Keratin 17 activates AKT signalling and induces epithelial-mesenchymal transition in oesophageal squamous cell carcinoma

Journal Pre-proof Keratin 17 activates AKT signalling and induces epithelialmesenchymal transition in oesophageal squamous cell carcinoma

Zhun Liu, Shaobin Yu, Shuting Ye, Zhimin Shen, Lei Gao, Ziyang Han, Peipei Zhang, Fei Luo, Sui Chen, Mingqiang Kang PII:

S1874-3919(19)30329-X

DOI:

https://doi.org/10.1016/j.jprot.2019.103557

Reference:

JPROT 103557

To appear in:

Journal of Proteomics

Received date:

23 July 2019

Revised date:

18 September 2019

Accepted date:

17 October 2019

Please cite this article as: Z. Liu, S. Yu, S. Ye, et al., Keratin 17 activates AKT signalling and induces epithelial-mesenchymal transition in oesophageal squamous cell carcinoma, Journal of Proteomics (2018), https://doi.org/10.1016/j.jprot.2019.103557

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof

Ke ratin 17 activates AKT s ignalling and induces epithelial-mesenchymal trans ition in oesophageal squamous cell carcinoma

Zhun Liu1,* , Shaobin Yu1,* , Shuting Ye2 , Zhimin Shen1 , Lei Gao1 , Ziyang Han1 , Peipei Zhang1 ,

Department of Thoracic Surgery, Fujian Medical University Union Hospital, Fuzhou 350001,

ro

1

of

Fei Luo1 , Sui Chen1,# , Mingqiang Kang1,2.3,#

Key Laboratory of Gastrointestinal Cancer (Fujian Medical University), Ministry of Education,

lP

2

re

-p

China

Fujian Key Laboratory of Tumor Microbiology, Fujian Medical University, Fuzhou 350122,

Jo

China

ur

3

na

Fuzhou 350122, China

*Zhun Liu and Shaobin Yu contributed equally to this work.

#

Correspondence:

Mingqiang

Kang

([email protected])

or

Sui

Chen

([email protected]), Fujian Medical University Union Hospital, No. 29, Xinquan Rd, Gulou District, Fuzhou, Fujian 350001, P.R. China.

Journal Pre-proof

Abstract Oesophageal squamous cell carcinoma (ESCC) is an aggressive malignancy and a leading cause of cancer-related death worldwide. Lack of effective early diagnosis strategies and ensuing complications from tumour metastasis account for the majority of ESCC death. Thus,

of

identification of key molecular targets involved in ESCC carcinogenesis and progression is

ro

crucial for ESCC prognosis. In this study, four pairs of ESCC tissues were used for mRNA

-p

sequencing to determine differentially expressed genes (DEGs). 347 genes were found to be upregulated whereas 255 genes downregulated. By screening DEGs plus bioinformatics analyses

re

such as KEGG, PPI and IPA, we found that there were independent interactions between KRT

lP

family members. KRT17 upregulation was confirmed in ESCC and its relationship with

na

clinicopathological features were analysed. KRT17 was significantly associated with ESCC

ur

histological grade, lymph node and distant metastasis, TNM stage and five-year survival rate.

Jo

Upregulation of KRT17 promoted ESCC cell growth, migration, and lung metastasis. Mechanistically, we found that KRT17-promoted ESCC cell growth and migration was accompanied by activation of AKT signalling and induction of EMT. These findings suggested that KRT17 is significantly related to malignant progression and poor prognosis of ESCC patients, and it may serve as a new biological target for ESCC therapy.

Keywords: Keratin 17; Oesophageal squamous cell carcinoma; The serine/threonine protein kinase AKT; Epithelial- mesenchymal transition

Journal Pre-proof

Significance Oesophageal cancer is one of the leading causes of cancer mortality worldwide and oesophageal squamous cell carcinoma (ESCC) is the major histological type of oesophageal cancer in Eastern

of

Asia. However, the molecular basis for the development and progression of ESCC remains

ro

largely unknown. In this study, RNA sequencing was used to establish the whole-transcriptome

-p

profile in ESCC tissues versus the adjacent non-cancer tissues and the results were bioinformatically analyzed to predict the roles of the identified differentially expressed genes.

re

We found that upregulation of KRT17 was significantly associated with advanced clinical stage,

lP

lymph node and distant metastasis, TNM stage and poor clinical outcome. Keratin 17 (KRT17)

na

upregulation in ESCC cells not only promoted cell proliferation but also increased invasion and

ur

metastasis accompanied with AKT activation and epithelial- mesenchymal transition (EMT).

Jo

These data suggested that KRT17 played an important role in ESCC development and progression and may serve as a prognostic biomarker and therapeutic target in ESCC.

1. Introduction Oesophageal cancer ranks sixth in cancer-related causes of death and is one of the seventh most aggressive malignancy worldwide [1]. Histologically, ESCC is the most prevalent type of EC pathology [2], predominating in most of the Asian regions [3, 4]. Even with improvements in operational strategies and targeted therapy which is one of the most promising strategies for the

Journal Pre-proof

treatment of multiple malignancies [5], ESCC patients still have a poor prognosis with the 5- year overall survival rate being as low as 15%-25% [6, 7]. Therefore, it is imperative to reveal molecular mechanisms and identify more sensitive and specific molecular markers involved in ESCC progression in hopes to improve early diagnosis and prognosis of ESCC. Keratin is a member of the intermediate filament family that makes up the cytoskeleton with

of

a molecular weight of approximately 40-70 kDa, and can be divided into type I keratin and type

ro

II keratin [8, 9]. KRT17 is a type I keratin and is generally distributed in epithelial cells [10, 11].

-p

KRT17 is not expressed in the epidermis of normal skin but inducible under stress conditions

re

such as skin scratching [12]. KRT17 has been shown to play a critical role as a multifunctional

lP

promoter and oncogene to promote proliferation, migration, invasion, and subsequent fatal

na

outcome of malignant tumours [13-16]. Concurrently, other studies have also indicated that KRT17 is not expressed in non-tumour areas, but its expression is increased in tumour tissues

ur

[17]. Furthermore, the high expression level of KRT17 has been reported to tightly relate to the

Jo

occurrence of EMT, implicating an additional significant effect of KRT17 on boosting the survival and metastasis of cancer cells [18]. However, whether KRT17 can function as an oncogene in ESCC and how its overexpression is regulated in ESCC is unclear. The present study demonstrated that KRT17 was significantly upregulated in ESCC and that its expression was associated with advanced clinical stage, lymph node metastasis and invasiveness. Patients with high levels of KRT17 had a decreased five-year survival rate as compared with patients with lower levels of KRT17. Mechanistically, KRT17 can activate AKT signalling pathway and promote EMT occurrence. These data suggest that KRT17 plays a crucial

Journal Pre-proof

role in the tumorigenesis and progression of ESCC and may serve as a potential prognostic biomarker and therapeutic target in ESCC.

2. Materials and Methods Tissue samples

of

Sixty-four human ESCC samples and their corresponding adjacent normal tissues were

ro

collected immediately after surgical resection at Fujian Medical University Union Hospital from

-p

2009 to 2011 (Fuzhou, China). All of the specimens were directly stored at liquid nitrogen.

re

Clinical staging was determined according to the American Joint Committee on Cancer (AJCC)

lP

Eighth Edition of ESCC TNM staging. Written informed consent and approval from the Ethics

collected.

ur

mRNA sequencing analysis

na

Committee of Fujian Medical University Union Hospital was received for all the tissues

Jo

Four pairs of ESCC tissues and corresponding adjacent normal tissues that were randomly chosen from the collected specimens were used for mRNA sequencing to determine differentially expressed genes. mRNA sequencing was performed based on the manufacturer's standard protocols (Novogene Co., LTD, China). The image data of the sequencing fragment detected by the high-throughput sequencer was converted to sequence data by CASAVA base recognition. HISAT2 v2.0.5 was used to construct the index of the reference genome and compare the paired-end clean reads with the reference genome. FeatureCounts was used to calculate the reads mapped to each gene. Then, Reads Per Kilobase of exon model per Million

Journal Pre-proof

mapped reads (FPKM) of each gene was calculated based on the length of the gene, and the reads mapped to the gene calculated to estimate the gene expression level. Differential expression between tumour tissues and adjacent normal tissues was analysed using DESeq2 R software (1.16.1) and the Benjamini- Hochberg method was used to adjust the p-value. The FDR was calculated to correct the p- value. A corrected p- value <0.01 and log2 fold-change ≥2.0 was

of

used as the threshold for significant differential expression. The clustering of index-coded

ro

samples was performed on a cBot Cluster Generation System using a TruSeq PE Cluster kit

-p

v3-cBot-HS (Illumina). Hierarchical clustering was performed to provide an overview of the

re

characteristics of the expression profiles based on the values of all significantly differentially

the

SRA

accession

number

of

“PRJNA562770”

via

the

following

link:

na

with

lP

expressed genes. The raw RNA-seq data was deposited into NCBI Sequence Read Archive (SRA)

https://www.ncbi.nlm.nih.gov/sra/PRJNA562770.

ur

Bioinformatics analysis

Jo

Gene Ontology (GO) enrichment analysis shows the GO terms in which the DEGs were enriched. It represents important or typical biological functions. Differentially expressed genes were identified by the clusterProfiler R package. The Kyoto Encyclopedia of Genes and Genomes (KEGG) summarizes the pathway interactions among differentially expressed genes in disease states and reveals reasons for pathway activation. KEGG is established by genome sequencing and

other

high- throughput

experimental

technologies

(http://www.genome.jp/kegg/).

Protein-Protein Interaction (PPI) analysis was performed on heterologous genes based on known and predicted protein-protein interactions in the STRING database [19]. The interactions include

Journal Pre-proof

direct physical and indirect functional associations. Ingenuity Pathway Analysis (IPA) was conducted by Ingenuity Knowledge Base (genes only) to build and explore transcriptional networks, microRNA- mRNA target networks, phosphorylation cascades, and protein-protein or protein-DNA interaction networks and identify regulatory events that lead from signalling events to transcriptional effects. Upstream Regulator Analysis was performed to predict upstream

ro

expression changes based on Ingenuity Knowledge Base.

a

rabbit

anti-KRT17

antibody

was

performed

on

formalin- fixed,

re

with

-p

Immunohistochemical staining IHC

of

molecules including microRNA and transcription factors that may account for the observed gene

lP

paraffin-embedded tissue sections of 4 to 5 μm cut from TMAs and placed on glass slides. A

na

5-tiered scale was used to assess the degree of nuclear or cytoplasmic staining based on the average percentage of positively stained cells: 0, 0% positive cells; 1, 1-25% positive cells; 2,

ur

26%-50% positive cells; 3, 51%-75% positive cells; 4, 76-100% positive cells, which was

Jo

multiplied by the staining intensity (0, no staining; 1, weak staining, light yellow; 2, moderate staining, yellow-brown; and 3, strong staining, brown) to obtain a score ranging from 0 to 12. A score of less than 4 was considered low KRT17 expression, and a score greater than 4 was deemed high KRT17 expression. Haematoxylin and eosin staining The ESCC tissue sections of different groups were subjected to conventional dewaxing and rehydration followed by HE staining. Then, light microscopy was used to observe the pathological changes in the ESCC tissue.

Journal Pre-proof

Western blotting analysis Tissues or cells were lysed in Western & IP cell lysis buffer (Beyotime, Shanghai, China) with PMSF (Amresco, Solon, Ohio, USA) for 30 min on ice at 4 °C, followed by centrifugation at 12,000 × g for 10 min at 4 °C. The supernatants were collected as total proteins and then measured using a BCA Protein Assay kit (Thermo Scientific, Waltham, MA, USA). The same

of

amount of proteins in each well was separated by 10% SDS-PAGE and transferred to a 0.45 µm

ro

PVDF membrane (Amersham Hybond, GE Healthcare, München, Germany), blocked in 0.5%

-p

bovine serum albumin (Amresco, Solon, Ohio, USA) followed by incubation overnight at 4 °C

re

with specific antibodies. The following primary antibodies were used: rabbit anti-KRT17

lP

antibody (1:1 000, Abcam, ab51056), mouse anti-β-actin (1:1 000, Abcam, ab8226), rabbit

na

anti-ZO-1 (1:1 000; Cell Signaling Technology), rabbit anti-slug (1:1 000; Cell Signaling Technology), rabbit anti-N-cadherin (1:1 000; Cell Signaling Technology), rabbit anti-vimentin

ur

(1:1 000; Cell Signaling Technology), rabbit anti-pan-AKT (1:1 000; Cell Signaling Technology),

Jo

rabbit anti-Ser473-AKT (1:1 000; Cell Signaling Technology) at 4 °C overnight. After three 10 min washes in TBST, the membrane was further incubated with the secondary antibodies for 1 h at room temperature, and the blots were developed using enhanced chemiluminescence (Lulong Biotech, Xiamen China). RNA extraction and quantitative real-time PCR Total RNA was extracted from cultured cells or frozen tissues using TRIzol reagent (Ambion, Carlsbad CA, USA), and 1 mg of RNA was reverse transcribed to cDNA using an RT Reagent kit (Takara, Dalian, China). Quantitative PCR was performed in an Mx3000P QPCR

Journal Pre-proof

system (Agilent Technologies, Santa Clara, CA, USA) by using the SYBR PremixExX Taq kit (Takara, Shiga, Japan). Paired primers were used to detect the relative expression levels of the target genes by the 2-ΔΔCt method with 3 repeated experiments. The expression level was normalized against endogenous GAPDH. All primers were designed by BioSune Biotechnology Co., Ltd (Shanghai, China) and their sequences were listed in Supplementary Table S1.

of

Cell culture

ro

Human ESCC cell lines EC9706, Eca109 EC9706, KYSE140, KYSE410 and TE-1 were

-p

purchased from Hunan Fenghbio Biological Ltd., China. Cells were grown in RPMI-DMEM

re

(Gibco) supplemented with 10% FBS (Gibco) and incubated in an atmosphere of 5% CO 2 at

lP

37 °C.

na

CRISPR/Cas9-mediated KRT17 knockout

CRISPR guide RNAs were designed based on their specificity score retrieved from the

ur

Optimized CRISPR Design web tool (https://crispr.mit.edu). KRT17 was knocked down in

Jo

EC9706 and Eca109 cells using a KRT17 sgRNA CRISPR/Cas9 All- in-One Lenti-vector (U6-sgRNA-SV40-EGFP) set (System Biosciences, Mountain View, CA, USA), which contained KRT17-specific target sequences (GTAGTACTGGCTGTAGTCAC) and scrambled sequences, according to the manufacturer’s instructions. We established KRT17 knockout (-KO-KRT17) and control (-Ctrl-KRT17) ESCC cells. The cell culture medium was replaced 24 h after transfection and cells were recovered for 48 h. For FACS sorting 1  106 cells were gently detached from the 6-cm culture plate with 0.25% trypsin- EDTA (Gibco) and resuspended in PBS containing 10% FBS. EGFP-positive cells were isolated by FACS (BD Facs Aria IIIu Sorter),

Journal Pre-proof

and single cells sorted into each well of a 96-well plate. Cell clones were expanded for three weeks and then screened for KRT17 knockout by Western blot analysis. Plasmids and the generation of stable ESCC cell lines The opening reading frame of the human KRT17 gene was PCR-amplified and cloned into the lentivirus expression vector Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin (System

of

Biosciences, Mountain View, CA, USA). The recombinant plasmid or empty vector was

ro

co-transfected with packaging plasmids MDL, pVSV, and pRev into 293T cells. The

-p

supernatants were collected 48 h post-transfection and used to infect ESCC cells cultured in

re

6-cm dishes. The puromycin-resistant clones were expanded into cell lines as KRT17

lP

overexpressing cells (-P-KRT17) or empty control cells (-pCDH-KRT17). The expression level

Colony formation assay

na

of KRT17 in the cell lines was evaluated by western blot analysis.

ur

A total of 500 cells were plated into 60- mm plates with RPMI-1640 medium containing 10%

Jo

FBS and cultured at 37 °C under 5% CO 2 for 14 days. Colonies were stained with crystal violet for 5 min, and the number of colonies containing 50 or more cells was counted. Surviving colonies (>50 cells per colony) were calculated and photographed with a Q imaging Micropublisher 5.0 RTV microscope camera (Olympus, Tokyo, Japan). Cell proliferation assay Cell proliferation was assessed using a Cell Counting Kit-8 (CCK-8, Dojindo, Kuma- moto japan). Cells were seeded at a density of 2,000 cells per well in 96-well plates and incubated at 37°C in 5% CO 2 for 24, 48, 72, 96 or 120 h. Ten microliters of CCK-8 solution was added to

Journal Pre-proof

each well and incubated at 37 °C for 2 h. The absorbance at 450 nm was measured using a microplate reader (Bio-Tek, Winooski, VT, USA). Wound healing assay Cell migration was examined in a wound healing assay. Cells were seeded in 6-well plates and incubated at 37°C in 5% CO 2 for 24 h until they were 100% confluent. Wounds were created

of

with a 200 µl disposable pipette tip. After washing with PBS, the fresh culture medium was

ro

added and the cells were cultured for 24 h and 48 h at which point the wound closure was

-p

photographed.

re

Cell migration assay

lP

A total of 4×104 cells in serum- free medium were plated into the upper chamber of a

na

Trans-well insert (8- mm pore size; BD Bioscience). The medium containing 10% fetal bovine serum in the lower chamber served as the chemoattractant. After 24 h of incubation at 37 °C in a

ur

5% CO 2 humidified incubator, the cells that did not migrate or invade through the pores in the

Jo

upper chamber were removed with a cotton swab, and then the lower surface of filter was stained with 0.1% crystal violet in 20% methanol for 10 min, imaged, and counted using a Qimaging Micropublisher 5.0 RTV microscope camera (Olympus). In vivo study Female BALB/c nude mice (4 weeks old, Shanghai, China) were randomly divided into four groups. A total of 2×106 KRT17 upregulated and knockout EC9706 cells, and the respective control groups were resuspended in 0.2 ml of PBS. In the metastasis study, cells were injected intravenously via the lateral tail vein in four nude female BALB/c mice. At 12 weeks

Journal Pre-proof

post-injection, all mice were euthanized, and the lungs and liver were removed. Metastasis of the lungs and liver was thoroughly examined under a dissecting microscope. For the in vivo growth study, 2×106 KRT17 upregulated and knockout EC9706 were inoculated subcutaneously into the right upper extremity axilla of four nude female BALB/c mice. The tumour volume was determined by the formula: length × width2 /2. All animal studies were approved by the Fujian

of

Medical University Institutional Animal Care and Use Committee.

ro

Statistical analysis

-p

Statistical analyses were performed using SPSS version 23.0 (IBM Corporation) for

re

Windows and GraphPad Prism 7 (San Diego, CA) software. All data used for the analysis were

lP

expressed as the mean ± SD from 3 independent assays. Clinicopathological characteristics were

na

analysed by the chi-square test. Survival curves were evaluated using the Kaplan-Meier method. All p-values were determined from 2-tailed tests, and differences with a p- value < 0.05 were

3. Results

Jo

ur

considered statistically significant.

3.1 Identification of differentially expressed genes in ESCC tissues We performed high- throughput mRNA sequencing analysis to comprehensively define the transcriptomic changes in four pairs of ESCC samples (Supplementary Fig. S1). Hierarchical clustering (Fig. 1A) was used to demonstrate the gene expression patterns. We found that 602 genes showed significant changes in expression, including 347 upregulated and 255

Journal Pre-proof downregulated genes (with a fold-change ≥ 2.0, p-adj < 0.01). To provide an overview of the differential status of gene expression, volcano plots were drawn in which the fold change of gene expression was displayed on the x-axis and the significance of difference in gene expression between pools was shown on the y-axis (Fig. 1B). We also performed pathway analysis to identify critical signal regulation pathways according to the KEGG database and found that the

of

pathway related to cell cycle was the most significantly enriched pathway among these top 20

ro

significant KEGG pathways including the well-known PI3K−AKT signalling pathway and the

-p

pathways associated with the infection and inflammatory network and protein metabolism

re

network (Fig. 1C). Upstream analysis was used to predict a link between upstream molecules,

lP

which may result in observed changes in gene expression (Fig. 1D). The genes were arranged

na

into three domains: biological process, cellular component, and molecular function. GO enrichment analysis of the DEGs showed that the target genes were significantly enriched in

ur

different treatment groups (Fig. 1E). As shown in Fig. 1F, we generated a PPI network of a total

Jo

of 602 nodes, and 521 protein pairs were obtained based on the STRING database. IPA analysis revealed molecular and cellular functions the DEGs involved such as Cellular Movement, Cell- To-Cell Signalling, and Interaction, Cell Signalling, Cellular Assembly and Organization, Cellular Function and Maintenance interacting networks (Supplementary Material S1), indicating the presence of protein-protein interactions (Fig. 1G). 3.2 KRT13 is downregulated and KRT17 is upregulated in ESCC We then performed a bioinformatics analysis of the screened differentially expressed genes in ESCC. The STRING database and the Ingenuity Knowledge Base were used to analyse

Journal Pre-proof

protein-protein interactions of the DEGs. In this analysis, we found an independent interaction between KRT family members. We further confirmed the expression of KRT17 and KRT13 in ESCC tissues. KRT13 was found to be expressed at low levels in ESCC tissues by qRT-PCR (Fig. 2A). Similarly, qRT-PCR and western blot analysis demonstrated a higher expression level of both KRT17 mRNA and protein (Figs. 2B and 2C) in the fresh ESCC tissues than their

of

adjacent normal tissues. These results are consistent with those of the mRNA sequencing. To

ro

assess the association between KRT17 and prognosis in ESCC patients, we used IHC to stain

-p

tumour samples from the 64 ESCC patients. As shown in Fig. 2E, KRT17 expression in primary

re

ESCC tissues was significantly higher than that in adjacent normal tissues, which is consistent

lP

with the results of Fig. 2C and the IHC score, as shown Fig. 2F.

na

3.3 Upregulation of KRT17 in ESCC is positively associated with poor patient prognosis To demonstrate the clinical significance of KRT17 upregulation in ESCC, HE staining was

ur

performed. The results revealed that KRT17 was expressed at higher levels in patients with more

Jo

advanced stages (Fig. 3A), indicating that KRT17 may be involved in tumour stage. To investigate the association between KRT17 and prognosis in ESCC patients, we used IHC to stain tumour samples from 64 ESCC patients. Pearson’s χ2 test and Spearman's order-related analysis of KRT17 expression and clinicopathological features indicated that high expression levels of KRT17 were associated with ESCC clinical stages. As shown in Table 1, KRT17 overexpression was associated with age (p=0.028), tumour location (p=0.003), smoking (p=0.031), lymph metastasis (p=0.03), T stage (p=0.013), N stage (p=0.019) and TNM stage (p=0.002) but not related to gender, tumour differentiation, hemangioma and neurological

Journal Pre-proof

invasion. The Kaplan-Meier analysis was used to examine the connection between KRT17 expression evaluated by IHC and the patient survival. As shown in Fig. 3B, ESCC patients with high KRT17 expression levels had significantly shorter 5-year survival rates (p=0.036) than patients with lower KRT17 expression levels. Furthermore, both univariate and multivariate Cox hazard analyses were performed showing that KRT17 expression level and tumour

of

differentiation were significantly associated with overall survival (OS) in the 64 ESCC patients,

ro

both of which were also independent prognostic indicators for OS (Supplementary Table S2).

-p

Collectively, these results suggest that KRT17 may be a tumour-promoting factor, and its

re

increase in expression may contribute to the malignant progression of ESCC. The expression of

lP

KRT17 in five ESCC cells, Eca109, EC9706, KYSE140, KYSE410 and TE-1 was examined by

na

western blot analysis (Fig. 3C). We used both CRISPR/Cas9 technology and an overexpression strategy to specifically knockout or upregulate KRT17 in Eca109 and EC9706 cells. The stable

ur

overexpression or knockout of KRT17 in EC9706 and Eca109 (Figs. 3D and 3E) was confirmed.

Jo

3.4 KRT17 participates in the proliferation and migration of ESCC cells in vitro Given the prognostic relevance of the high KRT17 expression levels in ESCC, we verified the role of KRT17 in the malignant behaviour of ESCC cells in vitro. To determine whether KRT17 influenced the proliferative ability of ESCC cells, we performed CCK-8 assays and colony formation assays. As shown in Fig. 4A, proliferation capacity was notably enhanced by the overexpression of KRT17 but compromised when KRT17 was knocked out. We used colony formation assay to examine the effect of KRT17 on the proliferation of ESCC cells (Fig. 4B). Increased expression of KRT17 significantly enhanced the cell proliferation capacity while

Journal Pre-proof

KRT17 knockout reduced it. To reveal the impact of KRT17 on ESCC cell migrative capability, a trans-well migration chamber experiment was used, in which FBS was used as a chemoattractant to compare the effect of downregulation and upregulation of KRT17 on migration. As shown in Fig. 4C, the results demonstrated that compared with the empty vector controls, the KRT17- knockout Eca109 and EC9706 cells displayed significantly reduced

of

migration. It has been confirmed that the cell migration ability can be assessed by a wound

ro

healing test because wound closure is generally a measure of cell motility. As shown in Fig. 4D,

-p

the wound healing assay results showed that KRT17 overexpression notably enhanced the

re

mobility of Eca109 and EC9706 compared with that of the empty vector controls. In contrast,

lP

KRT17-knockout cells displayed a prolonged wound closure time compared to that of the blank

na

controls. Collectively, these data support the notion that overexpression of KRT17 in ESCC promotes cell proliferation and migration.

ur

3.5 KRT17 mediates the growth and metastasis of ESCC in vivo

Jo

The influence of KRT17 on cell growth in vivo was evaluated by injecting 2×106 KRT17 upregulated or knockout EC9706 cells and their respective controls into the right upper extremity axilla of four BALB/c nude mice. After three weeks, the mice were sacrificed, and the tumour mass was removed. As shown in Fig. 5A, mice injected with KRT17-upregulated cells showed significantly increased tumour size and weight compared to mice injected with control cells. In contrast, KRT17-knockout EC9706 cells caused a significant reduction in the tumour growth compared with the blank controls. 2×106 KRT17 upregulated or knockout EC9706 cells and their empty controls were injected into the tail vein of four BALB/c nude mice to evaluate the effect

Journal Pre-proof

of KRT17 on ESCC metastasis in vivo. After 8 weeks, mice were sacrificed, and metastatic nodules were counted in liver and lung sections. As shown in Fig. 5B, the number of nodules formed in the lungs of mice injected with KRT17-knockout ESCC cells was significantly reduced compared to that of mice injected with the empty control cells. KRT17-upregulated cells showed significantly increased number of lung nodules compared to mice injected with control

of

cells. However, we found no visible tumours in the liver tissues of the mice injected with

ro

KRT17-knockout cells and control cells. Overall, these results demonstrate that KRT17

-p

upregulation is a critical factor in promoting the growth and metastasis of ESCC in vivo.

re

3.6 KRT17 is associated with EMT induction and AKT activation.

lP

EMT is one of the critical initiation steps in the metastasis process and provides cancer cells

na

with motility and invasion properties. The role of KRT17 in modulating EMT has been demonstrated in oral cancer cells [18]. Thus, we sought to determine whether KRT17 also

ur

participates in the regulation of EMT in ESCC cells. As shown in Figs. 6A and 6B,

Jo

overexpression of KRT17 in EC9706 cells significantly increased the protein levels of N-cadherin and Slug whereas N-cadherin, Slug and vimentin levels were decreased in KRT17-knockout EC9706 cells. Overexpression of KRT17 increased the gene expression levels of snail, twist and vimentin while ZO-1 level was decreased (Fig. 6C). Furthermore, slug, twist and snail levels were decreased when KRT17 was knocked out. These findings suggest that KRT17 overexpression is involved in promoting ESCC cell proliferation and that metastasis is closely related to EMT activation. To explore the molecular mechanisms underlying KRT17- mediated stimulation of proliferation and migration in ESCC, we verified the signalling

Journal Pre-proof

molecules that are important in cancer metastasis. Western blot analysis (Figs. 6D and 6E) confirmed that the expression levels of pan-AKT and pAKT-473 were decreased in KRT17-knockout EC9706 cells compared with KRT17-upregulated EC9706 cells which showed increased expression. Moreover, the expression of AKT at the mRNA level was consistent with that at the protein level, as shown in Fig. 6F. To strengthen confidence in the results obtained in

of

cultured cells, AKT pathway activation scores were computed and compared between epithelial

ro

and mesenchymal ESCC samples using a patient-derived, pan-cancer EMT signature as

-p

previously reported [20]. The 9 major AKT signalling components [21], namely AKT1/2/3,

signature

on

the

basis

of

TCGA

RNA-seq

data

of

ESCC

lP

activation

re

PTEN, PHLPP1, HSP90, TSC1, TSC2 and VHL, were used as seeds to derive the AKT pathway

na

(https://tcga-data.nci.nih.gov/tcga/ dataAccessMatrix.htm). An increased expression of AKT3 and HSP90 but a decreased expression of PHLPP1 was found in the mesenchymal ESCC

ur

tumours (P<0.05) while there was no significant difference in the expression levels of AKT1,

Jo

AKT2, PTEN, TSC1, TSC2 and VHL between the epithelial and mesenchymal tumo urs (Figs. 6G and 6H). These results suggest that induction of EMT and activation of AKT in ESCC cells is mediated, at least in part, by KRT17.

4. Discussion Even though significant progress has been made in investigating the biological targets of ESCC, this aggressive tumour continues to have poor patient outcomes. Due to the poor early diagnosis predicament of ESCC, it is difficult to make substantial advances in its treatment [22].

Journal Pre-proof

This study aimed to identify biological markers in ESCC and their potential use as targets for effective diagnosis and therapy. First, we performed high-throughput mRNA sequencing in four pairs of ESCC tissues and para-cancerous tissues to detect DEGs. By combining analysis of Ingenuity Knowledge Base (Genes Only, IPA) and the STRING database for protein-protein interaction, we found that KRT family members interact independently in protein-protein

of

interactions. Many novel genes were detected, but the study also isolated a uniq ue KRT family,

ro

the functions of which remain unclear and need to be further investigated. In fresh ESCC tissues,

-p

KRT13 was confirmed to have low expression, and KRT17 was found to be overexpressed; this

re

finding is consistent with the results of Luo et al [23]. We focused on the KRT17 gene and

lP

identified a functional phenotype and potential molecular mechanism of KRT17 involvement in

na

ESCC. Furthermore, it has been reported that KRT17 is overexpressed in ESCC [23-25]. Our studies found that KRT17 was upregulated in ESCC and the variety of reliable KRT17 biological

ur

roles in ESCC tissues identified seem to meet the criterion of a useful biomarker for tracking

Jo

ESCC progression, early diagnosis and prognosis assessment as well as its potential for use as a target for effective therapy of ESCC. The potential to predict the prognosis and determination of critical factors underlying biological mechanisms are primary goals in cancer management [26]. This study analysed 64 cases and found that KRT17 expression was markedly upregulated in ESCC tissues. Our results are consistent with previous observation that KRT17 is upregulated in ESCC [24]. Moreover, our data verified that KRT17 upregulation in ESCC tissues was positively correlated with the TMN stage. Survival analysis demonstrated that ESCC patients with increased expression of KRT17

Journal Pre-proof

exhibited a remarkably shorter survival period than those with low KRT17 expression levels, implying that KRT17 may be involved in the aggressive progression of ESCC. KRT17 plays a critical role in cell viability and a multitude of biological processes [11]. Abnormal upregulation of KRT17 has been detected in various conditions ranging from trauma to malignant tumours [27]. Tumour cell proliferation and metastasis predict poor prognosis of

of

cancer patients [28]. The proliferation and migration of ESCC cells into the surrounding tissue

ro

and lymph is a primary factor in ESCC deterioration. Upstream analysis was used to predict links

-p

between upstream molecules, which may result in observed changes in gene expression. Many

re

upstream genetic and epigenetic modulations of core signalling pathways in ESCC eventually

lP

affect genes that play vital roles in cell migration, and aberrant cell proliferation is the definitive

na

hallmark of cancer [29]. Additionally, IPA revealed differentially expressed genes involved in cellular movement, cell- to-cell signalling, and interaction. The existing literature shows that

ur

KRT17 is overexpressed in malignant lesions of various tumours, which highlights KRT17 as a

Jo

possible factor in mediating tumour proliferation and migration [30, 31]. To further confirm the role of KRT17 in ESCC cells, we established stable KRT17 knockdown and overexpression in ESCC cells to perform functional analyses. Interestingly, we found that the proliferation and migration capacity of KRT17-overexpressing ESCC cells were strikingly increased. Additionally, the in vivo growth study revealed that the volume and weight of the KRT17-knockdown tumors in BALB/c mice were significantly smaller than the controls whereas KRT17-overexpressing tumors showed the opposite results. The in vivo metastasis study demonstrated a similar result. Therefore, KRT17 plays an essential role in reinforcing ESCC proliferation and metastasis.

Journal Pre-proof

KEGG analysis was performed based on the STRING database. The differentially expressed genes were found to participate in more than twenty pathways. Some of these well-known pathways are known to play essential roles in tumour progression. For instance, the PI3K−AKT signalling pathway is one of the main growth regulatory pathways in both normal and cancer cells [32-34]. AKT participates in a wide variety of oncogenic processes, such as proliferation

of

and cell survival, cell cycle progression, metabolism, and EMT [35]. Furthermore, EMT is a

ro

complex multistage process in the primary invasion process during cancer exacerbation, in w hich

-p

the migration activity and mesenchymal- like properties increase [36, 37]. AKT is highly

re

activated by its phosphorylation at both the Thy308 and Ser473 sites and contributes to EMT,

lP

leading to metastasis [38]. Therefore, further studies are required to explore the relevant

na

mechanism of KRT17 underlying the process of ESCC cell migration. We noticed that the expression of epithelial biomarkers (ZO-1), transcription factors known to drive EMT (Slug,

ur

Snail, and Twist), and a mesenchymal marker (vimentin) were increased in KRT17 upregulated

Jo

ESCC cells, while they were decreased in KRT17-knockout cells. These results indicate that KRT17 mediates EMT occurrence. Additionally, in KRT17-upregulated ESCC cells, we found that pan-AKT and AKT-Ser473 sites were significantly enhanced compared with those of the KRT17-knockout cells, which produced the opposite result. Research published by Chiang et al confirmed that upregulated KRT17 induces EMT to reinforce the migration and invasive capacity of OSCC [18]. Khanom et al found that KRT17 positively regulates oral cancer cell proliferation and migration by stimulating the AKT/mTOR signalling pathway [17]. Our findings are in concert with the findings of these studies. We suggest that KRT17 might play a crucial

Journal Pre-proof

role in regulating the EMT process by activating the AKT pathway in ESCC proliferation and metastasis. These findings support the hypothesis that KRT17 is associated with poor prognosis in ESCC. Although our study indicates that KRT17 overexpression promotes proliferation and metastasis of ESCC cells and is correlated with poor prognosis in ESCC patients, our research

of

has shortcomings. First, it may be noted that the limited number of patients (64 cases) in the

ro

cohort affects the relevance of the study. Second, a sufficient number of BALB/c nude mice per

-p

group is needed to improve the credibility of the results. Although the biological functions of

re

KRT17 in ESCC were confirmed in vitro and in vivo, the specific and detailed mechanism

lP

remains to be full explored. Therefore, further research is needed to verify the mechanism of

Jo

5. Conclusions

ur

complex processes.

na

KRT17 in ESCC cells, which involves particular proteins such as adhesion factors or other

In summary, our study demonstrates that KRT17 was significantly upregulated in ESCC tissues and that KRT17 was able to enhance AKT signalling and induce EMT in ESCC cells with increased proliferative and migratory capacities both in vitro and in vivo. Most importantly, KRT17 expression was highly correlated with an enhanced malignant phenotype and poor prognosis. We further determined that a high KRT17 expression level is a robust biomarker for the early diagnosis and negative prognosis of ESCC that could potentially provide information to help guide individualized therapy.

Journal Pre-proof

Abbreviations: ESCC: esophageal squamous cell carcinoma; DAPs: differentially expressed genes; OSCC: oral squamous cell carcinoma; KRT17: keratin17 Protein; TNM: Tumor node metastasis; EMT: epithelial- mesenchymal transition; IHC: Immunohistochemistry; qRT-PCR: quantitative real- time polymerase chain reaction; GO: Gene Ontology; IPA: Ingenuity Pathway

ro

of

Analysis; KEGG: Kyoto Encyclopedia of Genes and Genomes; PPI: Protein-Protein interaction;

-p

Acknowledgment

re

We thank Drs. Jiajian Si and Dr. Lushan Chen for their expert histologic assistance, as well as

lP

Prof. Xu Lin and Prof. Xinjian Lin for generously providing their time and help with this study.

na

Authors’ contributions

ur

SSY and ZL designed study. ZL, SSY, STY, ZMS, PPZ and FL executed the experiments,

Jo

interpreted the data and performed the literature review. LG, ZL and ZH collected ESCC tissue specimens and clinical data. MQK, SC, SBY conceived and supervised the study, interpreted the data and wrote the paper.

Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request.

Journal Pre-proof

Compliance with ethical standards Ethical approval for this study was obtained from the institutional review board of the Union Hospital of Fujian Medical University (Fuzhou, China) and the Fujian Medical University Institutional Animal Care and Use Committee.

of

Funding

ro

This study was supported by Fujian Young Teacher Fund (JAT16020), Sailing Fund of Fujian

-p

Medical University (Grant number: 2016QH036), Joint Funds for the Innovation of Science and

re

Technology， Fujian province (Grant number: 2017Y9039 and 2017Y9013), Program for

lP

Innovative Research Team in Science and technology in Fujian Province University and Startup

na

Fund for Scientific Research, Fujian Medical University (Grant number: 2017XQ2027).

ur

Declaration of Competing Interests

Jo

The authors declare that they have no conflict of interest.

References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J Clin 68(6) (2018) 394-424. [2] Y. Liang, X. Chen, Y. Wu, et al., LncRNA CASC9 promotes esophageal squamous cell

Journal Pre-proof

carcinoma metastasis through upregulating LAMC2 expression by interacting with the CREB-binding protein, Cell Death Differ 25(11) (2018) 1980-1995. [3] M. Hongo, Y. Nagasaki, T. Shoji, Epidemiology of esophageal cancer: Orient to Occident. Effects of chronology, geography and ethnicity, J Gastroenterol Hepatol 24(5) (2009) 729-735.

of

[4] C.C. Hong, P.S. Chen, J. Chiou, et al., miR326 maturation is crucial for VEGF-C-driven

ro

cortactin expression and esophageal cancer progression, Cancer Res 74(21) (2014)

-p

6280-6290.

re

[5] A. Herskovic, W. Russell, M. Liptay, M.J. Fidler, M. Al-Sarraf, Esophageal carcinoma

lP

advances in treatment results for locally advanced disease: review, Ann Oncol 23(5) (2012)

na

1095-1103.

[6] A. Pennathur, M.K. Gibson, B.A. Jobe, J.D. Luketich, Oesophageal carcinoma, The Lancet

ur

381(9864) (2013) 400-412.

Jo

[7] N. Syed, M.A. Barbhuiya, S.M. Pinto, et al., Phosphotyrosine profiling identifies ephrin receptor A2 as a potential therapeutic target in esophageal squamous-cell carcinoma, Proteomics 15(2-3) (2015) 374-382. [8] J.T. Jacob, P.A. Coulombe, R. Kwan, M.B. Omary, Types I and II Keratin Intermediate Filaments, Cold Spring Harb Perspect Biol 10(4) (2018). [9] D.M. Toivola, P. Boor, C. Alam, P. Strnad, Keratins in health and disease, Curr Opin Cell Biol 32 (2015) 73-81. [10] I. Kurokawa, K. Takahashi, I. Moll, R. Moll, Expression of keratins in cutaneous epithelial

Journal Pre-proof

tumors and related disorders--distribution and clinical significance, Exp Dermatol 20(3) (2011) 217-228. [11] L. Yang, S. Zhang, G. Wang, Keratin 17 in disease pathogenesis: from cancer to dermatoses, J Pathol 247(2) (2019) 158-165. [12] K.M. McGowan, P.A. Coulombe, Onset of keratin 17 expression coincides with the

of

definition of major epithelial lineages during skin development, J Cell Biol 143(2) (1998)

ro

469-486.

-p

[13] M. Chivu- Economescu, D.L. Dragu, L.G. Necula, L. Matei, A.M. Enciu, C. Bleotu, C.C.

re

Diaconu, Knockdown of KRT17 by siRNA induces antitumoral effects on gastric cancer

lP

cells, Gastric Cancer 20(6) (2017) 948-959.

na

[14] R.P. Hobbs, A.S. Batazzi, M.C. Han, P.A. Coulombe, Loss of Keratin 17 induces tissue-specific cytokine polarization and cellular differentiation in HPV16-driven cervical

ur

tumorigenesis in vivo, Oncogene 35(43) (2016) 5653-5662.

Jo

[15] M. van de Rijn, C.M. Perou, R. Tibshirani, et al., Expression of Cytokeratins 17 and 5 Identifies a Group of Breast Carcinomas with Poor Clinical Outcome, The American Journal of Pathology 161(6) (2002) 1991-1996. [16] B. Bournet, A. Pointreau, A. Souque, et al., Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples, Pancreatology 12(1) (2012) 27-34. [17] R. Khanom, C.T. Nguyen, K. Kayamori, et al., Keratin 17 Is Induced in Oral Cancer and Facilitates Tumor Growth, PLoS One 11(8) (2016) e0161163.

Journal Pre-proof

[18] C.H. Chiang, C.C. Wu, L.Y. Lee, et al., Proteomics Analysis Reveals Involvement of Krt17 in Areca Nut-Induced Oral Carcinogenesis, J Proteome Res 15(9) (2016) 2981-2997. [19] C. von Mering, L.J. Jensen, B. Snel, et al., STRING: known and predicted protein-protein associations, integrated and transferred across organisms, Nucleic Acids Res 33(Database issue) (2005) D433-437.

of

[20] M.P. Mak, P. Tong, L. Diao, et al., A Patient-Derived, Pan-Cancer EMT Signature

ro

Identifies Global Molecular Alterations and Immune Target Enrichment Following

-p

Epithelial-to-Mesenchymal Transition, Clin Cancer Res 22(3) (2016) 609-620.

re

[21] M. Cheung, J.R. Testa, Diverse mechanisms of AKT pathway activation in human

lP

malignancy, Curr Cancer Drug Targets 13(3) (2013) 234-244.

na

[22] G. Ma, X. Zhang, Q. Ma, T. Rong, H. Long, P. Lin, J. Fu, L. Zhang, A novel multivariate scoring system for determining the prognosis of lymph node-negative esophageal squamous

Jo

(2015) 541-547.

ur

cell carcinoma following surgical therapy: an observational study, Eur J Surg Oncol 41(4)

[23] A. Luo, J. Kong, G. Hu, et al., Discovery of Ca2+-relevant and differentiation-associated genes downregulated in esophageal squamous cell carcinoma using cDNA microarray, Oncogene 23(6) (2004) 1291-1299. [24] J. Zhang, K. Wang, J. Zhang, S.S. Liu, L. Dai, J.Y. Zhang, Using proteomic approach to identify tumor-associated proteins as biomarkers in human esophageal squamous cell carcinoma, J Proteome Res 10(6) (2011) 2863-2872. [25] Q. Du, W. Yan, V.H. Burton, et al., Validation of esophageal squamous cell carcinoma

Journal Pre-proof

candidate genes from high- throughput transcriptomic studies, Am J Cancer Res 3(4) (2013) 402-410. [26] Y. Quan, M. Xu, P. Cui, M. Ye, B. Zhuang, Z. Min, Grainyhead- like 2 Promotes Tumor Growth and is Associated with Poor Prognosis in Colorectal Cancer, J Cancer 6(4) (2015) 342-350.

of

[27] S. Kim, P. Wong, P.A. Coulombe, A keratin cytoskeletal protein regulates protein synthesis

ro

and epithelial cell growth, Nature 441(7091) (2006) 362-365.

-p

[28] D. Duff, A. Long, Roles for RACK1 in cancer cell migration and invasion, Cellular

re

Signalling 35 (2017) 250-255.

lP

[29] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144(5) (2011)

na

646-674.

[30] H. Hu, D.H. Xu, X.X. Huang, C.C. Zhu, J. Xu, Z.Z. Zhang, G. Zhao, Keratin17 Promotes

Jo

(2018) 346-357.

ur

Tumor Growth and is Associated with Poor Prognosis in Gastric Cancer, J Cancer 9(2)

[31] S. Sankar, J.M. Tanner, R. Bell, A. Chaturvedi, R.L. Randall, M.C. Beckerle, S.L. Lessnick, A novel role for keratin 17 in coordinating oncogenic transformation and cellular ad hesion in Ewing sarcoma, Mol Cell Biol 33(22) (2013) 4448-4460. [32] I.A. Mayer, C.L. Arteaga, The PI3K/AKT Pathway as a Target for Cancer Treatment, Annu Rev Med 67 (2016) 11-28. [33] B.T. Hennessy, D.L. Smith, P.T. Ram, Y. Lu, G.B. Mills, Exploiting the PI3K/AKT pathway for cancer drug discovery, Nat Rev Drug Discov 4(12) (2005) 988-1004.

Journal Pre-proof

[34] Y. Zhang, P. Kwok-Shing Ng, M. Kucherlapati, et al., A Pan-Cancer Proteogenomic Atlas of PI3K/AKT/mTOR Pathway Alterations, Cancer Cell 31(6) (2017) 820-832 e823. [35] I.F. Bambang, Y.K. Lee, D.R. Richardson, D. Zhang, Endoplasmic reticulum protein 29 regulates epithelial cell integrity during the mesenchymal-epithelial transition in breast cancer cells, Oncogene 32(10) (2013) 1240-1251.

of

[36] P. Dong, Y. Konno, H. Watari, M. Hosaka, M. Noguchi, N. Sakuragi, The impact of

ro

microRNA- mediated PI3K/AKT signaling on epithelial- mesenchymal transition and cancer

-p

stemness in endometrial cancer, J Transl Med 12 (2014) 231.

re

[37] J.P. Thiery, H. Acloque, R.Y. Huang, M.A. Nieto, Epithelial- mesenchymal transitions in

lP

development and disease, Cell 139(5) (2009) 871-890.

na

[38] S.J. Grille, A. Bellacosa, J. Upson, et al., The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness o f squamous cell

Jo

ur

carcinoma lines, Cancer Res 63(9) (2003) 2172-2178.

Journal Pre-proof

Fig. legends Fig. 1. Identification of differentially expressed genes in ESCC cancer tissues and para-cancerous tissues. Hierarchical clustering (A) and volcano plots (B) showing mRNA expression patterns. KEGG pathway analysis showing the most significantly enriched pathway among 20 relevant targets (C). The upstream analysis predicting links between upstream

of

molecules in the gene expression analysis (D). GO enrichment analysis showing important or

ro

typical biological functions in the study (E). PPI network of total genes based on the STRING

-p

database (F). IPA, by Ingenuity Knowledge Base (genes only), was used to predict the

re

protein-protein interactions (G).

lP

Fig. 2. The expression of the KRT family in ESCC. KRT13 downregulation (A) and KRT17

na

upregulation (B) at the gene expression level in ESCC patients. Western blotting (C & D) confirms that KRT17 is highly expressed in ESCC tissues. (E) Representative images of IHC

ur

staining of ESCC tissues and adjacent normal tissues using an anti-KRT17 antibody; 40× scale

Jo

bars, 200 μm; 200× scale bars, 50 μm. A score of less than 4 was considered indicative of low KRT17 expression, and a score greater than 4 was considered indicative of high KRT17 expression. The score for ESCC tissues compared with adjacent normal tissues (F). *p <0.05, **p <0.01, ***p <0.001, and ****p <0.0001, #p>0.05.

Fig. 3. Increased expression of KRT17 has significant clinical implications in ESCC. (A) Representative HE staining (upper panel) and KRT17 immunohistochemical IHC staining (lower panel) at different clinical stages of ESCC using an anti-KRT17 antibody of; 40× scale bars, 200 μm. (B) Kaplan-Meier survival analysis indicating that upregulation of KRT17 in ESCC is

Journal Pre-proof significantly correlated with the reduced overall survival, p=0.036. (C) The expression level of KRT7 in 5 ESCC cell lines was verified by western blot analysis. Western blotting confirmed the expression of KRT17 overexpression or knockout in EC9706 (D) and Eca109 (E) cells. *p <0.05, **p <0.01, ***p <0.001, and ****p <0.0001, #p >0.05.

Fig. 4. KRT17 significantly promotes the proliferation and metastasis of ESCC cells in vitro. (A)

of

Evaluation of cell proliferation using Cell Counting Kit-8, as described in the Methods section.

ro

The results of both the EC9706 and Eca109 groups indicated that the proliferation capacity of the

-p

KRT17-overexpressing group was enhanced while the proliferation of the KRT17 knockout

re

group was significantly reduced. (B) Colony formation assay, as described in the Methods section. Compared with the blank group, the proliferation ability of the KRT17-overexpressing

lP

group was significantly enhanced. Correspondingly, the KRT17 knockout group proliferation

na

was considerably weaker than that of the control group. Scale bars, 1 cm. (C) Cell migration towards the gap was observed, imaged, and quantified at the indicated times, as described in the

ur

Methods section. ESCC stably transfected cells in which KRT17 was stably knocked down or

Jo

upregulated, and each control cell type were treated for 24 h; the metastasis of the KRT17-overexpressing group was significantly stronger than that of the control groups. In contrast, the migration ability of the KRT17-knockdout group was notably weaker than that of the empty control groups; scale bars, 50 μm. (D) The wound healing assay was performed on stably transfected EC9706 and Eca109 cells (KRT17 upregulated and KRT17 knockdown) according to the protocol described in the Materials and Methods. Representative time- lapse microscopy images showing wound migration distances at 0 h and 48 h time points; scale bars, 200 μm. *p <0.05, **p <0.01, ***p <0.001, and ****p <0.0001.

Journal Pre-proof

Fig. 5. KRT17 facilitates the proliferation and migration of ESCC cells in vivo. (A) EC9706 stably transfected cells were subcutaneously injected into the right upper extremity axilla of BALB/c nude mice (n = 4). All mice were euthanized, and the tumour was removed. The tumour size and weight were statistically analysed. The results showed that the KRT17-overexpressing EC9706 tumours had bigger size and weight than the control tumours. The volume and weight of

of

the tumours in the KRT17 knockout group was significantly reduced compared with the tumours

ro

in empty control groups. (B) KRT17 stably expressiong EC9706 cells and the empty vector

-p

control cells were injected into the tail vein of BALB/c nude mice. The number of nodules

re

formed in the lungs of mice injected with KRT17-knockout ESCC cells was significantly reduced compared to mice injected with KRT17-upregulated cells. However, no visible tumours

na

lP

were found in the livers of mice in any group. *p <0.05, ***p <0.001.

Fig. 6. KRT17-regulated expression of EMT markers is dependent on the AKT pathway in ESCC

ur

cells. Western blot analysis (A & B) and qRT-PCR analysis (C) of the expression of EMT

Jo

markers in KRT17-upregulated or knockout EC9706 cells. Western blot analysis (D & E) of the expression of pan-AKT and pAKT-473 in EC9706 cells. (F) qRT-PCR analysis of total AKT expression in EC9706 cells. (G) Heatmap representation of mRNA expression levels of 9 major AKT signalling components genes in 81 ESCC samples from TCGA RNA-seq datasets, rank ordered on the basis of their EMT score. (H) Comparison of mRNA expression levels of the 9 major AKT signalling components between designated epithelial (n=57) and mesenchymal (n=24) ESCC samples. *p <0.05, **p <0.01, ***p <0.001, #p >0.05.

Journal Pre-proof Table 1

Jo

ur

na

lP

re

-p

ro

of

Clinicopathological characteristics of 64 ESCC patients according to KRT17 expression KRT17 Low expression(%) High expression(%) p value Characteristic n = 22 n = 42 p=0.0001* Normal vs Cancer Normal 55(85.9) 9(14.1) Cancer 22(34.4) 42(65.6) p=0.028* Age(years) <60 9(14.1) 29(45.3) ≥60 13(20.3) 13(20.3) p=0.094# Gender Females 7(10.9) 6(9.4) Males 15(23.4) 36(56.3) p=0.002* TNM stage I 7(10.9) 1(1.6) II 8(12.5) 14(21.9) III 7(10.9) 27(42.2) p=0.013* T classification T1 7(10.9) 2(3.1) T2 3(4.7) 5(7.8) T3 12(18.8) 30(46.9) T4 0(0.0) 5(7.8) p=0.019* N classification N0 15(23.4) 14(21.9) N1 3(4.7) 17(26.6) N2 4(6.3) 6(9.4) N3 0(0.0) 5(7.8) P=0.003* Tumor location Upper 0(0.0) 8(12.5) Middle 8(12.5) 24(37.5) Lower 14 (21.5) 10(15.6) P=0.465# Differentiation Highly 7(14.1) 18(28.1) Moderate 13(17.2) 20(31.3) Low 2(3.1) 4(6.3) # P=0.73 Neurological invasion positive 1(1.6) 2(3.1) negative 21(32.8) 40(62.5) p=0.031* Smoking Yes 5(7.8) 21(32.8) No 17(26.6) 21(32.8) p=0.03* Lymph metastasis Yes 6(9.4) 28 (43.8)

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

No 16(25.0) 14(21.9) P=0.096# Hemangioma Yes 2(3.1) 11(17.2) No 20(31.3) 31(48.4) *p value was determined using Pearson’s chi-square test; #: no statistical significance

Journal Pre-proof Graphical abstract Highlights KRT17 is upregulated in human ESCC, which correlates with poor clinical outcome.



KRT17 promotes ESCC cell proliferation, migration and metastatic potential.



KRT17 activates AKT signaling and induces EMT.



KRT17 may serve as a prognostic biomarker and potential therapeutic target in ESCC.

Jo

ur

na

lP

re

-p

ro

of



Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6