Kazinol B from Broussonetia kazinoki improves insulin sensitivity via Akt and AMPK activation in 3T3-L1 adipocytes

    Kazinol B from Broussonetia kazinoki Improves Insulin Sensitivity via Akt and AMPK activation in 3T3-L1 Adipocytes Hyejin Lee, Hua Li, Ji Hye Jeong, Minsoo Noh, Jae-Ha Ryu PII: DOI: Reference:

S0367-326X(16)30114-9 doi: 10.1016/j.fitote.2016.05.006 FITOTE 3410

To appear in:

Fitoterapia

Received date: Revised date: Accepted date:

11 March 2016 13 May 2016 16 May 2016

Please cite this article as: Hyejin Lee, Hua Li, Ji Hye Jeong, Minsoo Noh, Jae-Ha Ryu, Kazinol B from Broussonetia kazinoki Improves Insulin Sensitivity via Akt and AMPK activation in 3T3-L1 Adipocytes, Fitoterapia (2016), doi: 10.1016/j.fitote.2016.05.006

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Kazinol B from Broussonetia kazinoki Improves Insulin Sensitivity via Akt and AMPK

College of Pharmacy and Research Center for Cell Fate Control, Sookmyung Women’s

SC

a

RI P

Hyejin Leea, Hua Lia, Ji Hye Jeonga, Minsoo Noh b, Jae-Ha Ryua*

T

activation in 3T3-L1 Adipocytes

University, 52 Hyochangwon-Gil, Yongsan-Gu, Seoul 140–742, Republic of Korea Natural Products Research Institute, College of Pharmacy, Seoul National University, 1

MA NU

b

Gwanak-Ro, Gwanak-Gu, Seoul 151-742, Republic of Korea

ED

*Corresponding author

Tel: +82-2-710-9568

CE

Fax: +82-2-2077-7869

PT

Address: 52 Hyochangwon-Gil, Yongsan-Gu, Seoul 140–742, Republic of Korea

AC

E-mail: [email protected]

ACCEPTED MANUSCRIPT ABSTRACT In this study, we evaluated the insulin-sensitizing effect of flavans purified from Broussonetia kazinoki Siebold (BK) on 3T3-L1 adipocytes. Among the tested compounds,

T

kazinol B enhanced intracellular lipid accumulation, gene expression of proliferator-activated

RI P

receptorγ (PPARγ) and CCAAT/enhancer binding protein-alpha (C/EBPα), and consistently induced PPARγ transcriptional activation. To further investigate the insulin-sensitizing effect of kazinol B, we measured glucose analogue uptake by fully differentiated adipocytes and

SC

myotubes. Kazinol B increased 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-Dglucose (2-NBDG) uptake by cells by upregulating the gene expression and translocation of

MA NU

glucose transporter 4 (GLUT-4) into the plasma membrane in adipocytes. Kazinol B stimulated the gene expression and secretion of adiponectin, which is associated with a low risk of types 1 and 2 diabetes mellitus. We also suggested the mechanism of the antidiabetic effect of kazinol B by assaying Akt and AMP-activated protein kinase (AMPK) phosphorylation. In conclusion, kazinol B isolated from BK improved insulin sensitivity by

ED

enhancing glucose uptake via the insulin-Akt signaling pathway and AMPK activation. These

PT

results suggest that kazinol B might be a therapeutic candidate for diabetes mellitus.

Keywords: Broussonetia kazinoki, diabetes mellitus, glucose uptake, 3T3-L1, AMPK

CE

Chemical compound studied in this article; Kazinol B (PubChem CID: 480869); Rosiglitazone (PubChem CID: 77999)

AC

1. Introduction

Over 29 million people suffer from diabetes mellitus (DM) in United States, and type 2 DM accounts for more than 90% of DM cases. Type 2 DM patients have a defect in insulin utilization in metabolic organs and tissues, causing resistance to insulin. Insulin resistance leads to a high blood glucose level accompanied by high blood pressure, high cholesterol or triglyceride levels. It is thus associated with chronic diseases such as obesity, hypertension, atherosclerosis, liver failure, and certain cancers. Glucose transport into metabolic organs and tissues is required to maintain a normal blood glucose level in DM patients, and is an important strategy for diabetes treatment. The insulin-Akt/PKB (protein kinase B) and AMP-activated protein kinase (AMPK) signaling pathways have been reported to mediate insulin utilization. In adipocytes, insulinmediated glucose uptake is dependent on GLUT4 expression and translocation [1]. Activation of the insulin and AMPK signaling pathways cooperatively triggers

ACCEPTED MANUSCRIPT translocation of glucose transporter 4 (GLUT4) to the plasma membrane and subsequently increases glucose uptake by adipocytes. In fasting-induced insulin-resistant mammals, AMPK-evoked translocation of GLUT4 contributes to insulin signaling [2]. Metformin, an

T

antidiabetic drug, regulates GLUT4 translocation by regulating Cbl and Cbl-associated

RI P

protein (CAP) signals via AMPK in 3T3-L1 adipocytes [3]. Plant-derived flavonoids have been reported to modulate GLUT2 expression or GLUT4 translocation via phosphoinositide 3-kinase (PI3K)/Akt in various cell and animal models [4].

SC

Paper mulberry, Broussonetia kazinoki Siebold (BK), exhibits various pharmacological activities, including inhibition of atopic dermatitis-like response [5], an anticancer effect via

MA NU

inhibition of angiogenesis [6] and production of reactive oxygen species [7], an antiinflammatory effect [8], depigmenting effect [9] and stimulation of myoblast differentiation [10]. Interestingly, an extract of BK showed antidiabetic and antihyperglycemic potency in diabetic rats [11]. Also, Shibano et al. reported alkaloids as inhibitors of glycosidase, implying their therapeutic potential for diabetes [12]. We reported that a flavan compound

ED

from BK, kazinol U, protected pancreatic β-cells against cytokine-induced toxicity [13], but the insulin-sensitizing potential of compounds from BK has not been studied to date.

PT

In a previous study, we reported kazinol B, an isoprenylated flavan, to be an inhibitor of nitric oxide production in LPS-induced macrophages [8]. As chronic inflammation is

CE

associated with the pathogenesis of obesity and insulin resistance, the anti-inflammatory potency of kazinol B might be useful for the treatment of diabetes. In this study, we evaluated the antidiabetic potential of kazinol B in mouse 3T3-L1 preadipocytes. Kazinol B promoted

AC

glucose uptake by adipocytes and myotubes. Furthermore, we found that Akt and AMPK activation are responsible for the insulin-sensitizing effect of kazinol B.

2. Materials and Methods 2.1. Purification of kazinol B from BK Root of B. kazinoki was collected from Goesan city, Chungbuk province, Korea in 2014, and a voucher specimen (No. SPH 14001) was deposited in the herbarium of Sookmyung Women’s University. Air-dried root bark (0.5 kg) was extracted with methanol and evaporated to dryness. The extracts were dissolved in water and successively partitioned with n-hexane, ethyl acetate and chloroform. Kazinol B (13 mg) was purified from the ethyl acetate soluble fraction (25 g) as described previously [14]. The purity and structure were confirmed by 1HNMR spectroscopy.

ACCEPTED MANUSCRIPT

2.2. Cell culture and preadipocyte differentiation Mouse 3T3-L1 preadipocytes (obtained from the American Type Culture Collection,

T

Manassas, VA) were maintained at 37°C in Dulbecco’s modified Eagle’s medium (DMEM)

RI P

(WelGENE, Daegu, Korea) supplemented with 10% newborn calf serum (Gibco BRL Life Technology, Grand Island, NY, USA) in a 5% CO2 atmosphere. Two days after cells reached confluence (differentiation day 0), the medium was replaced with medium containing MDI

SC

mixture (1 µg/ml isobutyl-methylxanthine, 1 µM dexamethasone, and 1 µg/ml insulin (Sigma, St. Louis, MO). After two days (differentiation day 2), cells were supplemented with insulin-

MA NU

containing DMEM. During differentiation, cells were maintained by replenishing with new insulin-containing medium every 2 days.

C2C12 myoblasts (kindly provided by Prof. GU Bae, Sookmyung Women’s University, Seoul, Korea) were cultured in growth medium containing 15% FBS. Cells at near confluence were cultured in differentiation medium (DMEM containing 2% horse serum)

ED

until myotube formation was observed (normally at 2-3 days of differentiation).

PT

2.3. MTT assay and ORO staining of lipid drop formation in 3T3-L1 cells To assess the effect of kazinol B on preadipocyte viability, 3T3-L1 cells were plated in

CE

96-well plates and incubated for 72 h. The cells were treated with 3-(4,5-dimethylthiazol-2yl)-2,5- diphenyltetrazoliumbromide (MTT) (Sigma, St. Louis, MO) solution at 37°C. After 3 h, the MTT solution was removed and 100 l of DMSO were added to extract MTT formazan

AC

crystals. The absorbance at 570 nm was measured using a GloMax®-Multi Microplate Multimode Reader (Promega, Madison, WI). The accumulated lipid content of differentiated 3T3-L1 cells was evaluated by Oil Red O (ORO) (Sigma, St. Louis, MO) and images were obtained on day 8 (D8) of differentiation. Differentiated adipocytes were washed with phosphate-buffered saline (PBS) and fixed in 10% formalin, and then stained with 0.5% ORO in 60% isopropanol. To quantify intracellular lipid storage, ORO inside cells was extracted with 4% Nonidet P-40 (NP-40) in isopropanol. The absorbance of the extract solution was measured at 520 nm using a microplate reader. Intracellular lipid accumulation in 3T3-L1 cells was photographed using an inverted phasecontrast microscope (TH4, Olympus, Tokyo, Japan).

2.4. Glucose uptake

ACCEPTED MANUSCRIPT For glucose uptake assay, fully differentiated 3T3-L1 adipocytes and C2C12 myoblasts were pre-incubated for 12 h in serum-free and low-glucose DMEM, followed by treatment with kazinol B for 24 h. After 1 h stimulation with insulin, 20 μM of the fluorescent glucose 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)

amino)-2-deoxyglucose

(2-NBDG)

T

analog

RI P

(Invitrogen, Carlsbad, CA, USA) was added, and the cultures were incubated for a further 1 h. Fluorescence retained in the cell monolayer was measured using a microplate reader set at an

SC

excitation wavelength of 465 nm and an emission wavelength of 540 nm.

2.5. Adiponectin secretion

MA NU

Adiponectin secretion was evaluated according to the manufacturer’s instructions (Mouse Adiponectin/Acrp30 DuoSet, R&D Systems, Minneapolis, MN, USA). 3T3-L1 preadipocytes were differentiated in MDI medium containing kazinol B or rosiglitazone. Conditioned medium was collected at D5 and the adiponectin concentration was measured.

ED

2.6. PPAR reporter assay

CV-1 cells were transiently transfected with plasmid mixture containing PPARγ expression

PT

vector and tk-PPRE-luciferase (Luc) vector for 6 h, and then treated with kazinol B for 24 h. The β-galactosidase reporter gene is used as a control for transfection efficiency in this

CE

reporter assay system. The luciferase activity in cell lysates was measured using a luciferase assay system (Promega, Madison, WI) and β-gal activities were measured as the absorbance at 410 nm using a microplate reader. All constructs were kindly provided by Dr. Ronald M.

AC

Evans at The Salk Institute (La Jolla, CA).

2.7. RNA extraction and quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) Differentiated adipocytes with MDI medium containing kazinol B were lysed with TRIzol reagent (Molecular Research Center, Cincinnati, OH, USA) for RNA preparation at D5. The cDNA was amplified from total RNA to estimate gene expression level during adipocyte differentiation by RT-qPCR. PCR reactions were performed using SYBR® Green PCR Master Mix and an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA, USA). mRNA levels were normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA as an internal control. Primers used are shown in Table 1.

Table 1. Oligonucleotide primer sequences used for the RT-qPCR analysis.

ACCEPTED MANUSCRIPT Gene name

Forward primer (5’ -> 3’)

Reverse primer (5’ -> 3’)

AACTCTGGGAGATTCTCCTGTTGA GAAGTGCTCATAGGCAGTGCAT

C/EBPα

TGCTGGAGTTGACCAGTAC

AAACCATCCTCTGGGTCTCC

Adiponectin

TGTAGGATTGTCAGTGGATCTG

GCTCTTCAGTTGTAGTAACGTCATC

GLUT4

GGGTCCTTACGTCTTCCTTCT

CCTCTGGTTTCAGGCACTTT

GAPDH

TGCACCACCAACTGCTTAG

GGCATGGACTGTGGTC TGAG

RI P

T

ARγ2

PPARγ2, peroxisome proliferator activated receptor subtype gamma 2; C/EBPα,

MA NU

glyceraldehyde 3-phosphate dehydrogenase.

SC

CCAAT/enhancer binding protein-alpha; GLUT4, glucose transporter subtype 4; GAPDH,

2.8. Western blot analysis and preparation of plasma membrane fraction Western blot analysis was performed to determine the effect of kazinol B on PPARγ, C/EBPα and GLUT4 protein levels and phosphorylation of Akt and AMPK in 3T3-L1 cells. 3T3-L1 preadipocytes were differentiated in MDI medium in the presence or absence of

ED

kazinol B as described above. At D5, cells were collected and resuspended in lysis buffer (25 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium

PT

dodecyl sulfate (SDS), and protease inhibitor cocktail (Calbiochem, Darmstadt, Germany)). Protein was electrophoresed in SDS-polyacrylamide gels and transferred to polyvinylidene

CE

fluoride (PVDF) membranes. The membrane was probed with primary antibodies against PPARγ and C/EBPα, followed by a secondary antibody (Cell Signaling Technology, Danvers,

AC

MA). For detection of Akt and AMPK activation, and GLUT4 translocation, 3T3-L1 preadipocytes were pre-incubated for 1 h with kazinol B, followed by insulin stimulation for a further 1 h. Membranes were incubated with antibody solution containing anti-phospho-Akt, -phospho-AMPK or -GLUT4 antibody (Cell Signaling Technology, Danvers, MA). GLUT4 expression in the nuclear fraction was normalized to the Na+-K+ ATPase content. Western blotting results were quantified using the Fusion Solo system (Vilber Lourmat, Collegien, France). The plasma membrane fraction was prepared by ultracentrifugation. Kazinol E-treated preadipocytes were lysed in ice-cold lysis buffer (0.02 M HEPES, 0.25 M sucrose and 2 mM EGTA, pH 7.4)) and then the cell suspension was passed through a 25-gauge needle 10 times using a 1 ml syringe. To remove cellular debris and nuclei, the cell lysate was centrifuged at 700  g for 10 min. The supernatant was collected and further centrifuged at 760  g for 10 min to remove mitochondria. The obtained supernatant was ultracentrifuged (Beckman Ti-90

ACCEPTED MANUSCRIPT rotor) at 35,000  g for 60 min, and the resulting pellet was used as the plasma membrane fraction.

T

2.9. Statistical analysis

RI P

Data are presented as means ± SD of triplicates and significance was assessed by one-way ANOVA and Student’s t-test. P <0.05 was considered a significant difference.

SC

3. Results

3.1. Kazinol B from BK regulated adipocyte differentiation

MA NU

We measured intracellular lipid accumulation as a typical marker of MDI-induced adipocyte differentiation using ORO staining to assess the insulin-sensitizing activity of test samples. The ethyl acetate soluble fraction (30 μg/mL) of BK extract increased adipogenesis by 2.0-fold compared with MDI-only treated cells. To identify the adipogenic constituents, the ethyl acetate fraction was subjected to an isolation process, which resulted in

ED

identification of kazinol B as an active compound. Rosiglitazone was used as a PPAR agonist (1 μM) control to induce adipogenesis.

PT

The active compound, identified as kazinol B (2, 10 and 20 μM) dose-dependently increased lipid accumulation by 2.4-fold (at 20 μM) treatment as compared with MDI-treated

CE

cells (Fig. 1A). Kazinol B showed no toxicity to adipocytes at the concentrations used, as

AC

indicated by MTT assay (Fig. 1B).

ACCEPTED MANUSCRIPT

Fig. 1. Effect of kazinol B on adipocyte differentiation and viability. A) Chemical structure of kazinol B. B) 3T3-L1 cells were differentiated in the presence of kazinol B (2, 10 and 20 μM).

T

Cells were stained with Oil Red O (ORO) at differentiation day 8 (D8) and lipid

RI P

accumulation was quantified as described in the Materials and Methods. Adipocytes stained with ORO (magnification, 40) were visualized by light microscopy. C) Pre-adipocytes were incubated with kazinol B for 72 h, and viability was determined by MTT assay. Data are

SC

means  SD of triplicate experiments. ##p<0.01 vs. control; *p<0.05, **p<0.05 vs. MDI.

activity in differentiated adipocytes

MA NU

3.2. Kazinol B increased the expression of adipogenic factors and PPARγ transcriptional As PPARγ and C/EBPα are crucial adipogenic factors, we tested the effects of kazinol B on their expression in MDI-treated 3T3-L1 adipocytes by RT-qPCR and western blot analysis. Kazinol B dose-dependently increased PPARγ and C/EBPα protein and mRNA levels (Fig.

ED

2A and B). Kazinol B also dose-dependently increased PPARγ-driven transcription by 3.4fold at 20 µM as compared to control cells (Fig. 2C). Rosiglitazone was used as a control.

PT

These results indicate that kazinol B increases PPARγ expression, which, in turn, induces the expression of PPAR-responsive genes during adipocyte differentiation.

CE

To clarify the anti-diabetic potential of kazinol B, we evaluated its effect on the adiponectin level, which is inversely associated with DM. As shown in Figure 2D, kazinol B increased the mRNA level of adiponectin in a dose-dependent manner. Kazinol B further

AC

enhanced adiponectin secretion into culture medium during adipocyte differentiation compared with MDI only treated cells. Kazinol B stimulated the gene expression and secretion of adiponectin as an antidiabetic marker.

ACCEPTED MANUSCRIPT

Fig. 2. Effect of kazinol B on PPARγ expression and C/EBPα and PPARγ transactivation in differentiated adipocytes. Preadipocytes were differentiated with or without kazinol B at the

T

indicated concentrations as described in the Materials and Methods. A) Cells were harvested

RI P

on day 5 of differentiation (D5) and protein extracts (30 μg) were analyzed for PPARγ and C/EBPα expression by Western blotting. B) Gene expression level of PPARγ and C/EBPα was determined using RT-qPCR. C) CV-1 cells were transiently transfected with plasmid

SC

mixture containing PPARγ expression vector and tk-PPRE-luciferase (Luc) vector, and then treated with kazinol B. The luciferase activity was measured as described in the Materials and

MA NU

Methods. Data are reported as relative luciferase activities (RLU) divided by β-galactosidase activity. D) Gene expression of adiponectin was determined using RT-qPCR as described above. 3T3-L1 preadipocytes were differentiated in MDI medium containing kazinol B. Conditioned media were collected at D5 and adiponectin concentration was measured. Data

ED

are means ± SD of triplicate experiments. ##p<0.01vs. control; *p<0.05, **p<0.01 vs. MDI.

3.3. Kazinol B improved insulin-induced glucose uptake through GLUT4 translocation

PT

In this study, the fluorescent glucose analogue, 2-NBDG, was employed to monitor glucose uptake by fully differentiated adipocytes and myoblasts in the presence of insulin (Fig. 3A).

CE

The retained 2’NBDG-fluorescence in cells was increased in a dose-dependent manner by kazinol B treatment compared to the insulin control, indicating that kazinol B improved glucose uptake by adipocytes. The efficacy of kazinol B (20 μM) was comparable to that of 1

AC

μM rosiglitazone in adipocytes. In the same manner as adipocytes, kazinol B significantly increased glucose uptake by myotubes compared with the insulin control. These data suggest that kazinol B might be effectively combined with insulin to improve glucose uptake in DM. To further clarify the mechanism of glucose uptake, we accessed the effect of kazinol B on the mRNA level of GLUT4, a major insulin-responsive glucose transporter in adipocytes, by RT-qPCR. During adipocyte differentiation, kazinol B dose dependently increased the MDIstimulated GLUT4 mRNA level up to 4.7-fold as compared with MDI-only treated cells (Fig. 3B). Consistent with the glucose uptake and GLUT4 expression, kazinol B induced translocation of GLUT4 to the plasma membrane, which is required for glucose uptake. As expected, insulin induced GLUT4 expression in the plasma membrane fraction of adipocytes (Fig. 3C). Moreover, combined treatment with kazinol B and insulin remarkably increased GLUT4 expression and translocation to increase glucose uptake. These findings suggest that kazinol B increases glucose uptake by inducing and translocating GLUT4.

ED

MA NU

SC

RI P

T

ACCEPTED MANUSCRIPT

PT

Fig. 3. Effect of kazinol B on insulin-induced glucose uptake through translocation of GLUT4. A) Differentiated 3T3-L1 adipocytes and C2C12 myoblasts were serum-starved and

CE

then exposed to kazinol B (0, 2, 10 and 20 μM) in the presence of insulin (200 nM). After 24 h incubation, 2-NBDG was added and fluorescence retained in the cell monolayer was measured as described in the Materials and Methods. Data are means ± SD of triplicate

AC

experiments. p#<0.05 vs. insulin alone. B) The GLUT4 mRNA level was determined using RT-qPCR. C) 3T3-L1 preadipocytes were pre-incubated for 1 h with kazinol B, followed by insulin stimulation for a further 1 h. Cell lysate and the plasma membrane fraction were prepared for Western blotting analysis. The translocated GLUT4 was normalized to Na+-K+ ATPase content. Data are means ± SD of triplicate experiments. #p<0.05, ##p<0.01 vs. control; **p<0.01 vs. MDI.

3.4. Kazinol B induced the insulin/Akt signaling pathway and AMPK activation To elucidate the underlying mechanism of kazinol B for glucose uptake, we investigated the role of the insulin-signaling pathway. Considering that Akt phosphorylation is essential for the insulin-signaling pathway, we investigated the effect of kazinol B on insulindependent Akt phosphorylation. As shown in Fig. 4A, kazinol B dose-dependently increased insulin-dependent

Akt

phosphorylation.

Kazinol

B

alone

strongly

induced

Akt

ACCEPTED MANUSCRIPT phosphorylation compared with untreated cells, implying a direct effect on Akt phosphorylation. We also evaluated the contribution of AMPK to the insulin-sensitizing effect of kazinol B. As shown in Fig. 4B, kazinol B dose-dependently increased AMPK

T

phosphorylation in the absence of insulin, suggesting a direct effect on AMPK activation.

RI P

Furthermore, kazinol B also increased insulin-stimulated AMPK phosphorylation. These observations suggest that kazinol B from BK improves insulin sensitivity by activating

AC

CE

PT

ED

MA NU

SC

insulin/Akt signaling and the AMPK pathway.

Fig. 4. Effect of kazinol B on Akt and AMPK activation. 3T3-L1 preadipocytes were pretreated for 1 h with kazinol B, followed by 1 h insulin stimulation. Protein blots were incubated with an anti-phospho-Akt (A) or -phospho-AMPK antibody (B). Data represent the mean ± SD of triplicate experiments. #p<0.001 vs. control; †p<0.01vs. kazinol B, 0 M; ‡p<0.01vs. kazinol B, 10 M; §p<0.01vs. kazinol B, 20 M.

Discussion The differentiation of mouse 3T3-L1 preadipocytes to mature adipocytes accompanies intracellular lipid accumulation as a typical marker of adipogenesis. Lipid accumulation can be used to assess the antidiabetic activity of extracts and isolated compounds of plants [15] [16]. Higher lipid content implies an improved insulin-sensitization, resulting in enhanced

ACCEPTED MANUSCRIPT glucose utilization by adipocytes. Notably, rosiglitazone and pioglitazone (a thiazolidinedione antidiabetic drug) induce adipogenesis and glucose uptake by adipocytes [17]. Adipocyte differentiation is orchestrated by adipogenic transcriptional factors, including

T

PPARγ and C/EBPα. At an early stage of differentiation, C/EBPδ and β induce PPARγ and

RI P

C/EBPα expression, essential for terminal adipogenesis. The induction of PPARγ and C/EBPα transactivates adipogenic genes, which contribute to lipid accumulation. PPARγ belongs to the nuclear receptor superfamily and functions as a heterodimer with a retinoid X

SC

receptor (RXR) to control lipid and glucose metabolism in adipose tissue. The binding of agonist, TZDs for example, induces a conformational change in the PPARγ/RXR complex,

MA NU

followed by recruitment of the coactivators required for expression of peroxisome proliferator response element (PPRE)-containing genes. Thus, TZD stimulates adipogenesis and improves insulin sensitivity and hyperglycemia [18]. C/EBPα is a mammalian transcription factor, characterized by the sequence-specific binding to CCAAT motifs within DNA sequences. In middle-stage adipocytes, PPARγ

ED

induces accumulation of C/EBPα, which is crucial for maintenance of differentiation [19]. Therefore, activation of PPARγ and C/EBPα is evidence of the progress of adipogenesis and

PT

improvement of insulin sensitivity. To discover antidiabetic agents, a recent issue of interest has been identifying natural compound PPAR agonists. Flavonoids, isoflavonoids, and

CE

alkaloids from plants can activate PPAR-derived adipogenesis and improve basal and insulin-dependent glucose uptake in 3T3-L1 adipocytes [20, 21].

AC

BK extracts were reported to improve insulin sensitivity by reducing oxidative stress in a diabetic animal model. Polyphenols purified from BK—such as kazinol C, U, and isokazinol D—protect pancreatic β-cells against cytokine-mediated damage, suggesting their potential as therapeutic candidates for DM [13, 22]. Especially, kazinol B was reported to inhibit LPS-induced inflammation in macrophages [8]. As inflammation increases the risk of development of metabolic disorders such as type 2 DM, we expected kazinol B to be a promising insulin sensitizer. As expected, kazinol B significantly increased intracellular lipid accumulation without cytotoxicity (Fig. 1). In a preliminary study, we isolated three compounds from BK (Fig. S1). As shown in Fig. S2, compound 1 (kazinol B) showed potent stimulant of adipogenesis at 10 μM, as indicated by ORO staining. These compounds are favans substituted with prenyl groups at different positions. Kazinol B is a ring-closed form of compound 2. This 2,2-dimethylpyran ring formed by a prenyl group at C-3 and hydroxy group at C-4 might be important for the

ACCEPTED MANUSCRIPT adipogenic activity of kazniol B. Thus, further study is needed to disclose the structural basis of the mechanism of action and antidiabetic effect of the compounds. Moreover, kazinol B stimulated the expression of PPARγ and C/EBPα (Fig. 2A and B)

T

and activated PPAR-responsive gene expression according to a reporter gene assay (Fig. 2C).

RI P

The induction of adipogenesis by kazinol B suggested its potential for enhancing insulin sensitivity and glucose uptake by adipocytes. Most antidiabetic compounds have been reported to activate glucose uptake by differentiated 3T3-L1 cells and myotubes [23, 24]. In

SC

this study, kazinol B induced 2-NBDG uptake by fully differentiated adipocytes and myoblasts in the presence or absence of insulin (Fig. 3A).

MA NU

Impaired glucose transport causes insulin resistance in DM. Glucose uptake is dependent on glucose transporters, and GLUT4 is a representative insulin-sensitive isoform in adipocytes [25]. Glucose utilization is regulated by the translocation of GLUT4 from intracellular vesicles to the cell membrane of adipocytes. Recent studies report that various factors including adiponectin or insulin signaling mediators might control total GLUT4

ED

expression and translocation in response to insulin [26]. Kazinol B increased the gene expression (Fig. 3B) and total protein content of GLUT4 (Fig. S3A) during differentiation. In

PT

addition, short-term exposure to insulin and kazinol B induced GLUT4 translocation without an increase in the protein content (Fig. S3B). These results suggest that GLUT4 translocation

CE

to the plasma membrane plays an essential role in glucose uptake mediated by kazinol B. A low circulating level of adiponectin, an adipokine secreted from adipocytes, is a marker of diabetes [27]. Adiponectin secretion is negatively correlated with adipose tissue mass and

AC

insulin resistance, and positively associated with insulin sensitivity. Trans-cinnamic acid was reported to enhance adiponectin production by adipocytes and to improve insulin sensitivity [28]. 7-O-Galloyl-D-sedoheptulose, isolated from Corni fructus, prevents diabetes by increasing the adiponectin level in high-fat-fed mice [29]. As shown in Fig. 4, kazinol B stimulates the expression and secretion of adiponectin during differentiation (Fig. 2D). Insulin signaling has been implicated in the regulation of PPARγ expression and adipocyte differentiation. Conversely, PPARγ directly regulates the expression of molecules involved in the insulin-signaling pathway. Insulin-activated insulin receptor sequentially phosphorylates various mediators, including insulin receptor substrate (IRS), Akt/protein kinase B (PKB) and AS160. Phosphorylated AS160 augments the accumulation of GTPbound Rab proteins, which is required for tethering and fusion of GLUT4-containing vesicles with the plasma membrane [30]. We determined that kazinol B significantly induced Akt phosphorylation in an insulin-dependent manner, implying that kazinol B-mediated glucose

ACCEPTED MANUSCRIPT uptake might be stimulated via activation of insulin signaling, which triggers Akt phosphorylation. In addition, kazinol B directly activated the insulin/Akt-signaling pathway (Fig. 4A).

T

AMPK has received attention for the development of antidiabetic agents due to its

RI P

regulatory role in glucose and lipid metabolism. Wu et al. reported that AMPK increases glucose uptake via adiponectin signaling in primary rat adipocytes [31]. Various AMPK activators improve glucose uptake in adipocytes [32, 33]. The AMPK agonist, 5-

SC

aminoimidazole-4-carboxy-amide-1-D-ribofuranoside (AICAR), and metformin have been reported to enhance glucose uptake through AMPK activation. Metformin is used in patients

MA NU

with type 2 diabetes.

Although these AMPK agonists elevate basal and insulin-dependent glucose uptake [34, 35], cooperation between AMPK and insulin signaling in glucose uptake by adipocytes is controversial [36]. In this study, we found that kazinol B induces basal and insulin-stimulated AMPK activation (Fig. 4B). However, we did not identify the molecular target of kazinol B

ED

in the cross talk between insulin signaling and AMPK activation. Therefore, kazinol B improves glucose uptake and insulin sensitivity via insulin signaling

PT

and AMPK activation. These findings suggest that kazinol B from B. kazinoki can be used as

AC

CE

a lead compound for development of anti-diabetic drugs (Fig. 5).

Fig. 5. Kazinol B-induced insulin sensitization via insulin signaling and AMPK activation.

Acknowledgements This study was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (No. 2011-0030074 and NRF-2015R1D1A4A01019006).

Conflict of Interest

ACCEPTED MANUSCRIPT The authors declare no conflict of interest.

T

References

RI P

[1] L.N. Cong, H. Chen, Y. Li, L. Zho, M.A. McGibbon, S.I.Taylor, Physiological role of Akt in insulin-stimulated translocation of GLUT4 in transfected rat adipose cells, Mol. Endocrinol. (Baltimore, Md.). 11 (1997) 1881-90.

SC

[2] J.A. Viscarra, C.D. Champagne, D.E. Crocker, R.M. Ortiz, 5'AMP-activated protein kinase activity is increased in adipose tissue of northern elephant seal pups during prolonged

MA NU

fasting-induced insulin resistance, J. Endocrinol. 209 (2011) 317-25. [3] J.O. Lee, S.K. Lee, J.H. Kim, N. Kim, G.Y. You, J.W. Moon, Metformin regulates glucose transporter 4 (GLUT4) translocation through AMP-activated protein kinase (AMPK)mediated Cbl/CAP signaling in 3T3-L1 preadipocyte cells, J. Biol. Chem. 287 (2012) 441219.

ED

[4] F. Hajiaghaalipour, M. Khalilpourfarshbafi, A. Arya, Modulation of glucose transporter protein by dietary flavonoids in type 2 diabetes mellitus, Int. J. Biol. Sci. 11 (2015) 508-24.

PT

[5] H. Lee, H. Ha, J.K. Lee, S.J. Park, S.I. Jeong, H.K. Shin, The Leaves of Broussonetia kazinoki Siebold Inhibit Atopic Dermatitis-Like Response on Mite Allergen-Treated Nc/Nga

CE

Mice, Biomol. Ther. 22 (2014) 438-44. [6] Y.R. Cho, J.H. Kim, J.K. Kim, E.K. Ahn, H.J. Ko, J.K. In, Broussonetia kazinoki modulates the expression of VEGFR-2 and MMP-2 through the inhibition of ERK, Akt and

AC

p70S6Kdependent signaling pathways: Its implication in endothelial cell proliferation, migration and tubular formation, Oncol. Rep. 32 (2014) 1531-6. [7] B.L. Wei, Y.C. Chen, H.Y. Hsu, Kazinol Q from Broussonetia kazinoki enhances cell death induced by Cu(II) through increased reactive oxygen species, Molecules. 16 (2011) 3212-21. [8] J.H. Ryu, H. Ahn, H.J. Lee, Inhibition of nitric oxide production on LPS-activated macrophages by kazinol B from Broussonetia kazinoki, Fitoterapia. 74 (2003) 350-4. [9] J.H. Hwang, B.M. Lee, Inhibitory effects of plant extracts on tyrosinase, L-DOPA oxidation, and melanin synthesis, J. Toxicol. Environ. Health A. 70 (2007) 393-407. [10] J. Hwang, S.J. Lee, M. Yoo, G.Y. Go, Y. Lee da., Y.K. Kim, et al., Kazinol-P from Broussonetia kazinoki enhances skeletal muscle differentiation via p38MAPK and MyoD, Biochem. Biophys. Res. Commun. 456 (2015) 471-5. [11] J.Y. Cha, Y.T. Kim, H.S. Kim, Y.S. Cho, Antihyperglycemic effect of stem bark powder

ACCEPTED MANUSCRIPT from paper mulberry (Broussonetia kazinoki Sieb.) in type 2 diabetic Otsuka Long-Evans Tokushima fatty rats, J. Med. Food. 11 (2008) 499-505. [12] M. Shibano, D. Tsukamoto, R. Fujimoto, Y. Masui, H. Sugimoto, G. Kusano, Studies on

T

the constituents of Broussonetia species. VII. Four new pyrrolidine alkaloids, broussonetines

RI P

M, O, P, and Q, as inhibitors of glycosidase, from Broussonetia kazinoki SIEB, Chem. Pharm. Bull. 48 (2000) 1281-5.

[13] U.J. Bae, Y. Lee da, M.Y. Song, S.M. Lee, J.W. Park, J.H. Ryu, et al., A prenylated

SC

flavan from Broussonetia kazinoki prevents cytokine-induced beta-cell death through suppression of nuclear factor-kappaB activity, Biol. Pharm. Bull. 34 (2011) 1026-31.

MA NU

[14] A.Y. Kim, C.G. Lee, Y. Lee da, H. Li, R. Jeon, J.H. Ryu, et al., Enhanced antioxidant effect of prenylated polyphenols as Fyn inhibitor, Free Radic. Biol. Med. 53 (2012) 1198-208. [15] Z.Y. Qin, M. Zhang, X.R. Guo, Y.M. Wang, G.Z. Zhu, Y.H. Ni, et al., alpha-Lipoic acid ameliorates impaired glucose uptake in LYRM1 overexpressing 3T3-L1 adipocytes through the IRS-1/Akt signaling pathway, J. Bioenerg. Biomembr. 44 (2012) 579-86.

ED

[16] S.N. Kim, H.Y., W. Lee, G.M. Park, W.S. Shin, Y.K. Kim, Sargaquinoic acid and sargahydroquinoic acid from Sargassum yezoense stimulate adipocyte differentiation through

PT

PPARalpha/gamma activation in 3T3-L1 cells, FEBS Lett. 582 (2008) 3465-72. [17] C. Nugent, J.B. Prins, J.P. Whitehead, D. Savage, J.M. Wentworth, V.K. Chatterjee, et al.,

CE

Potentiation of glucose uptake in 3T3-L1 adipocytes by PPAR gamma agonists is maintained in cells expressing a PPAR gamma dominant-negative mutant: evidence for selectivity in the downstream responses to PPAR gamma activation, Mol. Endocrinol. 15 (2001) 1729-38.

AC

[18] R. Mukherjee, P.J. Davies, D.L. Crombie, E.D. Bischoff, R.M. Cesario, L. Jow, et al., Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists, Nature. 386 (1997) 407-10.

[19] Z. Cao, R.M. Umek, S.L. McKnight, Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells, Genes. Dev. 5 (1991) 1538-52. [20] R.B. El-Houri, J. Mortier, M.S. Murgueitio, G. Wolber, L.P. Christensen, Identification of PPARgamma Agonists from Natural Sources Using Different In Silico Approaches, Planta Med. 81 (2015) 488-94. [21] D. Kotowska, R.B. El-Houri, K. Borkowski, R.K. Petersen, X.C. Frette, G. Wolber, et al., Isomeric C12-alkamides from the roots of Echinacea purpurea improve basal and insulindependent glucose uptake in 3T3-L1 adipocytes, Planta Med. 80 (2014) 1712-20. [22] U.J. Bae, H.Y. Jang, J.M. Lim, L. Hua, J.H. Ryu, B.H. Park, Polyphenols isolated from Broussonetia kazinoki prevent cytokine-induced beta-cell damage and the development of

ACCEPTED MANUSCRIPT type 1 diabetes, Exp. Mol. Med. 47 (2015) e160. [23] K.N. Zhu, C.H. Jiang, Y.S. Tian, N. Xiao, Z.F. Wu, Y.L. Ma, et al., Two triterpeniods from Cyclocarya paliurus (Batal) Iljinsk (Juglandaceae) promote glucose uptake in 3T3-L1

T

adipocytes: The relationship to AMPK activation, Phytomedicine. 22 (2015) 837-46.

RI P

[24] Y. Shen, N. Honma, K. Kobayashi, L.N. Jia, T. Hosono, K. Shindo, et al., Cinnamon extract enhances glucose uptake in 3T3-L1 adipocytes and C2C12 myocytes by inducing LKB1-AMP-activated protein kinase signaling, PloS one. 9 (2014) e87894.

SC

[25] Z. Wu, Y. Xie, R.F. Morrison, N.L. Bucher, S.R. Farmer, PPARgamma induces the insulin-dependent glucose transporter GLUT4 in the absence of C/EBPalpha during the

MA NU

conversion of 3T3 fibroblasts into adipocytes, J. Clin. Invest. 101 (1998) 22-32. [26] Y. Fu, N. Luo, R.L. Klein, W.T. Garvey, Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation, J. Lipid Res. 46 (2005) 1369-79. [27] J.P. Whitehead, A.A. Richards, I.J. Hickman, G.A. Macdonald, J.B. Prins, Adiponectin-a key adipokine in the metabolic syndrome, Diabetes Obes. Metab. 8 (2006) 264-80.

ED

[28] C. Kopp, S.P. Singh, P. Regenhard, U. Muller, H. Sauerwein, M. Mielenz, Transcinnamic acid increases adiponectin and the phosphorylation of AMP-activated protein kinase

PT

through G-protein-coupled receptor signaling in 3T3-L1 adipocytes, Int. J. Mol. Sci. 15 (2014) 2906-15.

CE

[29] C.H. Park, T. Tanaka, T. Yokozawa, Evaluation of 7-O-galloyl-D-sedoheptulose, isolated from Corni Fructus, in the adipose tissue of type 2 diabetic db/db mice, Fitoterapia. 89 (2013) 131-42.

AC

[30] L. Eguez, A. Lee, J.A. Chavez, C.P. Miinea, S. Kane, G.E. Lienhard, et al., Full intracellular retention of GLUT4 requires AS160 Rab GTPase activating protein, Cell Metab. 2 (2005) 263-72.

[31] X. Wu, H. Motoshima, K. Mahadev, T.J. Stalker, R. Scalia, B.J. Goldstein, Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes, Diabetes. 52 (2003) 1355-63. [32] Y.H. Kuo, C.H. Lin, C.C. Shih, Caffeamide 36-13 Regulates the Antidiabetic and Hypolipidemic Signs of High-Fat-Fed Mice on Glucose Transporter 4, AMPK Phosphorylation, and Regulated Hepatic Glucose Production, Evid. Based Complement. Alternat. Med. 2014 (2014) 821569. [33] S. Yamaguchi, H. Katahira, S. Ozawa, Y. Nakamichi, T. Tanaka, T. Shimoyama, et al., Activators of AMP-activated protein kinase enhance GLUT4 translocation and its glucose transport activity in 3T3-L1 adipocytes, Am. J. Physiol. Endocrinol. Metab.. 289 (2005)

ACCEPTED MANUSCRIPT E643-9. [34] J. Grisouard, K. Timper, T.M. Radimerski, D.M. Frey, R. Peterli, B. Kola, et al., Mechanisms of metformin action on glucose transport and metabolism in human adipocytes,

T

Biochem Pharmacol. 80 (2010) 1736-45.

RI P

[35] J. Liu, C. Ye, W. Liu, W. Zhao, Y.J. Zhang, H. Zhang, H. Ying, AICAR enhances insulin signaling via downregulation of miR-29. Can. J Physiol. Pharmacol. 12 (2015) 1-7. [36] M.P. Gaidhu, R.B. Cedddia, The role of adenosine monophosphate kinase in remodeling

AC

CE

PT

ED

MA NU

SC

white adipose tissue metabolism. Exerc. Sport Sci. Rev. 39(2011) 102-8.

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

Graphical abstract