242a⁎ 325a CBS 102.14 CBS 310.80 CBS 614.78 IMI 345568 ITEM 4592 M12hip10a⁎ ITEM 4685 B.Me.A26 CECT 2091 ALHb ALMb CBS 108.08 CBS 624.78 CECT 2092⁎ CECT 2093 CECT 2969 CECT 2970 Cab5dch6 CBS 112812 CBS 112814 CBS 121991 CBS 121993 Bo75⁎ T.TT.A2 ALBb ALDb⁎ ALFb⁎ ALGb CBS 112803 CBS 112791 CBS 121983 CBS 121984 CBS 121986 F4094⁎ FvMM1-2 CECT 2270⁎ CYC 20012 CYC 20013 IMI 311661 CECT 10590 CECT 10113 Pv 1 CECT 1172 CECT 10676 Un 1
Aspergillus carbonarius Aspergillus carbonarius Aspergillus carbonarius Aspergillus elegans Aspergillus elegans Aspergillus elegans Aspergillus elegans Aspergillus flavus Aspergillus flavus Aspergillus japonicus Aspergillus niger Aspergillus niger Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus parasiticus Aspergillus steynii Aspergillus steynii Aspergillus steynii Aspergillus steynii Aspergillus tubingensis Aspergillus tubingensis Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Fusarium thapsinum Fusarium verticillioides Penicillium corylophilum Botrytis cinerea Botrytis cinerea Colletotrichum coffeanum Pichia anomala Pichia membranifaciens Plamopara viticola Saccharomyces cerevisiae Torulaspora delbrueckii Uncinula necator
Grapes, Spain Grapes, Spain Grapes, Spain
– – – – – – – – – – – – + + + + + + + + – – – – – – – + + + + + + + + + – – – – – – – – – – – –
Wheat, France Barley, Spain Grapes, Spain
Coffee, India Coffee, India Coffee, Thailand Coffee, Thailand Grapes, Spain Grapes, Spain
Sorghum, South Africa Coffee, Thailand Coffee, Thailand Coffee, Thailand Laboratory cross Maize, Spain Grapes, Spain Grapes, Spain Coffee, Tanzania Grape Juice, Spain Grapes, Spain Grapes, Spain Orange juice, Spain Grapes, France Grapes, Spain
Last nine strains corresponding to species that cause common fungal grapes or green coffee diseases and yeast that could be present as usual flora. CBS: Centralbureau voor Schimmel Cultures (The Netherlands). CECT: Spanish Type Culture Collection (Spain). CYC: Complutense Yeast Collection (Spain). ITEM: Institute of Sciences of Food Production Culture Collection (Italy). IMI: CABI Genetic Resource Collection (United Kingdom). a Strain supplied by Dr. V. Sanchis (University of Lleida, Spain). b Strains supplied by Dr. L. Niessen (Technische University of München, Germany). ⁎ Fungal strains used to test the specificity of the qPCR assay.
2.3. Primer design
2.4. Conventional PCR amplification
Two specific primers to A. ochraceus and A. westerdijkiae, OCRAQ1 and OCRAQ2 (5'GCACAGCGC TCGCCG 3' and 5'CTGATTGCGATACAATCG 3' respectively) were designed on the basis of sequence alignments of the ITS1 region of several strains from different origins and other related species and genera obtained in our laboratory or retrieved from data bases. A universal pair of primers based in 5.8 S region, 5.8 S1 (5'CGGCATCGATGAA GAACGC 3') and 5.8 S2 (5'CAATGTGCGTTCAAAGACTCG 3'), was designed following the same approach indicated above to test amplification in samples where neither A. ochraceus nor A. westerdijkiae DNA were present.
Specificity of the pair OCRAQ1/OCRAQ2 was tested by conventional PCR in a wide range of isolates shown in Table 1. The assays were performed in an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany). Amplification reactions were carried out in volumes of 25 µL containing 2 µL (5–50 ng) of template DNA, 1 µL of each primer (20 µM), 2.5 µL of 10× PCR buffer, 1 µL of MgCl2 (50 mM), 0.2 µL of dNTPs (100 mM) and 0.15 µL of Taq DNA polymerase (5 U/µL) supplied by the manufacturer (Biotools, Madrid, Spain). All genomic DNAs were tested for suitability for PCR amplification using universal primers ITS1 and ITS4 (White et al., 1990) and the
164
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
protocol described elsewhere (Henry et al., 2000). Specific PCR assays carried out using primers OCRAQ1/OCRAQ2 for A. ochraceus and A. westerdijkiae were performed according to the following protocol: 4 min 30 s at 95 °C, 24 cycles of 30s at 95 °C (denaturalization), 20s at 60 °C (annealing), 35s at 72 °C (extension) and finally 3 min at 72 °C. PCR products were detected in 3% agarose ethidium bromide gels in TAE 1X buffer (Tris-acetate 40 mM and EDTA 1.0 mM). The 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania) was used as molecular size marker. 2.5. Quantitative PCR amplification Quantitative real-time PCR assay was performed and monitored in an ABI PRISM 7900HT system (Applied Biosystems, Madrid, Spain) in the Genomic Unit of the Complutense University of Madrid. The reaction mixture composition in a final volume of 25 µl was: 12.5 µl SYBR® Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1.2 µl forward primer 5 µM, 1.2 µl reverse primer 5 µM, 5 µl DNA template in suitable concentration and 5.1 µl molecular biology water (MO-BIO, Carlsbad, USA). qPCR assays were carried out using a standard program: 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. All reactions were carried out by duplicate in MicroAmp 96-well plates (Applied Biosystems, Madrid, Spain). 2.6. Standard curve Ten-fold serial dilutions of DNA from CECT 2092 strain (from 50 to 5 × 10− 3 ng/µl) were used as template in the reactions. Ct values were plotted against the logarithm of starting quantity of template for each dilution. Then, amplification efficiency was calculated from the slope of the standard curve (Kubista et al., 2006). E = 10
− 1 = slope
% Efficiency = ðE − 1Þ × 100
ð1Þ
Table 2 qPCR analyses of samples containing DNA of two or more fungal species at different proportions. DNA mix
Ratio
Ct value
DNA concentration (ng/µl)
A A. A. A. A. A. A. A. A. A. A. A.
100 50:50 50:50 50:50 25:75 50:50 75:25 50:50 25:75 100 33:33:33
21.33 ± 0.20 22.75 ± 0.10 22.82 ± 0.04 22.76 ± 0.09 23.57 ± 0.21 22.86 ± 0.01 22.32 ± 0.13 22.76 ± 0.06 23.25 ± 0.08 30.61 ± 0.04 23.50 ± 0.08
0.078 0.031 0.029 0.030 0.018 0.028 0.041 0.030 0.022 0 0.019
50:50
30.50 ± 0.28 0
100 50:50 50:50 50:50 25:75 50:50 75:25 50:50 25:75 100 33:33:33 50:50
20.45 ± 0.02 21.22 ± 0.00 21.57 ± 0.10 21.65 ± 0.13 22.92 ± 0.02 21.42 ± 0.07 21.15 ± 0.01 21.85 ± 0.00 23.00 ± 0.03 34.34 ± 0.11 22.47 ± 0.25 32.94 ± 0.14
westerdijkiae westerdijkiae P. corylophilum westerdijkiae Fusarium sp. westerdijkiae A. flavus westerdijkiae A. flavus westerdijkiae A. tubingensis westerdijkiae A. tubingensis westerdijkiae A. carbonarius westerdijkiae A. carbonarius tubingensis westerdijkiae A. tubingensis A. carbonarius P. corylophilum Fusarium sp. B A. ochraceus A. ochraceus P. corylophilum A. ochraceus Fusarium sp. A. ochraceus A. flavus A. ochraceus A. flavus A. ochraceus A. tubingensis A. ochraceus A. tubingensis A. ochraceus A. carbonarius A. ochraceus A. carbonarius A. tubingensis A. ochraceus A. tubingensis A. carbonarius P. corylophilum Fusarium sp.
0.140 0.084 0.067 0.063 0.027 0.073 0.088 0.055 0.026 0 0.037 0
A) Assay with mixes containing A. westerdijkiae DNA. B) Assay with mixes containing A. ochraceus DNA. Ct values obtained in qPCR assays are shown as mean ± standard deviation of the reaction duplicates. DNA concentration was determined by interpolating from the standard curve.
ð2Þ
Additionally, different serial dilutions of fungal DNAs extracted from pure culture were evaluated to determine detection limits of the qPCR assay. 2.7. Specificity of qPCR reactions The exclusive binding of SYBR Green® to the amplicons derived from specific reactions was tested by analyzing the melting curve performed after the qPCR program. The protocol was as follows: 15 s at 95 °C, 15 s at 60 °C and 20 min slow ramp between 60 and 95 °C after the qPCR program. The specificity of the pair OCRAQ1/OCRAQ2 to detect A. ochraceus and A. westerdijkiae strains was also tested in qPCR assays using genomic DNA from closely related species and genera that usually contaminate the same products (Table 2). The samples analyzed containing different proportion of DNA from these species and A. westerdijkiae ALD (Table 2A) or A. ochraceus CECT 2092 (Table 2B). Both groups of mixtures were evaluated independently. Ct values obtained were interpolated from the standard curve to calculate initial DNA concentration. Reactions with primer set 5.8S1/5.8S2 were also carried out to test the suitability of genomic DNAs for amplification. 2.8. Evaluation of qPCR inhibition by host DNA Genomic DNA from 5 DNA independent extractions of pure cultures of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF were evaluated in qPCR assays using 1:1 dilutions with TE buffer, DNA of uncontaminated grapes (5 ng/µl) and DNA of uncontaminated green coffee beans (5 ng/µl). Ct values were compared to evaluate inhibition using statistical software SPSS 14.0. Corresponding Student t-test was applied with a level of significance p b 0.05.
2.9. Fungal detection in artificially contaminated samples Green coffee beans (Coffea arabica L., Brazil) and grape berries (Vitis vinifera L., var Vinalopo, Spain) were decontaminated by immersion in ethanol (70%) and, subsequently, 2 g were inoculated with 1 ml of spore suspensions at concentrations 102, 104 and 106 spores/ml (low, medium and high concentration respectively) from CECT 2092, ALD and ALF strains. Fungal conidia suspensions were prepared from a sporulating culture (7 day-old) on Rose Bengale Chloramphenicol Agar (Pronadisa, Madrid, Spain) and filtered through Whatman N°1 paper. Concentrations were measured by microscopy using a Thomas counting chamber and spore suspensions were diluted when necessary. Inoculated samples were incubated at 28 °C for 0, 8, 16 and 24 h before genomic DNA extraction. As negative control, 2 g of grapes or green coffee beans were mock inoculated with 1 ml of sterile saline solution and incubated following the same protocol. 3. Results 3.1. Specificity and sensibility of the qPCR assay designed The specificity of the primers OCRAQ1 and OCRAQ2 was studied by conventional PCR in a number of A. ochraceus and A. westerdijkiae strains from different sources as well as in closely related species or which frequently occur in the same food matrices (Table 1). A single fragment of about 75 bp was amplified when genomic DNA from A. ochraceus or A. westerdijkiae was used. No product was observed with genomic DNA from isolates of the other species tested. The standard curve generated with the pair OCRAQ1/OCRAQ2 in the conditions described above is shown in Fig. 1. Linearity was observed across all the range used and the very high correlation
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
165
Fig. 1. Standard curve generated from the amplification of ten-fold dilutions from target genomic DNA from CECT 2092. This curve revealed strong linear relationship (R2 = 0.998) between the decimal logarithm of the starting DNA concentration and the threshold cycle.
coefficient (R2 = 0.998) indicated very low inter-assays variability. The slope of the standard curve was −3.47 which corresponded to an amplification efficiency of 94%. NTC (non target control) value was 31.27. Different serial dilutions of DNA obtained from pure culture were evaluated in qPCR reactions to determine the lowest amount of target DNA detected by the qPCR protocol developed. The lowest DNA target concentration was 0.5 pg/µl, which corresponded to 2.5 pg/reaction. The derivative melting curve generated showed a single peak indicating that a single amplicon was generated by qPCR and primerdimers did not occur (data not shown). The results of samples with different relative contents of fungal DNA evaluated by qPCR are shown in Table 2. DNA samples containing neither A. ochraceus nor A. westerdijkiae DNA were not amplified with OCRAQ1/OCRAQ2 primer set. qPCR values were in agreement with the relative amount of initial DNA of A. ochraceus or A. westerdijkiae in the sample. Positive amplification with the pair 5.8S1/5.8S2 was observed in all samples analyzed. 3.2. DNA extraction protocol The efficiency of the DNA extraction protocol used was evaluated. DNA concentration values obtained using the NanoDrop spectrophotometer ranged from 5 and 81 ng/µl. All independent DNA extractions were subsequently analyzed by qPCR and the Ct values were interpolated from the standard curve obtaining values between 2 and 71 ng/µl. 3.3. Evaluation of qPCR inhibition by host DNA The results of evaluation of PCR inhibition by host DNA are shown in Table 3. Ct values obtained did not show significant differences (p N 0.05) between control assays (A. ochraceus or A. westerdijkiae DNA diluted in TE) and reactions containing fungal DNA and DNA from either green coffee beans or grape berries.
3.4. Fungal detection and quantification in artificially contaminated samples A. ochraceus and A. westerdijkiae detection in artificially contaminated food matrices after different times of incubation are shown in Fig. 2. When grapes (Fig. 2A) or green coffee beans (Fig. 2B) were inoculated with a suspension 106 spores/ml, target fungal DNA was detected even without incubation showing higher sensitivity on green coffee than on grapes. Intermediate values of spore concentration did reveal the occurrence of A. ochraceus or A. westerdijkiae after 16 h of incubation in green coffee beans and after 24 h in grapes. None of these species was detected by qPCR in samples inoculated with a low concentrated spore suspension (102 spores/ml). No detectable signal was observed in negative control grapes or coffee beans mockinoculated with saline solution. 4. Discussion In this work, a specific and sensitive protocol was developed to detect and quantify A. ochraceus and A. westerdijkiae contamination in grapes and green coffee beans by qPCR. Optimization of a qPCR assay is very important, mainly when SYBR Green dye is used. The analysis of the melting curve and the parameters calculated from the standard curve showed that the
Table 3 Evaluation of qPCR inhibition by host DNA. Ct values Fungal DNA
Fungal ± coffee DNA Fungal ± grape DNA
A. ochraceus CECT 2092 13.13 ± 0.36 13.09 ± 0.48 A. westerdijkiae ALD 16.39 ± 2.38 16.29 ± 2.21 ALF 15.11 ± 1.21 15.14 ± 1.84
13.77 ± 1.12 17.87 ± 2.50 15.59 ± 2.23
The mean of Ct values of the five independent extractions of each strain are shown (mean ± standard deviation). Differences among results were not statistically significant when fungal DNA was analysed alone or with coffee or grape DNA (p N 0.05).
166
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
Fig. 2. Fungal DNA detection by qPCR of inoculated grape berries (A) and green coffee beans (B). Each value corresponds to the mean of the results of the three strains at different incubation times (0, 8, 16 and 24 h) and spore concentration: 102 (grey), 104 (black) and 106 (dotted). Under no circumstances, controls with saline solution gave a detectable signal in the qPCR assay with OCRAQ1/OCRAQ2 pair of primers.
method designed was highly optimized. The efficiency obtained (94%) and the high R2 coefficient are considered good indicators of a robust and reproducible assay and the melting curve showed that only one fragment was amplified and primer-dimers did not form. The ITS1-5.8S-ITS2 region within the rDNA unit is frequently used to discriminate at the species level (Edwards et al., 2002). Conventional PCR assays have demonstrated the specificity of the pair of primers OCRAQ1/OCRAQ2 in a wide representation of A. ochraceus and A. westerdijkiae strains, related and other species causing grape and coffee diseases or those frequently present in the same substrates.
The alignment of ITS1-5.8S-ITS2 region of several strains of A. ochraceus and A. westerdijkiae performed revealed differences in few bases. This allowed development of a single assay to detect both species, being the most important OTA-producing species in terms of relative amounts of OTA produced (Frisvad et al., 2004). On the other hand, the use of ITS regions to develop specific primers instead of single copy genes (either constitutive or toxin biosynthetic genes) enhances the sensitivity of the assay due to its multi-copy character (Suarez et al., 2005). A previous qPCR assay targeting genes involved in OTA synthesis to detect A. ochraceus could detect up to 4.7 pg per
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
reaction (Schmidt et al., 2004) and, in this work, the lowest detection limit achieved was 2.5 pg per reaction. Currently, several authors prefer to express sensitivity of qPCR method in number of haploid genomes detected (Mulè et al., 2006; Selma et al., 2008). Nevertheless, it was not possible in our case because genomic size of these species is not known yet. Since the applicability of a qPCR protocol can be seriously compromised by the food matrix (Hanna et al., 2005), we have tested several rapid and easy DNA extraction protocols which could result in efficient removal of matrix compounds which might inhibit qPCR reaction. DNeasy Plant Mini Kit yielded good quality DNA obtained either from fungal pure culture or green coffee beans and suitable for qPCR. The protocol was further improved to be used for grapes, because efficiency was considerably lower than in coffee beans (data not shown), probably due to phenolic compounds present in the grape juice which can inhibit qPCR (Wilson, 1997). Addition of PVP in the corresponding steps, as indicated above, improved the qPCR assay to achieve quantification values closer to those obtained for coffee beans. Once these protocols were optimized, the sensitivity of the qPCR assay was tested in grapes and green coffee beans artificially contaminated with known concentrations of spore suspensions. When a highly concentrated spore suspension (106 spores/ml) was used, a detectable fluorescent signal was obtained even without incubation. DNA extraction from spores is more difficult because of their strong cell wall but when fungi occur in food products, they normally exist as hyphal structures so the method could detect lower levels of contamination without incubation. This assay was useful not only to detect these species but also to quantify them. Concentration values obtained by qPCR in samples with different ratios of fungal DNA were related with the initial amounts of A. westerdijkiae and A. ochraceus DNA. Moreover, the application of the method to quantify these fungi in artificially contaminated matrices was confirmed and detection was increased at longer times of incubation both in grapes and green coffee beans. The possibility to quantify contamination levels in food matrices is essential because previous studies have demonstrated that levels of ochratoxigenic fungi can be related with OTA concentration that exceed legal limits (Lund and Frisvad, 2003). In conclusion, we describe an integrated qPCR method to detect and quantify A. ochraceus and A. westerdijkiae in grapes and green coffee beans. This method was rapid, specific and the sensitivity achieved higher than previously reported protocols, providing a useful tool for early detection of A. ochraceus and A. westerdijkiae and prediction of OTA contamination in commodities susceptible to be colonized by these species. Acknowledgments This work was supported by the Spanish Ministry of Science and Innovation (AGL 2007-66416-C05-02/ALI) and by the UCM-CM (CCG07-UCM/AGR-2612). J. Gil-Serna was supported by a FPU fellowship by the Spanish Ministry of Science and Innovation. References Atoui, A., Mathieu, F., Lebrihi, A., 2007. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR. International Journal of Food Microbiology 115, 313–318.
167
Commission Regulation, 2006. EC No 1881/2006 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union, Brussels. Dao, H.P., Mathieu, F., Lebrihi, A., 2005. Two primer pairs to detect OTA producers by PCR method. International Journal of Food Microbiology 104, 61–67. Edwards, S.G., O, 'Callaghan, J., Dobson, D.W., 2002. PCR-based detection and quantification of mycotoxigenic fungi. Mycological Research 106, 1005–1025. Frisvad, J.C., Frank, J.M., Houbraken, J.A.M.P., Kuijpers, A.F.A., Samson, R.A., 2004. New ochratoxin A producing species of Aspergillus section Circumdati. Studies in Mycology 50, 23–43. Hanna, S.E., Connor, C.J., Wang, H.H., 2005. Real-time polymerase chain reaction for the food microbiologist: technologies, applications, and limitations. Journal of Food Science 70, R49–R53. Henry, T., Iwen, P.C., Hinrichs, S.H., 2000. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 510–1515. IARC, 1993. IARC Vol. 56: some naturally occurring substances: some food items and constituents, heterocyclic aromatic amines and mycotoxins. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans 56. Kubista, M., Andrade, J.M., Bengtsoon, M., Forootan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27, 95–125. Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A. Journal of Applied Microbiology 95, 1117–1123. Mackay, I.M., Mackay, J.F., Nissen, M.D., Sloots, T.P., 2007. Real-time PCR: history and fluorogenic chemistries. In: Mackay, I.M. (Ed.), Real-Time PCR in Microbiology: From Diagnosis to Characterization. Horizon Scientific Press, Norfolk, pp. 1–40. Magnoli, C.E., Astoreca, A.L., Chiacchiera, S.M., Dalcero, A.M., 2007. Ocurrence of ochratoxin A and ochratoxigenic mycoflora in corn and corn based foods and feeds in some South American countries. Mycopathologia 163, 249–260. Morello, L.G., Sartori, D., De Oliveira Martinez, A.L., Vieira, M.L.C., Taniwaki, M.H., Fungaro, M.H.P., 2007. Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of β-tubulin gene by using real-time PCR. International Journal of Food Microbiology 119, 270–276. Mulè, G., Susca, A., Logrieco, A., Stea, G., Visconti, A., 2006. Development of a real-time PCR assay for the detection of Aspergillus carbonarius in grapes. International Journal of Food Microbiology 111, S28–S34. Niessen, L., Schmidt, H., Mühlencoert, E., Färber, P., Karolewiez, A., Geisen, R., 2005. Advances in the molecular diagnosis of ochratoxin A-producing fungi. Food Additives and Contaminants 22, 324–334. Pfohl-Leszkowicz, A., Manderville, R.A., 2007. Ochratoxin A: an overview on toxicity and carcinogenicity in animals and humans. Molecular Nutrition & Food Research 51, 61–99. Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245, 154–160. Rizzo, A., Eskola, M., Atroshi, F., 2002. Ochratoxin A in cereals, foodstuffs and human plasma. European Journal of Plant Pathology 108, 631–637. Samson, R.A., Hong, S.B., Frisvad, J.C., 2006. Old and new concepts of species differentiation in Aspergillus. Medical Mycology 44, S133–S148. Schmidt, H., Bannier, M., Vogel, R.F., Niessen, L., 2004. Detection and quantification of Aspergillus ochraceus in green coffee by PCR. Letters in Applied Microbiology 38, 464–469. Selma, M.V., Martínez-Culebras, P.V., Aznar, R., 2008. Real-time PCR based procedures for detection and quantification of Aspergillus carbonarius in wine grapes. International Journal of Food Microbiology 122, 126–134. Suarez, M.B., Walsh, K., Boonham, N., O'Neill, T., Pearson, S., Baker, I., 2005. Development of a real-time PCR (TaqMan®) assays for the detection and quantification of Botrytis cinerea in planta. Plant Physiology and Biochemistry 43, 890–899. Taniwaki, M.H., Pitt, J.I., Teixeira, A.A., Iamanaka, B.T., 2003. The source of ochratoxin A in Brazilian coffee and its formation in relation to processing methods. International Journal of Food Microbiology 82, 173–179. Van der Merwe, K.J., Steyn, P.S., Fourie, L., 1965. Ochratoxin A, a toxic metabolite produced by Aspergillus ochraceus Wilh. Nature 205, 1112–1113. Varga, J., Kozakiewicz, Z., 2006. Ochratoxin A in grapes and grape-derived products. Trends in Food Science & Technology 17, 72–81. White, T.J., Burns, T., Lee, S., Taylor, J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelgard, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR protocols: a guide to methods and applications. Academic Press, New York, pp. 315–322. Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology 63, 3741–3751. Zinedine, A., Soriano, J.M., Juan, C., Mojemmi, B., Molto, J.C., Bouklouze, A., Cherrah, Y., Idrissi, L., El Aouad, R., Manes, J., 2007. Incidence of ochratoxin A in rice and dried fruits from Rabat and Salé area, Morocco. Food Additives and Contaminants 24, 285–291.
Contents lists available at ScienceDirect
International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o
ITS-based detection and quantification of Aspergillus ochraceus and Aspergillus westerdijkiae in grapes and green coffee beans by real-time quantitative PCR Jéssica Gil-Serna a, Amaia González-Salgado b, Ma Teresa González-Jaén b, Covadonga Vázquez a, Belén Patiño a,⁎ a b
Department of Microbiology III, Faculty of Biology, University Complutense of Madrid, José Antonio Novais 2, E 28040 Madrid, Spain Department of Genetics, Faculty of Biology, University Complutense of Madrid, José Antonio Novais 2, E 28040 Madrid, Spain
a r t i c l e
i n f o
Article history: Received 9 June 2008 Received in revised form 12 January 2009 Accepted 9 February 2009 Keywords: Aspergillus ochraceus Aspergillus westerdijkiae Real-time qPCR OTA Grapes Green coffee beans ITS
a b s t r a c t Aspergillus ochraceus and A. westerdijkiae are considered the most important Ochratoxin A (OTA) producing species included in Aspergillus section Circumdati which contaminate foodstuffs and beverages for human consumption. In this work a real-time quantitative PCR protocol was developed to detect both species using SYBR® Green and primers designed on the basis of the multicopy ITS1 region of the rDNA. The assay had high efficiency (94%) and showed no inhibition by host or fungal DNA other than the target species. The lower detection limit of the target DNA was 2.5 pg/reaction. Accuracy of detection and quantification by qPCR were tested with genomic DNA obtained from green coffee beans and grapes artificially contaminated with spore suspensions of known concentrations. Spore concentrations equal or higher than 106 spore/ml could be detected by the assay directly without prior incubation of the samples and a positive relationship was observed between incubation time and qPCR values. The assay developed would allow rapid, specific, accurate and sensitive detection and quantification of A. ochraceus and A. westerdijkiae to be directly used in a critical point of the food chain, before harvesting green coffee and grape berries, to predict and control fungal growth and OTA production. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Ochratoxin A (OTA) is a widespread mycotoxin with nephrotoxic, inmunotoxic, genotoxic and teratogenic properties towards several animal species (Pfohl-Leszkowicz and Manderville, 2007) and has been classified by the International Agency for Research on Cancer as a possible human carcinogen (group 2B) (IARC, 1993). The maximum OTA limits allowed in several food and raw agro-products for human consumption are under legal regulation in the European Union (Commission Regulation, 2006). This mycotoxin occurs in various foodstuffs including cereals and derivatives (Rizzo et al., 2002), coffee (Taniwaki et al., 2003), grapes and grape-products (Varga and Kozakiewicz, 2006), dried fruits (Zinedine et al., 2007) and spices (Rizzo et al., 2002). OTA is a secondary metabolite produced by several fungal species belonging to the Aspergillus and Penicillium genera. Aspergillus ochraceus was the first OTA-producing species described (Van der Merwe et al., 1965) and it is considered an important species contributing to OTA contamination of coffee, grapes and cereals (Taniwaki et al., 2003; Magnoli et al., 2007). Other important OTA-producing
⁎ Corresponding author. E-mail address: [email protected] (B. Patiño). 0168-1605/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2009.02.008
species of the Section Circumdati are the more recently described A. westerdijkiae and A. steynii (Frisvad et al., 2004; Samson et al., 2006). Discrimination among these species and from other closely related species is difficult when conventional methods based mainly on morphological features are used and requires considerable expertise. The application of DNA-based techniques permits rapid, sensitive and specific detection, necessary to devise strategies to control or reduce fungal mass and toxin production at early and critical stages of the food chain, and they are replacing traditional methods in many areas related with food analyses (Niessen et al., 2005). Real-time quantitative PCR (qPCR) has solved the limitations of conventional PCR, providing a tool to accurate and sensitive quantification of target DNA. The most common chemistries, DNA-associating dyes (SYBR Green I) or fluorescently labelled sequence-specific oligoprobes (TaqMan® oligoprobes) are being widely used to develop qPCR assays (Mackay et al., 2007). The lower cost of qPCR based on SYBR Green is an advantage of this method for detection and quantification protocols used in routine analyses of commodities, but it may involve a loss of specificity if primers-dimers or nonespecific fragments are present (Kubista et al., 2006). Because of this, additional controls should be done such as analyzing the reaction products with a melting curve (Ririe et al., 1997). The target sequence used to design the primers is also relevant, because it will condition the power of discrimination and the sensitivity of the assay. Several qPCR assays to detect and quantify ochratoxigenic fungi have been developed using as target
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
constitutive genes (Mulè et al., 2006; Morello et al., 2007) or genes involved in toxin biosynthesis (Schmidt et al., 2004; Atoui et al., 2007; Selma et al., 2008). Sensitivity and specificity of qPCR assays are enhanced when multicopy sequences are used to design specific primers (Suarez et al., 2005). However, none of the qPCR protocols reported so far was designed using the multicopy ITS regions to detect ochratoxigenic fungi. The applicability of the assay to detect fungi in natural samples need special consideration since food matrices are usually very complex (Hanna et al., 2005) and some of the matrix-associated compounds can inhibit qPCR or reduce its efficiency, such as phenolic compounds which may cause problems in real-time reaction by binding or denaturing the polymerase (Wilson, 1997). Early detection of OTA-producing species is critical to prevent mycotoxin entering the food chain (Dao et al., 2005) and OTA concentration can be correlated with the levels of ochratoxigenic fungus detected on naturally contaminated samples (Lund and Frisvad, 2003). Hence, identification and quantification of A. ochraceus and A. westerdijkiae in raw products could predict potential risk of OTA contamination of foodstuffs. The aim of the present work was to develop a sensitive and specific assay not inhibited by matrix effects to detect and quantify A. ochraceus and A. westerdijkiae in green coffee beans and grapes. An efficient protocol for extraction of fungal DNA from foodstuffs was developed and the effect of exogenous DNA on the qPCR efficiency was also evaluated. 2. Materials and methods 2.1. Organisms, media and culture conditions All the isolates used in this study are given in Table 1. Fungal strains were maintained by regular subculturing on Potato Dextrose Agar (PDA) (Pronadisa, Madrid, Spain) at 25 + 1 °C for 4–5 days and then stored as spore suspension in 15% glycerol at −80 °C. Fungal strains were cultured for DNA extraction in Erlenmeyer flasks containing 20 ml of Sabouraud Broth (Pronadisa, Madrid, Spain) and incubated at 28 + 1 °C in an orbital shaker (140 rpm) for 3 days. 2.2. DNA extraction DNeasy Plant Mini Kit (Qiagen, Valencia, Spain) was used according to manufacturer's instructions starting from 20 mg of filtered mycelium frozen with liquid nitrogen and grinded using a mortar and pestle. This protocol was also used for DNA extraction from green coffee beans. The yield of the method was evaluated in five independent extractions of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF. In the case of DNA extraction from grapes, 0.33% Polyvinylpyrrolidone (PVP) (Sygma-Aldrich, Steinheim, Germany) was added to AP1 and AP2 buffers. In all cases, purified DNA was eluted from the DNeasy spin column using elution buffer (TE) and optimal results were obtained by eluting twice (2 × 75 µl). DNA concentrations were determined using a NanoDrop® ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA).
163
Table 1 Fungal strains used in this study to validate the quantitative PCR assay designed. Strain
Species
Source
Amplification with OCRAQ1/OCRAQ2
178a 242a⁎ 325a CBS 102.14 CBS 310.80 CBS 614.78 IMI 345568 ITEM 4592 M12hip10a⁎ ITEM 4685 B.Me.A26 CECT 2091 ALHb ALMb CBS 108.08 CBS 624.78 CECT 2092⁎ CECT 2093 CECT 2969 CECT 2970 Cab5dch6 CBS 112812 CBS 112814 CBS 121991 CBS 121993 Bo75⁎ T.TT.A2 ALBb ALDb⁎ ALFb⁎ ALGb CBS 112803 CBS 112791 CBS 121983 CBS 121984 CBS 121986 F4094⁎ FvMM1-2 CECT 2270⁎ CYC 20012 CYC 20013 IMI 311661 CECT 10590 CECT 10113 Pv 1 CECT 1172 CECT 10676 Un 1
Aspergillus carbonarius Aspergillus carbonarius Aspergillus carbonarius Aspergillus elegans Aspergillus elegans Aspergillus elegans Aspergillus elegans Aspergillus flavus Aspergillus flavus Aspergillus japonicus Aspergillus niger Aspergillus niger Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus ochraceus Aspergillus parasiticus Aspergillus steynii Aspergillus steynii Aspergillus steynii Aspergillus steynii Aspergillus tubingensis Aspergillus tubingensis Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Aspergillus westerdijkiae Fusarium thapsinum Fusarium verticillioides Penicillium corylophilum Botrytis cinerea Botrytis cinerea Colletotrichum coffeanum Pichia anomala Pichia membranifaciens Plamopara viticola Saccharomyces cerevisiae Torulaspora delbrueckii Uncinula necator
Grapes, Spain Grapes, Spain Grapes, Spain
– – – – – – – – – – – – + + + + + + + + – – – – – – – + + + + + + + + + – – – – – – – – – – – –
Wheat, France Barley, Spain Grapes, Spain
Coffee, India Coffee, India Coffee, Thailand Coffee, Thailand Grapes, Spain Grapes, Spain
Sorghum, South Africa Coffee, Thailand Coffee, Thailand Coffee, Thailand Laboratory cross Maize, Spain Grapes, Spain Grapes, Spain Coffee, Tanzania Grape Juice, Spain Grapes, Spain Grapes, Spain Orange juice, Spain Grapes, France Grapes, Spain
Last nine strains corresponding to species that cause common fungal grapes or green coffee diseases and yeast that could be present as usual flora. CBS: Centralbureau voor Schimmel Cultures (The Netherlands). CECT: Spanish Type Culture Collection (Spain). CYC: Complutense Yeast Collection (Spain). ITEM: Institute of Sciences of Food Production Culture Collection (Italy). IMI: CABI Genetic Resource Collection (United Kingdom). a Strain supplied by Dr. V. Sanchis (University of Lleida, Spain). b Strains supplied by Dr. L. Niessen (Technische University of München, Germany). ⁎ Fungal strains used to test the specificity of the qPCR assay.
2.3. Primer design
2.4. Conventional PCR amplification
Two specific primers to A. ochraceus and A. westerdijkiae, OCRAQ1 and OCRAQ2 (5'GCACAGCGC TCGCCG 3' and 5'CTGATTGCGATACAATCG 3' respectively) were designed on the basis of sequence alignments of the ITS1 region of several strains from different origins and other related species and genera obtained in our laboratory or retrieved from data bases. A universal pair of primers based in 5.8 S region, 5.8 S1 (5'CGGCATCGATGAA GAACGC 3') and 5.8 S2 (5'CAATGTGCGTTCAAAGACTCG 3'), was designed following the same approach indicated above to test amplification in samples where neither A. ochraceus nor A. westerdijkiae DNA were present.
Specificity of the pair OCRAQ1/OCRAQ2 was tested by conventional PCR in a wide range of isolates shown in Table 1. The assays were performed in an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany). Amplification reactions were carried out in volumes of 25 µL containing 2 µL (5–50 ng) of template DNA, 1 µL of each primer (20 µM), 2.5 µL of 10× PCR buffer, 1 µL of MgCl2 (50 mM), 0.2 µL of dNTPs (100 mM) and 0.15 µL of Taq DNA polymerase (5 U/µL) supplied by the manufacturer (Biotools, Madrid, Spain). All genomic DNAs were tested for suitability for PCR amplification using universal primers ITS1 and ITS4 (White et al., 1990) and the
164
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
protocol described elsewhere (Henry et al., 2000). Specific PCR assays carried out using primers OCRAQ1/OCRAQ2 for A. ochraceus and A. westerdijkiae were performed according to the following protocol: 4 min 30 s at 95 °C, 24 cycles of 30s at 95 °C (denaturalization), 20s at 60 °C (annealing), 35s at 72 °C (extension) and finally 3 min at 72 °C. PCR products were detected in 3% agarose ethidium bromide gels in TAE 1X buffer (Tris-acetate 40 mM and EDTA 1.0 mM). The 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania) was used as molecular size marker. 2.5. Quantitative PCR amplification Quantitative real-time PCR assay was performed and monitored in an ABI PRISM 7900HT system (Applied Biosystems, Madrid, Spain) in the Genomic Unit of the Complutense University of Madrid. The reaction mixture composition in a final volume of 25 µl was: 12.5 µl SYBR® Green PCR Master Mix (Applied Biosystems, Madrid, Spain), 1.2 µl forward primer 5 µM, 1.2 µl reverse primer 5 µM, 5 µl DNA template in suitable concentration and 5.1 µl molecular biology water (MO-BIO, Carlsbad, USA). qPCR assays were carried out using a standard program: 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. All reactions were carried out by duplicate in MicroAmp 96-well plates (Applied Biosystems, Madrid, Spain). 2.6. Standard curve Ten-fold serial dilutions of DNA from CECT 2092 strain (from 50 to 5 × 10− 3 ng/µl) were used as template in the reactions. Ct values were plotted against the logarithm of starting quantity of template for each dilution. Then, amplification efficiency was calculated from the slope of the standard curve (Kubista et al., 2006). E = 10
− 1 = slope
% Efficiency = ðE − 1Þ × 100
ð1Þ
Table 2 qPCR analyses of samples containing DNA of two or more fungal species at different proportions. DNA mix
Ratio
Ct value
DNA concentration (ng/µl)
A A. A. A. A. A. A. A. A. A. A. A.
100 50:50 50:50 50:50 25:75 50:50 75:25 50:50 25:75 100 33:33:33
21.33 ± 0.20 22.75 ± 0.10 22.82 ± 0.04 22.76 ± 0.09 23.57 ± 0.21 22.86 ± 0.01 22.32 ± 0.13 22.76 ± 0.06 23.25 ± 0.08 30.61 ± 0.04 23.50 ± 0.08
0.078 0.031 0.029 0.030 0.018 0.028 0.041 0.030 0.022 0 0.019
50:50
30.50 ± 0.28 0
100 50:50 50:50 50:50 25:75 50:50 75:25 50:50 25:75 100 33:33:33 50:50
20.45 ± 0.02 21.22 ± 0.00 21.57 ± 0.10 21.65 ± 0.13 22.92 ± 0.02 21.42 ± 0.07 21.15 ± 0.01 21.85 ± 0.00 23.00 ± 0.03 34.34 ± 0.11 22.47 ± 0.25 32.94 ± 0.14
westerdijkiae westerdijkiae P. corylophilum westerdijkiae Fusarium sp. westerdijkiae A. flavus westerdijkiae A. flavus westerdijkiae A. tubingensis westerdijkiae A. tubingensis westerdijkiae A. carbonarius westerdijkiae A. carbonarius tubingensis westerdijkiae A. tubingensis A. carbonarius P. corylophilum Fusarium sp. B A. ochraceus A. ochraceus P. corylophilum A. ochraceus Fusarium sp. A. ochraceus A. flavus A. ochraceus A. flavus A. ochraceus A. tubingensis A. ochraceus A. tubingensis A. ochraceus A. carbonarius A. ochraceus A. carbonarius A. tubingensis A. ochraceus A. tubingensis A. carbonarius P. corylophilum Fusarium sp.
0.140 0.084 0.067 0.063 0.027 0.073 0.088 0.055 0.026 0 0.037 0
A) Assay with mixes containing A. westerdijkiae DNA. B) Assay with mixes containing A. ochraceus DNA. Ct values obtained in qPCR assays are shown as mean ± standard deviation of the reaction duplicates. DNA concentration was determined by interpolating from the standard curve.
ð2Þ
Additionally, different serial dilutions of fungal DNAs extracted from pure culture were evaluated to determine detection limits of the qPCR assay. 2.7. Specificity of qPCR reactions The exclusive binding of SYBR Green® to the amplicons derived from specific reactions was tested by analyzing the melting curve performed after the qPCR program. The protocol was as follows: 15 s at 95 °C, 15 s at 60 °C and 20 min slow ramp between 60 and 95 °C after the qPCR program. The specificity of the pair OCRAQ1/OCRAQ2 to detect A. ochraceus and A. westerdijkiae strains was also tested in qPCR assays using genomic DNA from closely related species and genera that usually contaminate the same products (Table 2). The samples analyzed containing different proportion of DNA from these species and A. westerdijkiae ALD (Table 2A) or A. ochraceus CECT 2092 (Table 2B). Both groups of mixtures were evaluated independently. Ct values obtained were interpolated from the standard curve to calculate initial DNA concentration. Reactions with primer set 5.8S1/5.8S2 were also carried out to test the suitability of genomic DNAs for amplification. 2.8. Evaluation of qPCR inhibition by host DNA Genomic DNA from 5 DNA independent extractions of pure cultures of A. ochraceus CECT 2092 and A. westerdijkiae ALD and ALF were evaluated in qPCR assays using 1:1 dilutions with TE buffer, DNA of uncontaminated grapes (5 ng/µl) and DNA of uncontaminated green coffee beans (5 ng/µl). Ct values were compared to evaluate inhibition using statistical software SPSS 14.0. Corresponding Student t-test was applied with a level of significance p b 0.05.
2.9. Fungal detection in artificially contaminated samples Green coffee beans (Coffea arabica L., Brazil) and grape berries (Vitis vinifera L., var Vinalopo, Spain) were decontaminated by immersion in ethanol (70%) and, subsequently, 2 g were inoculated with 1 ml of spore suspensions at concentrations 102, 104 and 106 spores/ml (low, medium and high concentration respectively) from CECT 2092, ALD and ALF strains. Fungal conidia suspensions were prepared from a sporulating culture (7 day-old) on Rose Bengale Chloramphenicol Agar (Pronadisa, Madrid, Spain) and filtered through Whatman N°1 paper. Concentrations were measured by microscopy using a Thomas counting chamber and spore suspensions were diluted when necessary. Inoculated samples were incubated at 28 °C for 0, 8, 16 and 24 h before genomic DNA extraction. As negative control, 2 g of grapes or green coffee beans were mock inoculated with 1 ml of sterile saline solution and incubated following the same protocol. 3. Results 3.1. Specificity and sensibility of the qPCR assay designed The specificity of the primers OCRAQ1 and OCRAQ2 was studied by conventional PCR in a number of A. ochraceus and A. westerdijkiae strains from different sources as well as in closely related species or which frequently occur in the same food matrices (Table 1). A single fragment of about 75 bp was amplified when genomic DNA from A. ochraceus or A. westerdijkiae was used. No product was observed with genomic DNA from isolates of the other species tested. The standard curve generated with the pair OCRAQ1/OCRAQ2 in the conditions described above is shown in Fig. 1. Linearity was observed across all the range used and the very high correlation
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
165
Fig. 1. Standard curve generated from the amplification of ten-fold dilutions from target genomic DNA from CECT 2092. This curve revealed strong linear relationship (R2 = 0.998) between the decimal logarithm of the starting DNA concentration and the threshold cycle.
coefficient (R2 = 0.998) indicated very low inter-assays variability. The slope of the standard curve was −3.47 which corresponded to an amplification efficiency of 94%. NTC (non target control) value was 31.27. Different serial dilutions of DNA obtained from pure culture were evaluated in qPCR reactions to determine the lowest amount of target DNA detected by the qPCR protocol developed. The lowest DNA target concentration was 0.5 pg/µl, which corresponded to 2.5 pg/reaction. The derivative melting curve generated showed a single peak indicating that a single amplicon was generated by qPCR and primerdimers did not occur (data not shown). The results of samples with different relative contents of fungal DNA evaluated by qPCR are shown in Table 2. DNA samples containing neither A. ochraceus nor A. westerdijkiae DNA were not amplified with OCRAQ1/OCRAQ2 primer set. qPCR values were in agreement with the relative amount of initial DNA of A. ochraceus or A. westerdijkiae in the sample. Positive amplification with the pair 5.8S1/5.8S2 was observed in all samples analyzed. 3.2. DNA extraction protocol The efficiency of the DNA extraction protocol used was evaluated. DNA concentration values obtained using the NanoDrop spectrophotometer ranged from 5 and 81 ng/µl. All independent DNA extractions were subsequently analyzed by qPCR and the Ct values were interpolated from the standard curve obtaining values between 2 and 71 ng/µl. 3.3. Evaluation of qPCR inhibition by host DNA The results of evaluation of PCR inhibition by host DNA are shown in Table 3. Ct values obtained did not show significant differences (p N 0.05) between control assays (A. ochraceus or A. westerdijkiae DNA diluted in TE) and reactions containing fungal DNA and DNA from either green coffee beans or grape berries.
3.4. Fungal detection and quantification in artificially contaminated samples A. ochraceus and A. westerdijkiae detection in artificially contaminated food matrices after different times of incubation are shown in Fig. 2. When grapes (Fig. 2A) or green coffee beans (Fig. 2B) were inoculated with a suspension 106 spores/ml, target fungal DNA was detected even without incubation showing higher sensitivity on green coffee than on grapes. Intermediate values of spore concentration did reveal the occurrence of A. ochraceus or A. westerdijkiae after 16 h of incubation in green coffee beans and after 24 h in grapes. None of these species was detected by qPCR in samples inoculated with a low concentrated spore suspension (102 spores/ml). No detectable signal was observed in negative control grapes or coffee beans mockinoculated with saline solution. 4. Discussion In this work, a specific and sensitive protocol was developed to detect and quantify A. ochraceus and A. westerdijkiae contamination in grapes and green coffee beans by qPCR. Optimization of a qPCR assay is very important, mainly when SYBR Green dye is used. The analysis of the melting curve and the parameters calculated from the standard curve showed that the
Table 3 Evaluation of qPCR inhibition by host DNA. Ct values Fungal DNA
Fungal ± coffee DNA Fungal ± grape DNA
A. ochraceus CECT 2092 13.13 ± 0.36 13.09 ± 0.48 A. westerdijkiae ALD 16.39 ± 2.38 16.29 ± 2.21 ALF 15.11 ± 1.21 15.14 ± 1.84
13.77 ± 1.12 17.87 ± 2.50 15.59 ± 2.23
The mean of Ct values of the five independent extractions of each strain are shown (mean ± standard deviation). Differences among results were not statistically significant when fungal DNA was analysed alone or with coffee or grape DNA (p N 0.05).
166
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
Fig. 2. Fungal DNA detection by qPCR of inoculated grape berries (A) and green coffee beans (B). Each value corresponds to the mean of the results of the three strains at different incubation times (0, 8, 16 and 24 h) and spore concentration: 102 (grey), 104 (black) and 106 (dotted). Under no circumstances, controls with saline solution gave a detectable signal in the qPCR assay with OCRAQ1/OCRAQ2 pair of primers.
method designed was highly optimized. The efficiency obtained (94%) and the high R2 coefficient are considered good indicators of a robust and reproducible assay and the melting curve showed that only one fragment was amplified and primer-dimers did not form. The ITS1-5.8S-ITS2 region within the rDNA unit is frequently used to discriminate at the species level (Edwards et al., 2002). Conventional PCR assays have demonstrated the specificity of the pair of primers OCRAQ1/OCRAQ2 in a wide representation of A. ochraceus and A. westerdijkiae strains, related and other species causing grape and coffee diseases or those frequently present in the same substrates.
The alignment of ITS1-5.8S-ITS2 region of several strains of A. ochraceus and A. westerdijkiae performed revealed differences in few bases. This allowed development of a single assay to detect both species, being the most important OTA-producing species in terms of relative amounts of OTA produced (Frisvad et al., 2004). On the other hand, the use of ITS regions to develop specific primers instead of single copy genes (either constitutive or toxin biosynthetic genes) enhances the sensitivity of the assay due to its multi-copy character (Suarez et al., 2005). A previous qPCR assay targeting genes involved in OTA synthesis to detect A. ochraceus could detect up to 4.7 pg per
J. Gil-Serna et al. / International Journal of Food Microbiology 131 (2009) 162–167
reaction (Schmidt et al., 2004) and, in this work, the lowest detection limit achieved was 2.5 pg per reaction. Currently, several authors prefer to express sensitivity of qPCR method in number of haploid genomes detected (Mulè et al., 2006; Selma et al., 2008). Nevertheless, it was not possible in our case because genomic size of these species is not known yet. Since the applicability of a qPCR protocol can be seriously compromised by the food matrix (Hanna et al., 2005), we have tested several rapid and easy DNA extraction protocols which could result in efficient removal of matrix compounds which might inhibit qPCR reaction. DNeasy Plant Mini Kit yielded good quality DNA obtained either from fungal pure culture or green coffee beans and suitable for qPCR. The protocol was further improved to be used for grapes, because efficiency was considerably lower than in coffee beans (data not shown), probably due to phenolic compounds present in the grape juice which can inhibit qPCR (Wilson, 1997). Addition of PVP in the corresponding steps, as indicated above, improved the qPCR assay to achieve quantification values closer to those obtained for coffee beans. Once these protocols were optimized, the sensitivity of the qPCR assay was tested in grapes and green coffee beans artificially contaminated with known concentrations of spore suspensions. When a highly concentrated spore suspension (106 spores/ml) was used, a detectable fluorescent signal was obtained even without incubation. DNA extraction from spores is more difficult because of their strong cell wall but when fungi occur in food products, they normally exist as hyphal structures so the method could detect lower levels of contamination without incubation. This assay was useful not only to detect these species but also to quantify them. Concentration values obtained by qPCR in samples with different ratios of fungal DNA were related with the initial amounts of A. westerdijkiae and A. ochraceus DNA. Moreover, the application of the method to quantify these fungi in artificially contaminated matrices was confirmed and detection was increased at longer times of incubation both in grapes and green coffee beans. The possibility to quantify contamination levels in food matrices is essential because previous studies have demonstrated that levels of ochratoxigenic fungi can be related with OTA concentration that exceed legal limits (Lund and Frisvad, 2003). In conclusion, we describe an integrated qPCR method to detect and quantify A. ochraceus and A. westerdijkiae in grapes and green coffee beans. This method was rapid, specific and the sensitivity achieved higher than previously reported protocols, providing a useful tool for early detection of A. ochraceus and A. westerdijkiae and prediction of OTA contamination in commodities susceptible to be colonized by these species. Acknowledgments This work was supported by the Spanish Ministry of Science and Innovation (AGL 2007-66416-C05-02/ALI) and by the UCM-CM (CCG07-UCM/AGR-2612). J. Gil-Serna was supported by a FPU fellowship by the Spanish Ministry of Science and Innovation. References Atoui, A., Mathieu, F., Lebrihi, A., 2007. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR. International Journal of Food Microbiology 115, 313–318.
167
Commission Regulation, 2006. EC No 1881/2006 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union, Brussels. Dao, H.P., Mathieu, F., Lebrihi, A., 2005. Two primer pairs to detect OTA producers by PCR method. International Journal of Food Microbiology 104, 61–67. Edwards, S.G., O, 'Callaghan, J., Dobson, D.W., 2002. PCR-based detection and quantification of mycotoxigenic fungi. Mycological Research 106, 1005–1025. Frisvad, J.C., Frank, J.M., Houbraken, J.A.M.P., Kuijpers, A.F.A., Samson, R.A., 2004. New ochratoxin A producing species of Aspergillus section Circumdati. Studies in Mycology 50, 23–43. Hanna, S.E., Connor, C.J., Wang, H.H., 2005. Real-time polymerase chain reaction for the food microbiologist: technologies, applications, and limitations. Journal of Food Science 70, R49–R53. Henry, T., Iwen, P.C., Hinrichs, S.H., 2000. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 510–1515. IARC, 1993. IARC Vol. 56: some naturally occurring substances: some food items and constituents, heterocyclic aromatic amines and mycotoxins. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans 56. Kubista, M., Andrade, J.M., Bengtsoon, M., Forootan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27, 95–125. Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A. Journal of Applied Microbiology 95, 1117–1123. Mackay, I.M., Mackay, J.F., Nissen, M.D., Sloots, T.P., 2007. Real-time PCR: history and fluorogenic chemistries. In: Mackay, I.M. (Ed.), Real-Time PCR in Microbiology: From Diagnosis to Characterization. Horizon Scientific Press, Norfolk, pp. 1–40. Magnoli, C.E., Astoreca, A.L., Chiacchiera, S.M., Dalcero, A.M., 2007. Ocurrence of ochratoxin A and ochratoxigenic mycoflora in corn and corn based foods and feeds in some South American countries. Mycopathologia 163, 249–260. Morello, L.G., Sartori, D., De Oliveira Martinez, A.L., Vieira, M.L.C., Taniwaki, M.H., Fungaro, M.H.P., 2007. Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of β-tubulin gene by using real-time PCR. International Journal of Food Microbiology 119, 270–276. Mulè, G., Susca, A., Logrieco, A., Stea, G., Visconti, A., 2006. Development of a real-time PCR assay for the detection of Aspergillus carbonarius in grapes. International Journal of Food Microbiology 111, S28–S34. Niessen, L., Schmidt, H., Mühlencoert, E., Färber, P., Karolewiez, A., Geisen, R., 2005. Advances in the molecular diagnosis of ochratoxin A-producing fungi. Food Additives and Contaminants 22, 324–334. Pfohl-Leszkowicz, A., Manderville, R.A., 2007. Ochratoxin A: an overview on toxicity and carcinogenicity in animals and humans. Molecular Nutrition & Food Research 51, 61–99. Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245, 154–160. Rizzo, A., Eskola, M., Atroshi, F., 2002. Ochratoxin A in cereals, foodstuffs and human plasma. European Journal of Plant Pathology 108, 631–637. Samson, R.A., Hong, S.B., Frisvad, J.C., 2006. Old and new concepts of species differentiation in Aspergillus. Medical Mycology 44, S133–S148. Schmidt, H., Bannier, M., Vogel, R.F., Niessen, L., 2004. Detection and quantification of Aspergillus ochraceus in green coffee by PCR. Letters in Applied Microbiology 38, 464–469. Selma, M.V., Martínez-Culebras, P.V., Aznar, R., 2008. Real-time PCR based procedures for detection and quantification of Aspergillus carbonarius in wine grapes. International Journal of Food Microbiology 122, 126–134. Suarez, M.B., Walsh, K., Boonham, N., O'Neill, T., Pearson, S., Baker, I., 2005. Development of a real-time PCR (TaqMan®) assays for the detection and quantification of Botrytis cinerea in planta. Plant Physiology and Biochemistry 43, 890–899. Taniwaki, M.H., Pitt, J.I., Teixeira, A.A., Iamanaka, B.T., 2003. The source of ochratoxin A in Brazilian coffee and its formation in relation to processing methods. International Journal of Food Microbiology 82, 173–179. Van der Merwe, K.J., Steyn, P.S., Fourie, L., 1965. Ochratoxin A, a toxic metabolite produced by Aspergillus ochraceus Wilh. Nature 205, 1112–1113. Varga, J., Kozakiewicz, Z., 2006. Ochratoxin A in grapes and grape-derived products. Trends in Food Science & Technology 17, 72–81. White, T.J., Burns, T., Lee, S., Taylor, J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelgard, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR protocols: a guide to methods and applications. Academic Press, New York, pp. 315–322. Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology 63, 3741–3751. Zinedine, A., Soriano, J.M., Juan, C., Mojemmi, B., Molto, J.C., Bouklouze, A., Cherrah, Y., Idrissi, L., El Aouad, R., Manes, J., 2007. Incidence of ochratoxin A in rice and dried fruits from Rabat and Salé area, Morocco. Food Additives and Contaminants 24, 285–291.