Ivermectin biotransformation and impact on transcriptome in Arabidopsis thaliana

Chemosphere 234 (2019) 528e535

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Ivermectin biotransformation and impact on transcriptome in Arabidopsis thaliana  a, b, P
remysl Landa b, Martina Navra tilova  a, Lucie Raisova  Stuchlíkova  a, Eli
ska Syslova lova  a, Barbora Szota kova  a, Toma 
s Vane
k b,  a, Lenka Ska Petra Matou
skova b , *  Radka Podlipna a lov lov Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Kra e, Charles University, Heyrovsk eho 1203, 500 05, Hradec Kra e, Czech Republic b  313, 165 02, Lysolaje, Praha 6, Czech Republic Laboratory of Plant Biotechnologies, Institute of Experimental Botany, Czech Academy of Science, Rozvojova

h i g h l i g h t s

g r a p h i c a l a b s t r a c t


Ivermectin was up-taken by roots of Arabidopsis thaliana and translocated to rosette.
Six ivermectin metabolites were detected in roots, the metabolites were formed only via hydroxylation and demethylation.
Ivermectin in roots dysregulated significantly transcription of 236 and 114 genes after 24 and 72 h exposure.
Higher number of transcripts was dysregulated in the rosettes (300 and 438 genes after 24 and 72 h exposure).
The results indicate the possible negative impact of ivermectin on plant physiology.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 March 2019 Received in revised form 10 June 2019 Accepted 12 June 2019 Available online 13 June 2019

Veterinary drugs enter the environment in many ways and may affect non-target organisms, including plants. The present project was focused on the biotransformation of ivermectin (IVM), one of the mostly used anthelmintics, in the model plant Arabidopsis thaliana. Our results certified the ability of plants to uptake IVM by roots and translocate it to the aboveground parts. Using UHPLC-MS/MS, six metabolites in roots and only the parent drug in rosettes were found after 24- and 72-h incubation of A. thaliana with IVM. The metabolites were formed only via hydroxylation and demethylation, with no IVM conjugates detected. Although IVM did not induce changes in the activity of antioxidant enzymes in A. thaliana rosettes, the expression of genes was significantly affected. Surprisingly, a higher number of transcripts, 300 and 438, respectively, was dysregulated in the rosettes than in roots. The significantly affected genes

Handling Editor: A. Gies

* Corresponding author. Laboratory of Plant Biotechnologies, Institute of Experimental Botany, Czech Academy of Science, Rozvojov a 313, Lysolaje, Praha 6, CZ16502, Czech Republic. E-mail addresses: [email protected] (E. Syslov a), [email protected] (P. Landa), tilova ), [email protected] (M. Navra [email protected] ), [email protected] (P. Matou
skov (L.R. Stuchlíkova a), [email protected] ), [email protected] (B. Szota kova ), [email protected] (T. Vane
k), (L. Sk alova ). [email protected] (R. Podlipna https://doi.org/10.1016/j.chemosphere.2019.06.102 0045-6535/© 2019 Elsevier Ltd. All rights reserved.

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

Keywords: Veterinary drug Ivermectin Metabolites Transcriptomic response Arabidopsis thaliana

529

play role in response to salt, osmotic and water deprivation stress, in response to pathogens and in ion homeostasis. We hypothesize that the above described changes in gene transcription in A. thaliana resulted from disrupted ionic homeostasis caused by certain ionophore properties of IVM. Our results underlined the negative impact of IVM presence in the environment. © 2019 Elsevier Ltd. All rights reserved.

1. Introduction A number of emerging pollutants have raised great concern in the past decades. Veterinary pharmaceuticals are nowadays indispensable in agriculture and livestock farming; however, their increased application over the last few years has raised concerns about their potential biological and environmental risks, warranting optimization and safety assessment considerations. Veterinary drugs occur ubiquitously in manure and via manure application finally reach the soil compartment (Scheffczyk et al., 2016; Wohde et al., 2016). The environmental impact of these substances depends on many factors including the physicochemical properties of the substance; the extent of degradation in manure, slurry, soil, or water; the propensity to partition to soil and sediment; and the characteristics of the receiving environment (Boxall et al., 2003; McKellar, 1997). Ivermectin (IVM; Fig. 1), is the most common anti-parasitic drug used in farm animals at many regions of the world because it is both relatively inexpensive and highly effective against nematodes and arthropods (Lumaret et al., 2012). IVM is a semisynthetic derivative of avermectin, a macrocyclic lactone produced by Streptomyces avermitilis. It is a highly lipophilic substance that dissolves in many organic solvents, but is almost insoluble in water. For this reason IVM is quickly transported across the cell membrane. IVM binds to glutamate-gated chloride channels in the membranes of invertebrate nerve and muscle cells, causing increased permeability to chloride ions, resulting in cellular hyper-polarization, followed by paralysis and death of helminth (Didier and Loor, 1996). The pharmacokinetics of IVM significantly differ depending on the organism affected (Beynon, 2012), but generally the metabolism of IVM is only moderate and 62e98% of this drug is excreted unmetabolized in the feces. In the environment, IVM moves from feces to the underlying soil, where is relatively persistent with a reported half-life of one week to several months which further increases its environmental risk (Horvat et al., 2012; Iglesias et al.,

2006, 2011, 2018; Sutton et al., 2014). Residues of IVM show insecticidal activity, with effects on the survival, reproduction, and development of non-target organisms in soil, especially the larval forms of some dung-associated insects such as dung beetles (Halley et al., 1993). In the last few years it has been proven that the negative effects of direct IVM exposure on dung-degrading organisms could extend across generations (Baena-Diaz et al., 2018). Moreover, Mesa et al. (2018), reported that IVM at environmentally reached concentrations caused the complete mortality of the invertebrates Ceriodaphnia dubia and Hyalella curvispina. While the toxicity of IVM has been extensively investigated in microorganisms, animals and human cells, the phytotoxicity of IVM remains relatively unexplored (Liebig et al., 2010), although plants are also in frequent contact with IVM. Partitioned between soil particles, interstitial water and air, IVM and its metabolites are taken in by plants from water or air phases. With respect to the hydrophobicity of IVM, the large lipid covered surface of leaves also provide a sink for its accumulation (Iglesias et al., 2018). A high accumulation of IVM in the roots of Salvinia biloba was reported (Mesa et al., 2017). Nevertheless, information about the further fate of IVM in plant organisms and its impact on plants is lacking. To fill this gap, the present study sought to describe the biotransformation pathways of IVM and the transcriptomic response to IVM presence in the plant organism. Arabidopsis thaliana, a popular plant model organism, was used for this purpose. Knowledge regarding biotransformation products are important for the evaluation of their toxicity and stability in other living organisms eating plants exposed to IVM. The IVM-induced changes in plant transcriptome reflect the negative impact of IVM on plant physiology. Both sets of results might show further ecotoxicological risks of IVM in the environment.

2. Materials and methods 2.1. Chemicals and reagents All chemicals used were purchased from Sigma-Aldrich (Prague, Czech Republic).

2.2. Cultivation of plants

Fig. 1. Chemical formula of ivermectin, C48H74O14.

Hydroponic cultures of A. thaliana were grown in liquid 25% Hoagland's medium (Hoagland, 1920), pH 6.2e6.3, in short days: 8/ 16 h, at 21  C and 75% air humidity. The plants were stressed with 5 mM of IVM (pre-dissolved in DMSO). The control plants were treated only with DMSO at a corresponding concentration (100 ml/l medium). The effect was studied after 24 and 72 h of stress. Roots and rosettes were harvested separately. For the metabolomic analysis, the plant tissues were lyophilized. For enzyme assays, the fresh tissues were immediately put in liquid nitrogen. For RNA analysis, the fresh tissues were collected in tubes with TriReagen solution and these samples were immediately frozen in liquid nitrogen. All the samples were prepared in quadruplicate and stored in freezer (80  C).

530

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

2.3. Metabolomic analysis The sample preparation, extraction and analytical method for UHPLC-MS/MS analysis has been described previously by Podlipn a et al. (2013), but for the IVM analyte the method underwent minor modification. For the UHPLC conditions, flow rate was 0.3 ml/min and the mobile phase consisted of 5 mM ammonium acetate adjusted to pH 6.5 (A) and acetonitrile (B). The linear gradient was as follows: 0 mine15% B, 15 mine95% B, 17 mine95% B followed by 1 min of isocratic elution. For the QqQ mass spectrometer, ESI mass spectra were recorded in the range of m/z 50e1000 in positive-ion mode. The relative peaks area of metabolites were integrated using the internal standard doramectin. 2.4. Assays of enzyme activities The plants were cultivated with or without 5 mM IVM for 1- and 3-days. IVM was pre-dissolved in DMSO; concentration of DMSO in medium was 0.1%. The control plants were grown in medium with 0.1% DMSO. At the end of cultivation, the rosettes (1 g) were frozen in liquid nitrogen, then homogenized in liquid nitrogen, extracted in 5 ml of extraction buffer (50 mM KH2PO4; pH 7, 0.1 mM EDTA, 1% PVP K 30, 0.5% Triton-X 100) and centrifuged (14,000 g, 10min, 4  C). Protein content was determined (Bradford, 1976) and the supernatant was used for the subsequent enzyme assays. Peroxidase (POX) was assayed as described by (Drotar et al., 1985). Catalase (CAT) activity was determined spectrophotometrically by measuring the rate of H2O2 decrease at 240 nm (Verma and Dubey, 2003). Ascorbate peroxidase (APX) activity was assayed as described by (Vanacker et al., 1998). Glutathione S-transferase (GST) activity was determined using 1-chloro-2,4-dinitrobenzene as a substrate (Habig et al., 1974). 2.5. Statistical analysis Data were processed using the data analysis software STATISTICA.CZ version 12.0 (StatSoft, Prague, Czech Republic). Each treatment was represented by a minimum of three biological replicates. The normal distribution of the data was tested using the Shapiro-Wilk test. Following ANOVA, a post hoc Tukey test was performed for multiple pairwise comparisons. 2.6. Microarray analysis Agilent-based microarrays were used for general expression at the transcriptional level. RNA was isolated from the roots and rosettes of A. thaliana using the Plant RNA isolation Mini Kit (Agilent Technologies, CA, USA). The RNA was then labeled using Cyanine 5CTP and Cyanine 3-CTP using the Low Input Quick AMP Labeling Kit (Agilent Technologies, CA, USA). The RNA was purified by the RNeasy Mini Kit (Qiagen, Germany). The samples were hybridized to the Arabidopsis (V4) Gene Expression Microarray Chip (Agilent Technologies, CA, USA). The RNA extracted from roots and rosettes from four individual plants for each exposure was used for hybridization (four biological replicates for each time and plant part). After the hybridization (17 h, 65  C), the slides were washed with GE Wash Buffers (Agilent Technologies, CA), Stabilization and Drying Solution (Agilent Technologies, CA, USA) and acetonitrile. The microarrays were scanned using the GenePix 4000B scanner, with the entire process controlled by GenePix Pro Microarray Analysis Software (Molecular Devices, CA, USA). Then the data were processed in the R scripting environment using the LIMMA software package (Smyth and Speed, 2003; Smyth et al., 2005). The LOESS normalization method was used to balance the mean fluorescence intensity between red and green channels in each field.

The Aquantile method was used to normalize signals between fields. Annotations for the up- and down-regulated genes were downloaded from the TAIR database (Lamesch et al., 2012). Classification of genes in the respective categories was calculated using the Classification Super-Viewer (Provart et al., 2003). 2.7. Quantitative real-time PCR analysis The same RNA samples were used for further reverse transcription and quantitative real-time PCR (qPCR), to confirm the transcript levels of the selected genes obtained from the microarray analysis. The first-strand cDNA was synthesized from 1 mg RNA template in 20 ml reactions with random hexamer primers and Protoscript II reverse transcriptase (NEB, UK) according the manufacturer's supplied protocol. All cDNA was diluted 5 times with nuclease-free water and stored at 20  C for later use. Primers sets were designed, checked for hairpin structures, and synthetized according to the methodology described previously by (Syslova et al., 2019). The specificity and efficiency of the primers for reference and target genes were tested under the same reaction conditions as was the entire qPCR assay. The primer sequences, amplicon length, and efficiency are listed in Table 1. qPCR analyses were performed using the QuantStudio 6 instrument (Applied Biosystems, USA) using EvaGreen© detection dye in a final volume of 20 ml. The reaction mix contained qPCR GreenMaster lowROX (Jena Bioscience, Germany), primers sets (final concentration 100 nM), and 5 ml of cDNA (equivalent of 50 ng RNA). The same PCR steps with the same reaction conditions were followed as described previously (Syslova et al., 2019). Relative expression levels of the target genes were computed using the DDCt method (Livak and Schmittgen, 2001) using the GTP binding Elongation factor (EF) and TIP41-like family protein (TIP) as reference genes for normalization. EF and TIP were selected because of the high stability in leaves samples founded in a preliminary study (data not shown). 3. Results 3.1. Biotransformation of IVM in A. thaliana Hydroponic cultures of A. thaliana were cultivated in medium with 5 mM IVM (pre-dissolved in DMSO) for 24 and 72 h. The roots and rosettes were collected, processed, extracted and consequently analysed using the UHPLC-MS/MS technique. Two blank samples, biological (drug-free cultivation medium with DMSO) and chemical (plant-free cultivation medium with IVM) were prepared and measured as well. The amount of each metabolite was semiquantified using a ratio between the peak area of the metabolite and the peak area of internal standard (IS). The peak area was normalized to 1 g of the plant samples. The detected metabolites were identified based on the presence of protonated molecules with the ammonium adducts [M þ NH4]þ in positive ion mode. Six metabolites (M1-M6) in the roots and only the parent drug in the rosettes were found in A. thaliana incubated for 24- and 72-h with IVM. The parent drug IVM was detected at m/ z 892 [M þ NH4]þ (tR ¼ 13.90 min). In A. thaliana, only the Phase I (reactions unmasking or introducing functional groups, i.e. oxidation, reduction, hydrolysis) metabolites of IVM formed via hydroxylation and demethylation were found. Phase II (conjugation with endogenous hydrophilic compounds) metabolites of IVM were not observed. Semi-quantitative analysis showed M3 metabolite, formed via hydroxylation, as the major IVM metabolite in A. thaliana in both parts of plant. The molecular weight, retention time and fragmentation ions of all identified metabolites are shown in Table 2.

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

531

Table 1 Primers used for quantitative real-time PCR. Gene name

Accession number

Direction

Primer sequence

Amplicon size (bp)

Efficiency (%)

CRF2

NM_202870.1

96

NM_102188.3

93

91

SIS

NM_180421.1

100

93

UGT84A2

NM_113051.3

77

100

FSD1

NM_001203905

61

99

DIN2

NM_001340024.1

110

99

PRX52

NM_120616

65

92

EF

NM_125432

76

100

TIPa

NM_119592

GCTCAGTGGTTCCCGACTAT CGCCGTGAATAGATCTTCCC CGGATCTATGCCTGAGACGT ATATCTCCCACCGCGTTCAA GCAGGATCAGAGAGTACAACC CGTAGAGTTGCTGGTGGAATTT CGTTCTTGTGGGTGATTAGACA CCCTTTAACTTCTTCCGGCA CCGCAAACTACGTCCTCAAG GCTCATATGCGGCTCCAAAG ATCGGACCTGGGGAAGAAAG TCTTTGATGTAGACTGGCATGT CCATTGCTGCTAGAGACTCC TCTTCCTACTTTCACATTCCAGT TGAGCACGCTCTTCTTGCTTTCA GGTGGTGGCATCCATCTTGTTACA GTGAAAACTGTTGGAGAGAAGCAA TCAACTGGATACCCTTTCGCA

59

AT1G23390

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

61

100

a

Adopted from (Czechowski et al., 2005).

Table 2 Description of the metabolites of IVM present in A. thaliana detected by UHPLC-MS/MS. tR [min]

MW

[M þ NH4]þ

Elemental composition

Metabolic reaction

Fragment ions of [M þ NH4]þ, m/z

Metabolite designation

11.75 12.43 12.66 13.05 13.27 13.54 13.90

860 890 860 890 890 890 874

878 908 878 908 908 908 892

C47H72O14 C48H74O15 C47H72O14 C48H74O15 C48H74O15 C48H74O15 C48H74O14

demethylation hydroxylation demethylation hydroxylation hydroxylation hydroxylation -

307 551 307 567 307 551 307 567 307 567 307 567 137 307 51

M1 M2 M3 M4 M5 M6 IVM

3.2. Physiological response of A. thaliana to IVM The plants exposed to IVM showed no visible signs of damage, i.e. no changes in rosettes color, no wilting of rosettes, the similar growth and mass of tissues. Also the activities of the main antioxidant enzymes peroxidase (POX), catalase (CAT), ascorbate peroxidase (APX) and glutathione S-transferases (GST) assayed in rosettes were not significantly changed (p < 0.05) in comparison to the control (Table 3).

3.3. Transcriptomic response of A. thaliana to IVM

rosettes. A higher number of genes was down-regulated than upregulated in all transcription profiles except the roots after 72 h exposure. Numbers of up- and down-regulated genes and overlaps between time points and plant parts are shown in Fig. 2. The complete list of genes up- and down-regulated in both time points and plant parts are stated in Suppl. Table S1. The analysis of IVM-induced changes in A. thaliana transcriptome showed that the genes with dysregulated expression belong to proteins involved in drug metabolism; in response to salt, osmotic and water deprivation stress; in response to pathogens; and in ion homeostasis. The genes involved in response to stress and to abiotic or biotic stimuli were among the most influenced gene groups by IVM at both time points and in both plant parts.

a) Microarray-based expression profiling b) Validation of the microarray results The IVM-induced changes in transcriptome were analyzed in the roots and rosettes of A. thaliana. IVM in 5 mM concentration dysregulated the transcription of 236 and 114 genes (p value < 0.05; fold change > 2) in the roots after 24 and 72 h exposure, respectively. Surprisingly, a higher number of transcripts (300 and 438 after 24 and 72 h exposure, respectively) was dysregulated in the

Table 3 The specific activities of antioxidant enzymes peroxidase (POX), catalase (CAT), ascorbate peroxidase (APX) and glutathione S- transferases (GST) in rosettes after 24-h and 72-h exposition to IVM. The data, expressed as percentage of controls (¼ 100%), represent the mean ± S.D. (n ¼ 6). Specific activity (%)

24h

72h

GST APX CAT POX

122 ± 14 95 ± 9 99 ± 11 105 ± 41

121 ± 10 91 ± 19 81 ± 9 94 ± 23

Gene expression levels measured by microarray analyses were validated by qPCR. Based on the microarray results, seven representative genes identified as down-regulated or up-regulated were selected to assess the differential expression levels by qPCR in the 24 h and 72 h rosette and root samples. The fold change of relative expression levels of down-regulated and up-regulated control transcripts after 24 and 72 h stress of IVM were compared between microarray and qPCR. Tables 4 and 5 show that the data obtained by the qPCR coincide quite well with data obtained by microarrays. A mild dissimilarity in fold change values are based on the different sensitivity in each method. 4. Discussion The first aim of the present study was to describe the biotransformation pathways of IVM in A. thaliana, a plant widely

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

532

Fig. 2. Number of up- and down-regulated genes in leaf rosettes and roots after 24 and 72 h exposure to ivermectin.

Table 4 Validation of the microarray transcription profile by quantitative real-time PCR for selected genes in rosettes. * means significantly dysregulated genes. Annotation

24h rosette samples

Gene name AT1G23390 CRF2 SIS UGT84A2

72h rosette samples

Microarray fold change (log2) qPCR fold change (log2) Microarray fold change (log2) qPCR fold change (log2) Kelch repeat-containing F-box Cytokinin response factor 2 E3 ubiquitin-protein ligase RLIM-like protein UDP-glycosyltransferase

2.62 ± 0.27* 2.00 ± 0.28* 1.92 ± 0.27* 1.22 ± 0.15

3.47 ± 0.47* 2.11 ± 0.75* 3.03 ± 0.70* 1.21 ± 0.67*

2.08 ± 0.22* 1.32 ± 0.23* 1.20 ± 0.20* 1.09 ± 0.28*

2.17 ± 0.22* 1.34 ± 0.28* 1.82 ± 0.85* 0.94 ± 0.77

Table 5 Validation of the microarray transcription profile by quantitative real-time PCR for selected genes in roots. * means significantly dysregulated genes. Annotation Gene name FSD1 DIN2 PRX52

Fe superoxide dismutase 1 Glycosyl hydrolase Peroxidase

24h root samples

72h root samples

Microarray fold change (log2)

qPCR fold change (log2)

Microarray fold change (log2)

qPCR fold change (log2)

5.77 ± 0.44* 2.77 ± 0.57* 2.04 ± 0.35*

8.70 ± 0.51* 3.68 ± 1.67* 5.84 ± 1.16*

0.66 ± 0.33 2.24 ± 1.50 1.44 ± 0.27

0.43 ± 0.84 1.50 ± 1.8 2.18 ± 1.6

used as a model organism. Our results showed that only six Phase I metabolites of IVM were formed via hydroxylation (þO) and demethylation (-CH2) in A. thaliana. These biotransformation reactions of IVM have been described previously in sheep (Vokral et al., 2013; Zeng et al., 1998) revealed 10 mostly hydroxylated and demethylated IVM metabolites in human liver microsomes. However, no Phase II metabolites were shown to arise from IVM in A. thaliana nor in sheep. When the biotransformation of other anthelmintic drug, fenbendazole, was studied in A. thaliana, 12 metabolites were identified including Phase II metabolites, fenbendazole glycosides and acetylglycosides (Syslova et al., 2019). Based on this comparison, A. thaliana is able to transform IVM by a limited number of reactions. In view of the structure of IVM metabolites formed in A. thaliana, these end products can be considered as relatively stable, i.e. with no high reactivity and toxicity. In addition, the IVM metabolites were present only in the roots. Therefore, the risk associated with ingestion of the plants exposed to IVM is connected to the parent drug only. The second aim of present study was to follow up with the transcriptomic response to IVM presence in A. thaliana. A microarray analysis revealed numerous genes with changed expression in plants exposed to IVM. Corresponding proteins participated in drug metabolism; in response to salt, osmotic and water deprivation stress; in response to pathogens; and in ion homeostasis. IVM presence in A. thaliana up-regulated five CYP genes (CYP93D1, CYP71B2, CYP76G1, CYP83A1, and CYP712A1) in the roots after 24 h exposure, two (CYP81F2 and CYP94B1) in the roots after 72 h and one (CYP91A2) in the rosettes after 72 h. It is possible that

some of these CYPs are involved in IVM metabolism. Since only metabolites of Phase I were identified in our study, the upregulation of glycosyl transferases and glutathione S-transferases was probably not related to IVM metabolism. However, the drug transporters ABCG40, AT3G23550, ABCB21, which are up-regulated by IVM, might be included in IVM transport and extrusion. IVM also up-regulated many genes involved in transport e.g. the intrinsic proteins (PIP1A, PIP1C, PIP2A, PIP2B, PIP3, TIP2;2, TIP2;3, and TIP4;1) which transport the polar molecules, including water, across membranes (Johanson et al., 2001). Further, IVM upregulated several genes involved in the transport of metals and in metal homeostasis such as the copper chaperone CCH, copper transporter COPT2, zinc transporter ZIP2, molybdate transporter MOT1, metal ion transporter AT5G24580, and metallo reductases FRO4 and FRO5. IVM binds on glutamate-gated chloride ion channels in nerve and muscle cells in nematodes and insects, which leads to the increased uptake of chloride ions, resulting in the organism's paralyses and death (Crump and Omura, 2011). Therefore, the question arises as to whether IVM could have a similar effect in plants. Cl is a plant nutrient that plays a role in the regulation of photosynthesis, transpiration, fertilization, nutrition, and growth via changes in membrane potential, enzyme stability, charge balance, pH, osmoregulation, volume control, and turgor (Li et al., 2017). Keeping this in mind, the up-regulation of genes coding for intrinsic proteins and for metal transporters caused by a changed concentration of Cl ions in root cells seems possible. The up regulation of SLAH1, which is involved in control NO 3 /Cl ratio in shoots, can be assumed as an indication of the misbalance of Cl

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

ions (Cubero-Font et al., 2016). On the other hand, neither the cation-chloride co-transporter (CCC) nor the chloride channels (CLCs) were dysregulated at any time point in any plant part. Many genes involved in response to water deprivation, salt and osmotic stress (NAC6, DIN2, AT4G16260, GSTF2, Rap2.6L, AATP1, NAC019, BHLH100, NAC3, CBL1, ABR1, AT5G38710, AOC1, OSM34 and LHCB2.3) occurred also among genes with dys-regulated expression in the roots after exposure of A. thaliana to IVM. Rosette transcription profiles revealed a relatively high number of dysregulated genes employed in response to salt, osmotic or water deprivation stress as well. The largest group of genes up-regulated in the rosettes after 24 h falls into the category of signal transduction (ethylene-activated signaling pathway, phosphorelay signal transduction system, brassinosteroid mediated signaling pathway, transmembrane receptor protein tyrosine kinase signaling pathway, and cytokinin-activated signaling pathway) and transcription factor activity. A portion of these genes is involved in the reaction to drought, osmotic or salt stress. In addition, transcription factor TINY2 is an ethylene signaling pathway involved in response to drought, abscisic acid, cold, and mechanical wounding (Wei et al., 2005). Phospholipase D alpha 1 (PLDALPHA1) is employed in a variety of cellular and physiological processes such as cytoskeletal remodeling, regulation of stomatal opening and closure, as well as in biotic and abiotic stress signaling (Novak et al., 2018). Similarly to TINY2, AT2G44940 is also member of the DREB subfamily of A-4 transcription factors. AT2G44940 is involved in response to dehydration (Ding et al., 2013). AFP2 is induced by abscisic acid (ABA) and drought (Garcia et al., 2008). Transcription factor RGL2 is up-regulated during the salt stress (Kazachkova et al., 2016). Further, genes involved in response to stress and to abiotic and biotic stimuli included two of the most numerous groups down-regulated in the rosettes after 24 h IVM-exposure, i.e. genes participating in response to salt stress (e.g. salt induced serine rich [SIS], tonoplast intrinsic protein TIP2;2, along with the heat shock protein HSP17.6II). Many transcription factors down-regulated by IVM are involved in response to water deprivation (RAP2.6, RD26, and AT5G61590) and in response to iron ion starvation (basic helix-loop-helix proteins BHLH38, BHLH39, and BHLH101). This confirms that IVM exposure resulted in a disturbed osmotic balance. Further, several genes employed in wax biosynthesis (CER3, KCR2, KCS1, KCS12, LACS2, and AT2G39400) were down-regulated, which could be related to the afore mentioned osmotic stress and water misbalance. However, water deficiency or exposure to NaCl results in increased wax biosynthesis (Kosma et al., 2009). Since genes involved in wax synthesis down-regulated by IVM are transcribed in the endoplasmic reticulum (ER), another hypothetical explanation is the effect of IVM on Ca2þ levels in ER. IVM was able to reduce Ca2þ uptake into the sarcoplasmic reticulum in animals (Ahern et al., 1999). The function of ER as storage place for Ca2þ ions in plants is not so clear (Stael et al., 2012). However, because IVM down-regulated a relatively high number of genes expressed in ER, we also suggest the possible effect of IVM on ER via the misbalance of Ca2þ ions. After 72 h exposure, the cation exchangers CAX1 and CAX3 as well as the autoinhibited Ca(2þ)-ATPase ACA4 were upregulated in the rosettes. These all play important role in Ca2þ homeostasis (Conn et al., 2011). Moreover, the calcium uniporter AT5G66650 was up-regulated in the roots after 72 h exposure. Since IVM increased calcium influx into leukemia cells (Sharmeen et al., 2010), we hypothesize that IVM may influence Ca2þ homeostasis in plant cells as well. Further, genes employed in response to salt stress (BT4, RVE2, ERD6, AT5G14920, and GSTF2) and in stomatal closure (CA2) were up-regulated, while 20 genes involved in response to ABA were down-regulated in the rosettes after 72 h exposure. ABA plays an important role in the signaling of various

533

abiotic as well as biotic stresses, and it specifically targets guard cells in which stomatal closure is induced under water stress conditions (Tuteja, 2007). Finally, the number of genes involved in photosynthesis in light harvesting in photosystem I and II (chlorophyll A/B binding proteins CAB, CAB1, and CAB2, light harvesting proteins LHCA1, LHCA4, LHCB3, LHCB2.1, and LHCB2, and lightharvesting chlorophyll-protein complex II subunits LHB1B1 and LHB1B2) were down-regulated in the rosettes after 72 h. As mentioned above, the Cl level is able to affect photosynthesis, and salt or drought stress influences photosynthesis as well (Chaves et al., 2009). Previously, we observed the negative regulation of genes involved in photosynthesis in the case of A. thaliana exposure to the anthelmintic drug fenbendazole (Syslova et al., 2019). Among genes with IVM-dysregulated expression, a high number was involved in response to pathogens. These genes were to a greater extent down-regulated than up-regulated, e.g. the disease resistance proteins AT1G63750 and AT5G41750, disease resistanceresponsive family protein DIR5, defensin-like family proteins At1g34047, AT3G59930, as well as AT5G33355 were down-regulated in the roots after 24 h exposition. The defensin-like family proteins AT1G34047, AT2G36255, and AT5G33355 were down-regulated in the roots after 72 h. In the rosettes, the plant defensins PDF1.2c and PDF1.3, polygalacturonase inhibiting proteins PGIP1 and PGIP2, and pathogenesis related PR4 were down-regulated after 24 h. After 72 h exposure, a relatively high number of genes involved in response to bacterial and fungal pathogens (e.g. MEE14, LYK3, AT5G10760, CHI, PMR6, RLP23, AT1G70130, and PR4) was upregulated in the rosettes. The rise of Ca2þ together with NO (nitric oxide) generation in cells are early stage signals in plant innate immune response (Ma et al., 2008). The possible effect of IVM on Ca2þ levels in cells was discussed above. Since transcription of the nitrate reductases NIA1 and NIA2 was increased in the rosettes at the same time point, along with the findings of Yamamoto et al. (2003), who observed nitrite-dependent NO production after pathogenic fungi inoculation, we suggest that IVM could affect the expression of defense response genes via changes in cellular Ca2þ level and via the production of NO by nitrate reductases. NO is also involved in the abscisic acid (ABA) signaling pathway leading to stomatal closure during drought and salinity stress (Neill et al., 2008). This corresponds with the up-regulation of genes involved in the ABA signaling pathway (LYK3, PYL8, and CIPK3) as well as carbonic anhydrase CA2, which was involved in stomatal movement in the rosettes after 72 h exposure. To summarize the transcriptomic analysis, IVM significantly affected the transcription of genes involved in response to various stresses. Since IVM is known for its ability to disrupt Cl balance in insects and nematodes (Crump and Omura, 2011), we hypothesize that the above described changes in gene transcription in A. thaliana resulted from disrupted ionic homeostasis caused by the ionophore properties of IVM. 5. Conclusions A. thaliana was able to uptake IVM, but its capability to metabolize it was relatively low. Only 6 metabolites of the Phase I biotransformation of IVM and no metabolite of Phase II were formed in A. thaliana. All IVM metabolites were detected in the roots, while only the parent compound was detected in the rosettes. Therefore, the risk associated with ingestion of the plants exposed to IVM is connected to the parent drug only. In the plant organism, IVM significantly affected the transcription of numerous genes involved in the response to salt, osmotic and water deprivation stress, in ion homeostasis as well as in defense responses to pathogens. The IVM-induced changes in transcriptome indicate the possible negative impact of IVM on plant physiology.

534

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova

Acknowledgements This project was supported by the Czech Science Foundation
grants No. 18-08452S, 18-07724S), by the project EFSA-CDN (GACR, (No. CZ.02.1.01/0.0/0.0/16_019/0000841) co-funded by ERDF and by Charles University in Prague (research project SVV 260 416). Special thanks to GENERI BIOTECH for microarray scanning and image and statistical processing of microarray data, and to Daniel Paul Sampey, MDA for English revisions. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.chemosphere.2019.06.102. References Ahern, G.P., Junankar, P.R., Pace, S.M., Curtis, S., Mould, J.A., Dulhunty, A.F., 1999. Effects of ivermectin and midecamycin on ryanodine receptors and the Ca2þATPase in sarcoplasmic reticulum of rabbit and rat skeletal muscle. Journal of Physiology-London 514, 313e326. Baena-Diaz, F., Martinez, I., Gil-Perez, Y., Gonzalez-Tokman, D., 2018. Trans-generational effects of ivermectin exposure in dung beetles. Chemosphere 202, 637e643. Beynon, S.A., 2012. Potential environmental consequences of administration of anthelmintics to sheep. Vet. Parasitol. 189, 113e124. Boxall, A.B.A., Kolpin, D.W., Halling-Sorensen, B., Tolls, J., 2003. Are veterinary medicines causing environmental risks? Environ. Sci. Technol. 37, 286Ae294A. Bradford, M.M., 1976. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Anal. Biochem. 72, 248e254. Chaves, M.M., Flexas, J., Pinheiro, C., 2009. Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103, 551e560. Conn, S.J., Gilliham, M., Athman, A., Schreiber, A.W., Baumann, U., Moller, I., Cheng, N.H., Stancombe, M.A., Hirschi, K.D., Webb, A.A.R., Burton, R., Kaiser, B.N., Tyerman, S.D., Leigh, R.A., 2011. Cell-specific vacuolar calcium storage mediated by CAX1 regulates apoplastic calcium concentration, gas exchange, and plant productivity in arabidopsis. Plant Cell 23, 240e257. Crump, A., Omura, S., 2011. Ivermectin, 'Wonder drug' from Japan: the human use perspective. Proc. Jpn. Acad. B Phys. Biol. Sci. 87, 13e28. Cubero-Font, P., Maierhofer, T., Jaslan, J., Rosales, M.A., Espartero, J., Diaz-Rueda, P., Muller, H.M., Hurter, A.L., Al-Rasheid, K.A.S., Marten, I., Hedrich, R., ColmeneroFlores, J.M., Geiger, D., 2016. Silent S-type Anion channel subunit SLAH1 gates SLAH3 open for chloride root-to-shoot translocation. Curr. Biol. 26, 2213e2220. Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K., Scheible, W.R., 2005. Genomewide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 139, 5e17. Didier, A., Loor, F., 1996. The abamectin derivative ivermectin is a potent P-glycoprotein inhibitor. Anti Canccer Drugs 7, 745e751. Ding, Y., Liu, N., Virlouvet, L., Riethoven, J.J., Fromm, M., Avramova, Z., 2013. Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. BMC Plant Biol. 13, 11. Drotar, A., Phelps, P., Fall, R., 1985. Evidence for glutathione-peroxidase activities in cultured plant-cells. Plant Sci. 42, 35e40. Garcia, M.E., Lynch, T., Peeters, J., Snowden, C., Finkelstein, R., 2008. A small plantspecific protein family of ABI five binding proteins (AFPs) regulates stress response in germinating Arabidopsis seeds and seedlings. Plant Mol. Biol. 67, 643e658. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases - first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130e7139. Halley, B.A., Vandenheuvel, W.J.A., Wislocki, P.G., 1993. Environmental-effects of the usage of avermectins in livestock. Vet. Parasitol. 48, 109e125. Hoagland, D.R., 1920. Special articles - optimum nutrient solutions for plants. Science 52, 562e564. Horvat, A.J.M., Petrovic, M., Babic, S., Pavlovic, D.M., Asperger, D., Pelko, S., Mance, A.D., Kastelan-Macan, M., 2012. Analysis, occurrence and fate of anthelmintics and their transformation products in the environment. Trac. Trends Anal. Chem. 31, 61e84. Iglesias, L.E., Fuse, L.A., Lifschitz, A.L., Rodriguez, E.M., Sagues, M.F., Saumell, C.A., 2011. Environmental monitoring of ivermectin excreted in spring climatic conditions by treated cattle on dung fauna and degradation of faeces on pasture. Parasitol. Res. 108, 1185e1191. Iglesias, L.E., Saumell, C., Sagues, F., Sallovitz, J.M., Lifschitz, A.L., 2018. Ivermectin dissipation and movement from feces to soil under field conditions. J. Environ. Sci. Health - Part B Pesticides, Food Contam. Agric. Wastes 53, 42e48. Iglesias, L.E., Saumell, C.A., Fernandez, A.S., Fuse, L.A., Lifschitz, A.L., Rodriguez, E.M., Steffan, P.E., Fiel, C.A., 2006. Environmental impact of ivermectin excreted by cattle treated in autumn on dung fauna and degradation of faeces on pasture. Parasitol. Res. 100, 93e102. Johanson, U., Karlsson, M., Johansson, I., Gustavsson, S., Sjovall, S., Fraysse, L.,

Weig, A.R., Kjellbom, P., 2001. The complete set of genes encoding major intrinsic proteins in arabidopsis provides a framework for a new nomenclature for major intrinsic proteins in plants. Plant Physiol. 126, 1358e1369. Kazachkova, Y., Khan, A., Acuna, T., Lopez-Diaz, I., Carrera, E., Khozin-Goldberg, I., Fait, A., Barak, S., 2016. Salt induces features of a dormancy-like state in seeds of eutrema (thellungiella) salsugineum, a halophytic relative of arabidopsis. Front. Plant Sci. 7, 18. Kosma, D.K., Bourdenx, B., Bernard, A., Parsons, E.P., Lu, S., Joubes, J., Jenks, M.A., 2009. The impact of water deficiency on leaf cuticle lipids of arabidopsis. Plant Physiol. 151, 1918e1929. Lamesch, P., Berardini, T.Z., Li, D.H., Swarbreck, D., Wilks, C., Sasidharan, R., Muller, R., Dreher, K., Alexander, D.L., Garcia-Hernandez, M., Karthikeyan, A.S., Lee, C.H., Nelson, W.D., Ploetz, L., Singh, S., Wensel, A., Huala, E., 2012. The Arabidopsis Information Resource (TAIR): improved gene annotation and new tools. Nucleic Acids Res. 40, D1202eD1210. Li, B., Tester, M., Gilliham, M., 2017. Chloride on the move. Trends Plant Sci. 22, 236e248. Liebig, M., Fernandez, A.A., Blübaum-Gronau, E., Boxall, A., Brinke, M., Carbonell, G., Egeler, P., Fenner, K., Fernandez, C., Fink, G., Garric, J., Halling-Sørensen, B., €ffler, D., Cots, M.A., Pope, L., Prasse, C., Knacker, T., Krogh, K.A., Küster, A., Lo €mbke, J., Ro €nnefahrt, I., Schneider, M.K., Schweitzer, N., Tarazona, J.V., Ro Ternes, T.A., Traunspurger, W., Wehrhan, A., Duis, K., 2010. Environmental risk assessment of ivermectin: A case study. Integr. Environ. Assess. Manag. (567e587) https://doi.org/10.1002/ieam.96. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402e408. Lumaret, J.P., Errouissi, F., Floate, K., Rombke, J., Wardhaugh, K., 2012. A review on the toxicity and non-target effects of macrocyclic lactones in terrestrial and aquatic environments. Curr. Pharmaceut. Biotechnol. 13, 1004e1060. Ma, W., Smigel, A., Tsai, Y.C., Braam, J., Berkowitz, G.A., 2008. Innate immunity signaling: cytosolic Ca2þ elevation is linked to downstream nitric oxide generation through the action of calmodulin or a calmodulin-like protein. Plant Physiol. 148, 818e828. McKellar, Q.A., 1997. Ecotoxicology and residues of anthelmintic compounds. Vet. Parasitol. 72, 413e426. Mesa, L.M., Horler, J., Lindt, I., Gutierrez, M.F., Negro, L., Mayora, G., Montalto, L., Ballent, M., Lifschitz, A., 2018. Effects of the antiparasitic drug moxidectin in cattle dung on zooplankton and benthic invertebrates and its accumulation in a water-sediment system. Arch. Environ. Contam. Toxicol. 75, 316e326. Mesa, L.M., Lindt, I., Negro, L., Gutierrez, M.F., Mayora, G., Montalto, L., Ballent, M., Lifschitz, A., 2017. Aquatic toxicity of ivermectin in cattle dung assessed using microcosms. Ecotoxicol. Environ. Saf. 144, 422e429. Neill, S., Barros, R., Bright, J., Desikan, R., Hancock, J., Harrison, J., Morris, P., Ribeiro, D., Wilson, I., 2008. Nitric oxide, stomatal closure, and abiotic stress. J. Exp. Bot. 59, 165e176. Novak, D., Vadovic, P., Ovecka, M., Samajova, O., Komis, G., Colcombet, J., Samaj, J., 2018. Gene expression pattern and protein localization of arabidopsis phospholipase D alpha 1 revealed by advanced light-sheet and super-resolution microscopy. Front. Plant Sci. 9, 21. lova , L., Seidlov , B., Kubí
Podlipn a, R., Ska a, H., Szot akova cek, V., Stuchlíkov a, L., sko, R., Vane
k, T., Vok
ra l, I., 2013. Biotransformation of benzimidazole anJira thelmintics in reed (Phragmites australis) as a potential tool for their detoxification in environment. Bioresour. Technol. 144, 216e224. Provart, N.J., Gil, P., Chen, W.Q., Han, B., Chang, H.S., Wang, X., Zhu, T., 2003. Gene expression phenotypes of Arabidopsis associated with sensitivity to low temperatures. Plant Physiol. 132, 893e906. Scheffczyk, A., Floate, K.D., Blanckenhorn, W.U., During, R.A., Klockner, A., Lahr, J., Lumaret, J.P., Salamon, J.A., Tixier, T., Wohde, M., Rombke, J., 2016. Nontarget effects of ivermectin residues on earthworms and springtails dwelling beneath dung of treated cattle in four countries. Environ. Toxicol. Chem. 35, 1959e1969. Sharmeen, S., Skrtic, M., Sukhai, M.A., Hurren, R., Gronda, M., Wang, X.M., Fonseca, S.B., Sun, H., Wood, T.E., Ward, R., Minden, M.D., Batey, R.A., Datti, A., Wrana, J., Kelley, S.O., Schimmer, A.D., 2010. The antiparasitic agent ivermectin induces chloride-dependent membrane hyperpolarization and cell death in leukemia cells. Blood 116, 3593e3603. Smyth, G.K., Michaud, J., Scott, H.S., 2005. Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics 21, 2067e2075. Smyth, G.K., Speed, T., 2003. Normalization of cDNA microarray data. Methods 31, 265e273. Stael, S., Wurzinger, B., Mair, A., Mehlmer, N., Vothknecht, U.C., Teige, M., 2012. Plant organellar calcium signalling: an emerging field. J. Exp. Bot. 63, 1525e1542. Sutton, G., Bennett, J., Bateman, M., 2014. Effects of ivermectin residues on dung invertebrate communities in a UK farmland habitat. Insect Conservation and Diversity 7, 64e72. Syslova, E., Landa, P., Stuchlikova, L.R., Matouskova, P., Skalova, L., Szotakova, B., Navratilova, M., Vanek, T., Podlipna, R., 2019. Metabolism of the anthelmintic drug fenbendazole in Arabidopsis thaliana and its effect on transcriptome and proteome. Chemosphere 218, 662e669. Tuteja, N., 2007 May. Abscisic Acid and abiotic stress signaling. Plant Signal Behav. 2 (3), 135e138. Vanacker, H., Carver, T.L.W., Foyer, C.H., 1998. Pathogen-induced changes in the antioxidant status of the apoplast in barley leaves. Plant Physiol. 117, 1103e1114. Verma, S., Dubey, R.S., 2003. Lead toxicity induces lipid peroxidation and alters the

 et al. / Chemosphere 234 (2019) 528e535 E. Syslova activities of antioxidant enzymes in growing rice plants. Plant Sci. 164, 645e655. Vokral, I., Jedlickova, V., Jirasko, R., Stuchlikova, L., Bartikova, H., Skalova, L., Lamka, J., Holcapek, M., Szotakova, B., 2013. The metabolic fate of ivermectin in host (Ovis aries) and parasite (Haemonchus contortus). Parasitology 140, 361e367. Wei, G., Pan, Y., Lei, J., Zhu, Y.X., 2005. Molecular cloning, phylogenetic analysis, expressional profiling and in vitro studies of TINY2 from Arabidopsis thaliana. J. Biochem. Mol. Biol. 38, 440e446.

535

Wohde, M., Berkner, S., Junker, T., Konradi, S., Schwarz, L., During, R.A., 2016. Occurrence and transformation of veterinary pharmaceuticals and biocides in manure: a literature review. Environ. Sci. Eur. 28. Yamamoto, A., Katou, S., Yoshioka, H., Doke, N., Kawakita, K., 2003. Nitrate reductase, a nitric oxide-producing enzyme: induction by pathogen signals. J. Gen. Plant Pathol. 69 (4), 218e229. Zeng, Z., Andrew, N.W., Arison, B.H., Luffer-Atlas, D., Wang, R.W., 1998. Identification of cytochrome P4503A4 as the major enzyme responsible for the metabolism of ivermectin by human liver microsomes. Xenobiotica 28, 313e321.