- Email: [email protected]
Kaposi's sarcoma and new herpesvirus
Letters to the Editor
Kaposi’s sarcoma and
new
herpesvirus
SiR-Kaposi’s sarcoma (KS), an aggressive disease in AIDS patients, has long been suspected to result from a cascade of events involving, to various degrees, microorganisms such as herpesviruses, hepatitis B virus, HIV, and Mycoplasma penetrans.H Chang and colleagues5 have identified herpesvirus-like DNA sequence in biopsy samples from patients with AIDS-associated KS. This DNA sequence was found exclusively in KS biopsy specimens but not in several other tested tissues. We report our results of screening DNA samples from isolated peripheral blood mononuclear cells (PBMCs). DNA was directly purified from uncultured PBMCs that were
obtained from the blood of HIV-infected individuals
cell types from PBMCs might provide a rationale for its isolation and further characterisation. Sequence homologies with Epstein-Barr virus BDLF1 and herpesvirus saimiri orf 26, two well-known oncogenic y-herpesvirus, together with our finding of this particular sequence in PBMCs, lend support to the hypothesis of an infectious process in the development of AIDS-associated
KS, involving a new lymphotropic herpesvirus. However, this new virus, HHV-8 or KSV, remains to be identified. Hélène Collandre, Stéphane Ferris, Odile Grau, Luc *Alain Blanchard Unité d’oncologie Virale, Institut Pasteur, 75724 Paris, France 1
with
(10 patients) or without KS (9 patients). Samples were examined by PCR with primers and probe KS330233, described by Chang et alIn 2 samples from patients with KS, there was amplification of a 233 basepair (bp) DNA fragment that specifically hybridised to the internal probe
(figure). Amplified DNA from patient SAB (figure), designated KS22, was cloned in the TA cloning vector (Invitrogen) and its sequence determined. Two dilutions of DNA sample from this patient were also amplified according to the protocol described by Chang et al. 5 Product from each reaction was separately cloned and sequenced to avoid misreading of the Taq polymerase. Codon number in the table corresponds to the open-reading frame (nucleotides 633-1550) from KS330 taken as the reference sequence.’ Alignment of the reference sequence KS43305 with KS22 revealed 5 point mutations, with 3 of them inducing aminoacid changes in codons 134, 167, 169:
Our results show the presence in DNA from isolated PBMCs of a sequence very similar, if not identical, to those observed by Chang.5 Therefore, the tropism of this as yet unisolated virus is not restricted to KS and its presence in
Figure: Southern corresponding
blot
hybridisation of PCR amplified products
to sequences from
herpes-like virus
DNA samples from PBMCs obtained from HIV-infected individuals were subjected to PCR amplification with experimental conditions described
by Chang
et all Representative samples that were analysed are: 2 different dilutions of DNA from patient SAB (lanes 1 and 2), patient MEI (lane 3), patient MOR (lane 4), and 2 dilutions of DNA from patient DEB (lanes 5 and 6). Patients SAB, MOR, and DEB have KS, patient MEI does not.
2
3
4
5
Montagnier,
Siddiqui A. Hepatitis B virus DNA in Kaposi’s sarcoma. Proc Natl Acad Sci USA 1983; 80: 4861-64. Ensoli B, Gendelman R, Markham P, et al. Synergy between basic fibroblast growth factor and HIV-1 tat protein in induction of Kaposi’s sarcoma. Nature 1994; 371: 674-80. Bovenzi P, Mirandola P, Secchiero P, Strumia R, Cassai E, Diluca D. Human herpesvirus-6 (variant -A) in Kaposi’s sarcoma. Lancet 1993; 341: 1288-89. Wang RY-H, Shih JW-K, Weiss SH, et al. Mycoplasma penetrans infection in male homosexuals with AIDS: high seroprevalence and association with Kaposi’s sarcoma. Clin Infect Dis 1993; 17: 724-29. Chang Y, Cesarman E, Pessin MS, et al. Identification of herpes-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 1994; 266: 1865-69.
Kaposi’s-sarcoma-associated herpesvirus in HIV-negative Kaposi’s sarcoma SIR-A new herpesvirus, provisionally termed Kaposi’ssarcoma-associated herpes virus (KSHV) has been identified in biopsy specimens from patients with AIDS-associated KS.’ To find out whether the same virus is present in lesions from HIV-negative individuals with classic KS we examined DNA extracted from frozen and paraffin-embedded material by polymerase chain reaction (PCR). For PCR we used primers KS4 (5’ AGCACTCGCAGGGCAGTACG 3’) and KS5 (5’ GACTCTTCGCTGATGAACTGG 3’) to amplify a 700 bp fragment from a putative minor capsid protein of KSHV. Primers KS1 (5’ AGCCGAAAGGATTCCACCAT 3’) and KS2 (5’ TCCGTGTTGTCTACGTCCAG 3’), kindly supplied by Y Chang and P Moore, amplifying a 233 bp fragment’ nested inside the 700 bp fragment, were used in a nested PCR to demonstrate the specificity of the 700 bp fragment and to increase sensitivity. Nested PCR amplification of an endogenous retrovirus envelope gene (ERV3)2was used as a control for DNA quality. With DNA extracted from paraffin-embedded material most samples were only positive in nested PCR, whereas DNA from frozen samples consistently gave strong signals after amplification with KS4 and KS5 only. (Some samples were also analysed with 5’ TCGTGGGATCCACGGAGC[KS12: primers KS13: 5’ ATATAGGATACGCTGGCA ATACACC 3’; derived GGTGGGCG 3’] from a putative tegument protein of KSHV.) We found KSHV in 16 of 17 patients with classic KS
(table), including
7
elderly HIV-seronegative patients aged 1043
Kaposi’s sarcoma and
new
herpesvirus
SiR-Kaposi’s sarcoma (KS), an aggressive disease in AIDS patients, has long been suspected to result from a cascade of events involving, to various degrees, microorganisms such as herpesviruses, hepatitis B virus, HIV, and Mycoplasma penetrans.H Chang and colleagues5 have identified herpesvirus-like DNA sequence in biopsy samples from patients with AIDS-associated KS. This DNA sequence was found exclusively in KS biopsy specimens but not in several other tested tissues. We report our results of screening DNA samples from isolated peripheral blood mononuclear cells (PBMCs). DNA was directly purified from uncultured PBMCs that were
obtained from the blood of HIV-infected individuals
cell types from PBMCs might provide a rationale for its isolation and further characterisation. Sequence homologies with Epstein-Barr virus BDLF1 and herpesvirus saimiri orf 26, two well-known oncogenic y-herpesvirus, together with our finding of this particular sequence in PBMCs, lend support to the hypothesis of an infectious process in the development of AIDS-associated
KS, involving a new lymphotropic herpesvirus. However, this new virus, HHV-8 or KSV, remains to be identified. Hélène Collandre, Stéphane Ferris, Odile Grau, Luc *Alain Blanchard Unité d’oncologie Virale, Institut Pasteur, 75724 Paris, France 1
with
(10 patients) or without KS (9 patients). Samples were examined by PCR with primers and probe KS330233, described by Chang et alIn 2 samples from patients with KS, there was amplification of a 233 basepair (bp) DNA fragment that specifically hybridised to the internal probe
(figure). Amplified DNA from patient SAB (figure), designated KS22, was cloned in the TA cloning vector (Invitrogen) and its sequence determined. Two dilutions of DNA sample from this patient were also amplified according to the protocol described by Chang et al. 5 Product from each reaction was separately cloned and sequenced to avoid misreading of the Taq polymerase. Codon number in the table corresponds to the open-reading frame (nucleotides 633-1550) from KS330 taken as the reference sequence.’ Alignment of the reference sequence KS43305 with KS22 revealed 5 point mutations, with 3 of them inducing aminoacid changes in codons 134, 167, 169:
Our results show the presence in DNA from isolated PBMCs of a sequence very similar, if not identical, to those observed by Chang.5 Therefore, the tropism of this as yet unisolated virus is not restricted to KS and its presence in
Figure: Southern corresponding
blot
hybridisation of PCR amplified products
to sequences from
herpes-like virus
DNA samples from PBMCs obtained from HIV-infected individuals were subjected to PCR amplification with experimental conditions described
by Chang
et all Representative samples that were analysed are: 2 different dilutions of DNA from patient SAB (lanes 1 and 2), patient MEI (lane 3), patient MOR (lane 4), and 2 dilutions of DNA from patient DEB (lanes 5 and 6). Patients SAB, MOR, and DEB have KS, patient MEI does not.
2
3
4
5
Montagnier,
Siddiqui A. Hepatitis B virus DNA in Kaposi’s sarcoma. Proc Natl Acad Sci USA 1983; 80: 4861-64. Ensoli B, Gendelman R, Markham P, et al. Synergy between basic fibroblast growth factor and HIV-1 tat protein in induction of Kaposi’s sarcoma. Nature 1994; 371: 674-80. Bovenzi P, Mirandola P, Secchiero P, Strumia R, Cassai E, Diluca D. Human herpesvirus-6 (variant -A) in Kaposi’s sarcoma. Lancet 1993; 341: 1288-89. Wang RY-H, Shih JW-K, Weiss SH, et al. Mycoplasma penetrans infection in male homosexuals with AIDS: high seroprevalence and association with Kaposi’s sarcoma. Clin Infect Dis 1993; 17: 724-29. Chang Y, Cesarman E, Pessin MS, et al. Identification of herpes-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 1994; 266: 1865-69.
Kaposi’s-sarcoma-associated herpesvirus in HIV-negative Kaposi’s sarcoma SIR-A new herpesvirus, provisionally termed Kaposi’ssarcoma-associated herpes virus (KSHV) has been identified in biopsy specimens from patients with AIDS-associated KS.’ To find out whether the same virus is present in lesions from HIV-negative individuals with classic KS we examined DNA extracted from frozen and paraffin-embedded material by polymerase chain reaction (PCR). For PCR we used primers KS4 (5’ AGCACTCGCAGGGCAGTACG 3’) and KS5 (5’ GACTCTTCGCTGATGAACTGG 3’) to amplify a 700 bp fragment from a putative minor capsid protein of KSHV. Primers KS1 (5’ AGCCGAAAGGATTCCACCAT 3’) and KS2 (5’ TCCGTGTTGTCTACGTCCAG 3’), kindly supplied by Y Chang and P Moore, amplifying a 233 bp fragment’ nested inside the 700 bp fragment, were used in a nested PCR to demonstrate the specificity of the 700 bp fragment and to increase sensitivity. Nested PCR amplification of an endogenous retrovirus envelope gene (ERV3)2was used as a control for DNA quality. With DNA extracted from paraffin-embedded material most samples were only positive in nested PCR, whereas DNA from frozen samples consistently gave strong signals after amplification with KS4 and KS5 only. (Some samples were also analysed with 5’ TCGTGGGATCCACGGAGC[KS12: primers KS13: 5’ ATATAGGATACGCTGGCA ATACACC 3’; derived GGTGGGCG 3’] from a putative tegument protein of KSHV.) We found KSHV in 16 of 17 patients with classic KS
(table), including
7
elderly HIV-seronegative patients aged 1043