KIF3A is essential for sperm tail formation and manchette function

Molecular and Cellular Endocrinology 377 (2013) 44–55

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

KIF3A is essential for sperm tail formation and manchette function Mari S. Lehti a,b,⇑, Noora Kotaja b, Anu Sironen a a b

Agrifood Research Finland, Biotechnology and Food Research, Animal Genomics, FIN-31600 Jokioinen, Finland Department of Physiology, Institute of Biomedicine, University of Turku, FIN-20520 Turku, Finland

a r t i c l e

i n f o

Article history: Received 15 April 2013 Received in revised form 29 May 2013 Accepted 24 June 2013 Available online 2 July 2013 Keywords: KIF3A Spermatogenesis Intraflagellar transport Manchette

a b s t r a c t KIF3A motor protein is responsible for intraflagellar transport, which is required for protein delivery during axoneme formation in ciliated cells. The function of KIF3A during spermatogenesis is not known. In this study, we show that depletion of KIF3A causes severe impairments in sperm tail formation and interestingly, it also affects manchette organization and the shaping of sperm heads. Our results demonstrate the analogy between the mechanisms governing the formation of cilia in somatic cells and the formation of spermatozoa-specific flagella. Furthermore, this study reveals KIF3A as an important regulator of spermatogenesis and emphasizes the crucial role of KIF3A in maintaining male fertility. We also identified several novel interacting partners for KIF3A, including meiosis-specific nuclear structural protein 1 (MNS1) that colocalizes with KIF3A in the manchette and principal piece of the sperm tail. This study highlights the essential role of KIF3A-mediated microtubular transport in the development of spermatozoa and male fertility. Ó 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Spermatogenesis is a complex process, which occurs in the seminiferous tubules of the testis. Spermatogenesis can be divided in three phases: the mitotic phase in which the spermatogonia undergo several mitotic divisions and give rise to spermatocytes; in the meiotic phase, spermatocytes divide by meiosis to form haploid round spermatids; and in the last phase, spermiogenesis, round spermatids elongate, chromatin is condensed, acrosome and sperm tail are formed and finally spermatozoa are released into lumen of the seminiferous tubules (Hermo et al., 2010). Synchronized changes in cell content within the tubules are known as the cycle of seminiferous epithelium. The cycle can be divided into 12 stages (I–XII) in the mouse. Organization of specific cell populations within the tubule cross-section defines the stages of seminiferous epithelial cycle (Ahmed and de Rooij, 2009; Hess and Franca, 2009). Axonemal structure of the sperm tail is analogous to the motile ciliary axoneme. Both contain a central pair of microtubules; which

Abbreviations: MNS1, meiosis-specific nuclear structural protein 1; ODF, outer dense fiber; MS, mitochondrial sheath; FS, fibrous sheath; IFT, intraflagellar transport; KBP, Kif1-binding protein; Co-IP, Co-immunoprecipitation; PND, postnatal day. ⇑ Corresponding author. Address: Agrifood Research Finland, Biotechnology and Food Research, Animal Genomics, c/o University of Turku, Institute of Biomedicine, Department of Physiology, Kiinamyllynkatu 10, FIN-20520 Turku, Finland. Tel.: +358 29 5317 444. E-mail address: mari.lehti@mtt.fi (M.S. Lehti). 0303-7207/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mce.2013.06.030

are surrounded by nine outer doublets of microtubules. In addition, the axoneme sperm tail has accessory structures: outer dense fibers (ODFs); fibrous sheath (FS); and mitochondrial sheath (MS). Based on the accessory structures, the sperm tail can be divided into three parts: the mid piece; principal piece; and end piece. The most proximal part of the tail is the mid piece, where the mitochondrial layer surrounds ODFs and the axoneme. Between the mid piece and principal piece is the annulus, a septin based ring, which functions as a diffusion barrier (Kwitny et al., 2010). Nine ODFs surrounding the axoneme provide passive, rigid support for the tail. In the principal piece, two ODFs are replaced by the longitudinal columns of FS, which are connected to each other by circumferential ribs. FS provides support for the tail and participates in multiple signaling and metabolic cascades needed for normal tail function. In the end piece only the axoneme is surrounded by the plasma membrane (Turner, 2006, 2003). Formation of the sperm flagellum begins in early round spermatids; where one of the two centrioles forms an axoneme. In midspermiogenesis ODFs and FS develop around the nine outer doublets of the axoneme. Mid piece formation occurs in late spermiogenesis, when the annulus migrates towards proximal part of the FS and the mitochondrial layer is assembled in helical arrangement around the ODFs (Turner, 2003; Russell et al., 1993). Development of the sperm tail axoneme resembles the cilia formation; which is organized by intraflagellar transport (IFT). IFT is utilized to transport molecules along the axonemal microtubule doublets. Two motor proteins are responsible for the movement: kinesin II and dynein1b. Kinesin II is a heterotrimeric protein

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

complex containing two motor subunits KIF3A and KIF3B and one non-motor subunit KAP3 and works as an anterograde motor. Dynein1b serves as a retrograde motor (Rosenbaum and Witman, 2002). Mechanisms of IFT during spermiogenesis are not well understood. Some IFT related proteins localize in the sperm tail and interact with tail proteins (Zhang et al., 2012). An IFT88 knockout mouse model displays severe defects in sperm tail development and abnormal head shaping (Kierszenbaum et al., 2011). Mutation in Rabl2, which interacts with IFT complex B proteins IFT27, -81 and -172, causes reduction in sperm tail length and decreases sperm motility in mice (Lo et al., 2012). IFT20 has been localized to the Golgi complex, manchette and basal body during spermatogenesis (Sironen et al., 2010). The manchette is a transient microtubular and F-actin containing structure, which is required for head shaping and protein delivery during spermatid elongation (Kierszenbaum, 2002a). It appears at the caudal site of the early elongating spermatid head and disappears, when condensation of the spermatid nucleus is near completion. The manchette serves as a platform for intramanchette transport (IMT) and as a storage for the molecules needed for elongation and head shaping. Microtubules of the manchette are nucleated from perinuclear ring, which is separated by a narrow groove from the marginal ring of the acrosomal region (Kierszenbaum and Tres, 2004; Toshimori and Ito, 2003). The best established role for kinesin II subunit KIF3A is in ciliary transport. However; other biological functions have also been reported (Marszalek and Goldstein, 2000). KIF3A is essential in axonal elongation and transport (Takeda et al., 2000), cell polarity (Nishimura et al., 2004) and positioning of the basal body (Sipe and Lu, 2011). Mouse mutants lacking KIF3A are embryonic lethal at day 10 postcoitum, embryos have situs inversus and defects in ciliary morphogenesis (Marszalek et al., 1999). Several KIF3A conditional knockout mouse models serve as an experimental model for human ciliopathies, giving rise to symptoms such as polydactyly (Kolpakova-Hart et al., 2007), polycystic kidneys (Lin et al., 2003) and skeletal development defects (Haycraft et al., 2007). These symptoms are caused by defects in essential cilia related signaling cascades such as the hedgehog pathway. Kinesin II has been shown to be expressed in developing male germ cells and mature spermatozoa in different species. In the rat, kinesin II has been localized in the spermatid cytoplasm and manchette (Hall et al., 1992), developing flagella and base of the tail (Miller et al., 1999) and Sertoli cell trans-golgi network (Johnson et al., 1996). In the Sea urchins species, Strongylocentrus droebachiensis, and Sand dollar species, Echinarachnius parma, kinesin II subunits KIF3A and KAP3 are present in mature sperm flagella and mid piece (Henson et al., 1997). The exact role of KIF3A in sperm development remains unknown. In order to elucidate the function of KIF3A in the testis, we generated a male germ cell specific KIF3A knockout mouse model. We demonstrated that KIF3A and IFT are required for the correct sperm tail formation. In addition, our results unveil a new role for KIF3A in sperm head shaping through its manchette-related functions. We also identify novel interacting partners for KIF3A in the testis. All the results refer to the importance of KIF3A-mediated transport in the organization and function of the flagellum and manchette during spermatogenesis.

2. Materials and methods 2.1. Ethics statement All mice were maintained in a specific pathogen-free stage at the Central Animal Laboratory of the University of Turku. All animal experiments were approved by the Finnish Ethical Committee

45

and handled in accordance to international guidelines on the care and use of laboratory animals.

2.2. Generation of germ cell specific KIF3A knockout mice Kif3a fl/wt mice were purchased from MMRRC and are originally generated by Dr. Larry Goldstein, University of California, San Diego (Marszalek et al., 1999, 2000). Kif3a exon 2 is surrounded by LoxP sequences. To generate germ cell specific knockout mouse model; Kif3a fl/wt mice were bred with mice expressing transgenic Cre under the Ngn3 promoter (provided by Dr. Pedro L. Herrera, University of Geneva, Switzerland) to produce Cre+ Kif3a fl/fl mice. Cre expression and the floxed Kif3a allele were confirmed by PCR as described previously (Marszalek et al., 2000; Korhonen et al., 2011).

2.3. Gene expression analysis Whole testis from C57BL/6NHsd mice (Mus musculus) were collected and snap frozen in liquid nitrogen and stored at 80 °C prior to RNA extraction. Total RNA was extracted using RNeasy Midi kit (Qiagen) following the manufacturer’s instructions. Samples were prepared for Solid 4 sequencing using commercial kits and protocols provided by Applied Biosystems. The colorspace reads obtained from the Solid sequencer were aligned against the mouse reference genome (mm9 assembly) using the standard whole transcriptome pipeline and the colorspace alignment tool provided by Applied Biosystems and distributed with the instrument (LifeScope v2.1). After alignment to the reference genome; the unique reads were associated with known genes based on Ensembl annotations, and the number of reads aligned within each gene was counted. Gene variant detection and differential transcript expression analysis were carried out using the Cufflinks pipeline (Trapnell et al., 2012). The LifeScope mapping results were used as an input for the Cufflinks analysis. For gene expression assessment by gel electrophoresis, RNA extracted from the WT and KIF3A KO mice testis were reverse transcribed (RT-PCR) using oligo T primers and an ImProm-II Reverse Transcription System (Promega) according to the manufacturer’s instructions. Gene specific primers for Kif3A (forward in exon ½ junction GCCGATCAATAAGTCGGAGA and reverse in exon 3 AGCCCCGGTACTGCTCGAAC) and for control gene Eef2 (forward in exon 1 GCTTC CCTGTTCACCTCTGACTCTG and reverse in exon 2 CCTTGCACACAAGGGAGTCGGT) were used for amplification.

2.4. Western blotting For Western blot analysis, tissue samples were collected, snap frozen in liquid nitrogen and stored at 80 °C. Tissue samples were homogenized in lysis buffer [50 mM Tris–HCl pH 8.0, 170 mM NaCl, 1% NP40, 5 mM EDTA, 1 mM DTT and protease inhibitors (Complete mini; Roche diagnostic)] using Ultra Turrax and centrifuged at 13,000 rpm, for 20 min at +4 °C. Protein concentration was measured using Bradford protein assay kit (Thermo Scientific). Proteins were separated in denaturating conditions in 10% SDS– page gel (Bio-Rad) and blotted to Hybond membrane. Nonspecific sites on the membrane were blocked with 5% nonfat milk in 0.1% PBS-Tween 20 at RT for 1 h and the membrane was incubated with rabbit anti-KIF3A (PAI-20240, Thermo Scientific, 1:4000) or mouse anti-alpha-tubulin (MS-581-P0; Thermo Scientific, 1:4000) antibody at +4 °C overnight. Specific bands were detected using HRP-conjugated anti-rabbit or anti-mouse IgG as a secondary antibody (1:4000) and the signal was developed using ECL Plus Western blotting detection system (Amersham Pharmacia) and imaged using LAS-4000 (Fujifilm).

46

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

2.5. Immunofluorescent staining 2.5.1. Sperm slides Cauda epididymides were dissected from KIF3A KO and WT mice and placed in PBS. Spermatozoa were released by making several incisions on the tissue followed by 30 min incubation at +37 °C. Released spermatozoa were washed two times with PBS, dispersed on an object slide, air dried at RT and stored at 80 °C. Spermatozoa were fixed in 4% PFA for 15 min, washed in PBS and treated with 0.2% Triton X-100 for 10 min. After PBS washes, slides were blocked in 10% normal goat serum at RT for 1 h. Primary antibody (anti-KIF3A 1:200, rabbit anti-MNS1, UP-2284, gift from PhD P. Jeremy Wang, 1:250) was diluted in 3% normal goat serum and incubated at + 4 °C overnight. Slides were washed in 0.1% PBSTween 20 and incubated with secondary antibody (1:500, AlexaFluor goat anti-rabbit 594/488, Molecular Probes) at RT for 1 h. DNA was stained with 40 ,6-diamidino-2-phenylindole (DAPI, 1:10,000, Sigma) and slides were mounted with Mowiol 4-88 medium (Polysciences, Inc). All stainings were visualized using Zeiss AxioImager M1 microscope or Leica DMRBE microscope. 2.5.2. Drying down preparations KIF3A KO and WT mice testes were dissected and decapsulated in PBS. Specific stages of the seminiferous tubules were identified by transillumination (Kotaja et al., 2004) and specific segments for stages I–V, VI–VIII and IX–XII were transferred in 100 mM sucrose solution. Stage specific cell suspension was spread on an object slide with fixing solution (1% PFA, 0.15% Triton X-100, pH 9.0) and incubated in humified box at RT over night. Slides were air dried, washed with 0.4% photoflo (Kodak) and air dried again at RT. Slides were post-fixed in 4% PFA for 5 min and washed in PBS. Autofluorescence was quenched with 100 mM ammonium chloride for 2 min, and slides were subsequently washed in PBS and treated 0.2% Triton X-100 for 2 min. After PBS washes slides were blocked with 10% BSA or 10% normal goat serum in PBS with 0.05% Triton X-100 at RT for 1 h. Primary antibodies (anti-KIF3A 1:1000, goat anti-MNS1 1:100 (sc-138435, Santa Cruz Biotechnology, Inc.); mouse anti-AKAP82 1:500, mouse anti-acetylated tubulin 1:1000 (T7451, Sigma); anti-MNS1 (UP-2284 1:250); goat antiCBE1 1:100 (sc-162645, Santa Cruz Biotechnology, Inc.)) were diluted in 3% BSA or 3% normal goat serum and incubated at +4 °C overnight. Slides were washed in 0.1% PBS-Tween 20 and secondary antibodies were diluted in 1:500 [AlexaFluor goat anti-rabbit/ mouse 594/488, AlexaFluor donkey anti-goat 594/488 (Molecular Probes)] and incubated at RT for 1 h. For some experiments, the cells were counterstained with Lectin HPA from Helix pomatia Alexa Fluor 488 Conjugate (Molecular Probes, 1:50) or anti-alpha-tubulin-Alexa-488 (1:500, 32-2588, Invitrogen). DNA was stained with DAPI and slides were mounted with Mowiol 4-88 medium. 2.5.3. Paraffin embedded sections KIF3A KO and WT testis and epididymis were dissected and fixed in 4% PFA or Bouin’s solution at RT overnight. Paraffin embedded tissues were cut and for immunofluorescence antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) after deparaffinization and rehydration. Slides were stained as described for drying down preparations. For histology, testis tissue sections fixed in Bouin’s or epididymis tissue sections fixed in 4% PFA were deparaffinized, rehydrated, and treated with periodic acid–Schiff (PAS, testis) or Mayer’s Hematoxylin and eosin (HE&E, epididymis). 2.6. Immunoprecipitation and mass spectrometric analysis WT mice testes were dissected and decapsulated. Tubules were minced into short pieces and incubated in collagenase solution in

rotating conditions at RT for 1 h. Testicular cell suspension was first filtered through 100 lm silk and then through 40 lm silk, pelleted by centrifugation and suspended into lysis buffer (50 mM Tris–HCl pH 8.0, 170 mM NaCl, 1% NP40, 5 mM EDTA, 1 mM DTT and protease inhibitors [Complete mini; Roche diagnostic]). Cell lysate was sonicated 10 times in 30 s intervals, incubated on ice for 20 min and cleared by centrifugation. Protein concentration was measured using Bradford protein assay kit and 4.5 mg of total testis protein was used for one IP. Protein G Dynabeads (Life Technologies) were coupled with anti-KIF3A (5 lg) and anti-rabbit IgG (5 lg) and immunoprecipitation was performed according to manufacturer’s protocol. Shortly, protein lysate was added to the KIF3A or Rabbit IgG coupled beads and incubated at +4 °C overnight. Beads were washed three times with lysis buffer and proteins were eluted using 50 mM glycine, pH 2.8. Precipitated proteins were separated in 4–20% gradient gel, visualized using Silver Staining kit (Thermo Scientific) and protein bands of interest was cut into eight different pieces from a gel for in-gel digestion. Tryptic peptides were dissolved in 10 ll of 1% formic acid and 5 ll was submitted to LC-MS/MS analysis using the LTQ Orbitrap Velos Pro mass spectrometer. Database searches were performed by Mascot search engine against a Sprot protein sequence database. 2.7. Electron microscopy Stage specific tubule segments or epididymal sperm samples were fixed in 5% glutaraldehyde and treated with potassium ferrocyanide–osmium fixative, embedded in epoxy resin and stained with 1% uranyl acetate and 0.3% lead citrate. Visualization of the electron microscopical preparations was done with a JEM 100SX or JEM 1200EX transmission electron microscopes. 3. Results 3.1. KIF3A localization during mouse spermatogenesis Immunostaining of paraffin embedded WT testis sections with anti-KIF3A antibody revealed that the KIF3A protein expression is induced already in early spermatocytes. The signal was detected throughout the cytoplasm in spermatocytes, round spermatids and elongating spermatids (Fig. 1A–D). A clear KIF3A signal was first detected in pachytene spermatocytes around stage I. The signal was either absent or very low in spermatogonia and earlier types of spermatocytes (preleptotene, leptotene, zygotene). KIF3A expression was further enhanced in late pachytene/diplotene spermatocytes and remained strong throughout the round spermatid differentiation. The signal was detected in the cytoplasm of elongating spermatids until around step 14 of differentiation (stages II and III) (Fig. 1A–D). To analyze KIF3A localization in spermatids more carefully, we performed immunostaining on stage-specific drying down preparations. KIF3A specific signal was observed in the basal body and axoneme of round and elongating spermatids and in the manchette of elongating spermatids (Fig. 2). In mature sperm, isolated from the testis and cauda epididymis, KIF3A was located in the principal piece of the sperm tail (Fig. 2 and data not shown). 3.2. Generation of KIF3A conditional knockout mice To investigate the role of KIF3A during mouse spermatogenesis, we generated male germ cell specific conditional knockout mouse model by crossing the Neurogenin3 (Ngn3) Cre+ mice (Korhonen et al., 2011; Desgraz and Herrera, 2009) with the floxed Kif3a line (Marszalek et al., 1999). Under the control of Ngn3 promoter; Cre expression begins around postnatal day 5 resulting in Kif3a

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

47

Fig. 1. KIF3A is expressed in the cytoplasm of spermatocytes, round and elongating spermatids. On PFA-fixed paraffin-embedded testis section, stages VII and VIII (A) and IV– VI (B) KIF3A is expressed in the cytoplasm of spermatocytes and round spermatids. In stages X–XII (C and D) KIF3A specific signal was detected in the cytoplasm of spermatocytes and elongating spermatids. KIF3A KO testis section serves as a negative control (E). Scale bar is 50 lm. Sc = spermatocyte; RS = round spermatid; ES = elongating spermatid, secSc = secondary spermatocyte. (F) Seminiferous epithelial cycle in the mouse is divided into twelve stages. Cytoplasmic KIF3A expression begins in early spermatocytes and is detected until step 14 elongating spermatid. Different cell types are highlighted with specific colors and the strongest KIF3A expression by a red line.

deletion already in early spermatogonia (Yoshida et al., 2006). All mice were genotyped by PCR using specific primers amplifying the Ngn3Cre transgene (data not shown) and Kif3a wild type (360 bp) and floxed allele (490 bp) (Fig. 3A). To confirm the absence of KIF3A, proteins were isolated from the testis, epididymis and kidney and total RNA were isolated from the testis of the adult WT and KIF3A KO mice. In the testis, both Western blot (Fig. 3B) and RT-PCR (Fig. 3C) analyses showed substantial decrease in KIF3A expression.

(Fig. 4A). The cauda epididymis of KIF3A KO mice was almost completely devoid of spermatozoa and the epididymis was filled with cell debris (Fig. 4A). We were able to collect only few mature spermatozoa from the cauda epididymis of the KIF3A KO, which showed defective morphology of the head and tail (Fig. S1D). No phenotypically normal sperm were observed in adult (age > 7 weeks) mice. To test the fertility of KIF3A KO male mice, we bred adult (n = 3) KIF3A KO male mice with WT females. Vaginal plugs were detected confirming the successful mating, but after 6 weeks of breeding, no pups were born (data not shown).

3.3. KIF3A depletion causes male infertility KIF3A KO mice grew to adulthood and embryonic lethality was not observed. The total body weight of KIF3A KO males was similar to WT littermates (Fig. S1A). However, testis and epididymis weights were slightly decreased in KIF3A KO (Fig. S1B and C), which probably results from a large reduction in sperm production

3.4. Sperm tail structure is disorganized and manchette shape is abnormal in KIF3A KO mice Histological analyses of testis sections revealed a normal organization of the seminiferous epithelium and all stages of the seminiferous epithelial cycle could be identified (Fig. 4B).

48

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

Fig. 2. KIF3A localizes in the manchette, basal body and sperm tail. (A) Anti-KIF3A immunostaining of testicular cell spreads of step 9 elongating spermatids revealed the KIF3A localization in the manchette, and spermatid flagella and of steps 14 and 15 mature sperm in the basal body region (arrow) and sperm principal piece. Rabbit IgG staining was used as a negative control (B). KIF3A localization in the manchette was confirmed by colocalization with a-tubulin (C). KIF3A localization was confirmed in the basal body region with a basal body marker c-tubulin (D, arrow). Scale bar is 20 lm in A–C and 10 lm in D.

Fig. 3. KIF3A deletion in the KIF3A KO testis. (A) Genotyping PCR shows 490 bp band for the LoxP allele and 360 bp band for the WT allele. (B) KIF3A protein levels were detected using Western blot. KIF3A is substantially reduced in the KIF3A KO testis as compared to the WT testis. Alpha tubulin antibody was used as a control to confirm equal loading of the samples. (C) RT-PCR results from the KIF3A KO and WT mice testes show the lack of Kif3A exon 2 mRNA expression in the KO testis. Eef gene was used as a reference gene.

the absence of detectable axoneme in KIF3A KO mice (Fig. 4C). Missing flagellar structures and malformed head shapes were also detected in phase contrast microscopy (Fig. 4D). The presence of long and malformed spermatid heads suggests defects in the formation/function of manchette that is involved in the shaping of the sperm head. Immunofluorescence analysis, using an a-tubulin antibody, showed abnormally long manchettes in KIF3A KO spermatids (Fig. 5A). Furthermore, the clearance of the manchette seemed to be delayed as indicated by the presence of manchette containing elongating spermatids at stages I and II (Fig. 5B). At this stage manchette has already been cleared from the WT elongating spermatids (Fig. 5B). We performed electron microscopy to study the organization of sperm tail components and manchette in KIF3A KO in detail. Manchette was often found to be ectopically assembled and thicker compared to WT and the perinuclear ring was detached from the nucleus (Fig. 6A and B). During chromatin condensation (starting from step 11 elongating spermatids), the manchette appeared elongated and a nuclear constriction at the juncture of the groove and perinuclear ring became apparent (Fig. 6C and D). A schematic figure illustrates the commonly observed abnormal phenotype of KIF3A KO sperm head and manchette (Fig. 6E). Despite the fact that microtubules, ODFs, FS and mitochondria were present in the KIF3A KO elongating spermatids, all the components were displaced (Fig. 6F–I) and normal axonemal structure was not discovered. The overall structure of the sperm isolated from the cauda epididymis was severely disorganized and no correct axonemal or accessory structures were observed (Fig. 6J and K). Normal organization of the sperm tail is illustrated in Fig. 6L. The disorganization of tail structures was also observed by immunofluorescence analysis of the mature sperm. In the KIF3A KO sperm, the fibrous sheath component AKAP4 and axonemal acetylated a-tubulin were concentrated in the excess of cytoplasm (data not shown). 3.5. Novel interacting partners for KIF3A

Spermatogonia, spermatocytes and round spermatids appeared normal. In histological staining, the first defects in the spermatogenesis of KIF3A KO mice were detected in elongating spermatids which showed abnormal head shapes and the lack of visible tails (Fig. 4B). More careful analysis of spermatids, in drying-down preparations, failed to detect any axonemal structures (Fig. 4C and D). Fluorescence microscopy images of round and elongating spermatids, using an acetylated a-tubulin antibody, demonstrated

Co-immunoprecipitation (Co-IP) from adult WT testis lysates using KIF3A and negative control antibody (Rabbit IgG), followed by mass spectrometric analysis, was performed to identify possible interacting partners for KIF3A in the testis. Co-IP was done in triplicate to eliminate false positive results. The previously reported interactions between KIF3A and other kinesin II subunits, KIF3B ((Yamazaki et al., 1995), SwissProt, prot acc Q61771) and KAP3 ((Yamazaki et al., 1996), P70188) were confirmed by our data

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

49

Fig. 4. Depletion of KIF3A causes defects in spermatid differentiation. (A) HE&E staining of the cauda epididymis shows the greatly reduced number of spermatozoa in the KIF3A KO epididymis. Scale bar is 50 lm. (B) PAS staining of testis sections from KIF3A KO and WT mice. Depletion of KIF3A does not affect the overall organization of the seminiferous epithelium, but in stages XI and XII abnormal head shape of elongating spermatids is observed (arrows) and sperm tails are missing. + = spermatocyte;  = round spermatid; arrow head = elongating spermatid; arrow = malformed sperm head. (C) Anti-acetylated tubulin was used as a marker for sperm axoneme formation. The axoneme was missing from KIF3A KO mice. (D) Phase contrast microscopy of steps 9–16 elongating spermatids on drying down slides reveals the absence of normal sperm tail formation and malformed heads. Scale bar is 20 lm.

(Fig. 7A). All three proteins were detected with high coverage of peptide sequences (29–66%) in the mass spectrometric analysis. Furthermore, eight other interacting candidates for KIF3A were identified: MNS1 (Meiosis-specific nuclear structural protein 1, Q61884); SMRP1 (Spermatid-specific manchette-related protein 1, Q2MH31); KBP (KIF1-binding protein, Q6ZPU9); Enkur (Enkurin, Q6SP97); ODF3 (Outer dense fiber protein 3, Q920N1); CCDC105 (Coiled-coil domain-containing protein 105, Q9D4K7); CCDC11 (Coiled-coil domain-containing 11, Q9D439) and FAM166A (Protein FAM166A, Q9D4K5). These interactions were identified in all three KIF3A Co-IPs while Rabbit IgG control Co-IPs did not result in any protein matches (Fig. 7A). 3.6. Expression of Kif3a and its interaction partners during spermatogenesis We analyzed the mRNA expression patterns of Kif3a and novel interacting partners in juvenile testis at postnatal days (PND) 7, 14, 17, 21 and 28 by using RNAseq data and the Cufflinks pipeline (Trapnell et al., 2012) (Fig. 7B–L). Each time point corresponds to the appearance of different cell populations during the first wave of spermatogenesis. At PND 7, only somatic cells and spermatogonia are present in the testis. In addition to this, early spermatocytes (at PND 14), late spermatocytes (at PND 17), round spermatids (at

PND 21) and finally elongated spermatids (at PND 28) appears in the testis (Bellve et al., 1977). The gene expression pattern identified in this time frame reflects the presence of this gene product in specific cell types during spermatogenesis. The Cufflinks pipeline also identifies the expressed gene isoforms in the dataset enabling more precise estimation of gene products and expression patterns. Cufflinks analysis predicted five protein coding isoforms for Kif3a (Kif3a_001,_004-007, Fig. 7B). Kif3a mRNA expression was enhanced at PND 17 along with the appearance of late pachytene spermatocytes. Similar high expression in late spermatocytes has been demonstrated for some axonemal genes (Horowitz et al., 2005), which have to be synthesized before the initiation of sperm tail formation in early post-meiotic cells. Both Kif3b and Kap3 showed similar induction in expression at PND 17, and their expression continued increasing along with the appearance of elongating spermatids at PND 28 (Fig. 7C and D). The expression of all eight identified interaction partners increased during the progress of spermatogenesis reaching the highest expression level at PND28 (Fig. 7E–L). This expression pattern indicates a role in later processes during spermatid differentiation, possibly including manchette organization and flagellar assembly. Some showed a preceding induction of expression at PND17 (Mns1, Kbp, Enkur, Ccdc105, Ccdc11) suggesting that they could interact with KIF3A during axoneme formation. For some

50

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

Fig. 5. Manchette is abnormally elongated in KIF3A KO mice. (A) Abnormal manchette elongation in KIF3A KO spermatids. Spermatids from different manchette-containing steps were stained with anti-tubulin antibody to visualize manchette microtubules. The distance from the perinuclear ring to the caudal side of the head is indicated by arrows. This distance is reduced in WT spermatids during steps 12 and 13, when the manchette is cleared. KIF3A KO spermatids display abnormal elongation of the manchette and problems in manchette clearance. Scale bar is 10 lm. (B) Manchette appearance in staged seminiferous tubule sections. During stages IX–XI manchette is present in WT and KIF3A KO testis sections. In stages I-II manchette is cleared in WT, but retained in KIF3A KO mice. Scale bar is 20 lm. Alpha tubulin was used to visualize manchette microtubules and DAPI for nuclei staining.

the genes Cufflinks predicted several isoforms (Kbp, Smrp1, Odf3). In the case of Kbp, the three predicted isoforms (Kbp_001, Kbp_002, and Kbp_008, Ensembl database) appeared to be differentially expressed during spermatogenesis (Fig. 7F). KBP has previously been shown to interact with KIF3A (Alves et al., 2010) and Enkur has been localized in the principal piece of the mature sperm tail (Sutton et al., 2004). SMRP1 has been identified as a manchette protein (Matsuoka et al., 2008), and we were also able to localize it in the manchette by immunostaining (data not shown). However,

the elucidation of the possible functional interplay of these proteins with KIF3A during spermiogenesis requires further studies. 3.7. MNS1 localization in KIF3A KO mice MNS1 plays an important role in sperm tail development (Zhou et al., 2012). MNS1 KO mice have short sperm tails, the fibrous sheath is missing, and the axonema and ODFs are completely disorganized (Zhou et al., 2012). This prompted us to further investi-

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

51

Fig. 6. Manchette is ectopically placed and sperm tail structures are disorganized in KIF3A KO mice. (A) WT elongating spermatids (steps 9–11) show normal assembly of the manchette (arrow) and perinuclear ring (arrow head). (B) The manchette of early elongating spermatids (steps 9–11) of KIF3A KO is ectopically placed and the perinuclear ring is detached from the nucleus. (C) WT step 13 spermatids have condensed chromatin. (D) Step 13 spermatid from KIF3A KO mice show defects in chromatin condensation. The manchette is elongated and a nuclear constriction at the juncture of the groove and the perinuclear ring is prominent. Scale bar is 1 lm. (E) Schematic figure of common phenotype detected in KIF3A KO mice. Elongated manchette and perinuclear ring constrict the sperm head causing its abnormal shape. Cross sections of WT mice mid piece (F) and principal piece (G) demonstrate the normal organization of the axoneme, mitochondrial and fibrous sheath (indicated in the figure). (H and I) Cross sections of KIF3A KO sperm tail revealed the complete disorganization of axonemal microtubules and tail accessory structures. Magnification 10,000. (J and K) In the KIF3A KO epididymal spermatozoa, the accessory structure components are present, but not correctly organized. Magnification 10,000 (I), and 15,000 (J). (L) Schematic picture of normal sperm tail organization.

gate the localization of MNS1 and the possible interaction with KIF3A. For localization of MNS1 during spermatogenesis we used two different antibodies: sc-138435, which recognizes the internal region of MNS1 and UP-2284 which recognizes the C-terminal region of MNS1. We used sc-148435 to co-localize MNS1 with KIF3A in differentiating spermatids on WT drying down slides. MNS1 co-localized with KIF3A in the manchette and in the principal piece of the elongating spermatid tail (Fig. 8A). In addition, this antibody detected MNS1 in the acrosomal region and perinuclear ring (data not shown). Similar staining pattern was detected by using the UP-2284 antibody (Figs. 8B and S2). Acrosomal staining was observed in all steps of round spermatids with the signal concentrated in the acrosomal granule and the marginal areas of the

acrosome. This staining was not affected in the KIF3A KO spermatids (Fig. S2). In early elongating spermatids, which are characterized by the appearance of the manchette, a MNS1 specific signal was still detected in the acrosomal region. During step 10 the signal concentrated in the perinuclear ring of elongating spermatids, where it remained in steps 11 and 12 spermatids (Fig. 8B). MNS1 signal was also found in the manchette during these stages. In the mature spermatozoa isolated from the cauda epididymis, MNS1 was found in the principal piece of the sperm tail indicating its dynamic translocation from the acrosomal region via the manchette to the sperm tail (Fig. 8C). Despite the localization in the acrosome and manchette, the most critical function of MNS1 seems to be associated

52

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

Fig. 7. Mass spectrometric analysis reveals interacting candidates for KIF3A. (A) Table indicates the number of matched peptides per protein and sequence coverage of matched peptides of the total protein sequence for all KIF3A and Rabbit IgG Co-IP triplicates. (B) Kif3a expression pattern during sperm development. Cufflinks pipeline predicted five gene isoforms for Kif3a. (C–L) Expression patterns for protein coding isoforms of identified interacting partners. All interacting candidates for KIF3A were highly expressed during late spermiogenesis. Isoforms are named based on Ensembl IDs.

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

53

Fig. 8. MNS1 colocalizes with KIF3A and concentrates in the manchette of KIF3A KO mice. (A) MNS1 staining with anti-MNS1 (sc-138435) antibody localizes in the acrosomal region, manchette and principal piece of the WT sperm tail. MNS1 and KIF3A colocalize in the manchette and principal piece of the sperm tail. Scale bar 20 lm. (B) In steps 9– 11, spermatids anti-MNS1 (UP-2284) antibody staining is detected in the acrosomal region and in steps 9–12, in the perinuclear ring. During steps 11–12, MNS1 is concentrated in the manchette and acrosomal region of KIF3A KO mice. Scale bar is 20 lm. (C) MNS1 is localized in the principal piece of the mature sperm tail. Scale bar is 20 lm.

with flagellar assembly since this is the only process that is affected in MNS1 KO spermatids (Zhou et al., 2012). Interestingly, MNS1 seems to be retained in the abnormally formed manchette of the KIF3A KO elongating spermatids as well as in the acrosomal region (Fig. 8B). This suggests KIF3A functional impairment causes defects in the dynamics of MNS1 during the spermatid elongation process.

4. Discussion Previous studies have localized KIF3A in the wild type testis and sperm tail, but its exact function during sperm development has remained unsolved. In order to elucidate the role of IFT in spermatogenesis we generated a male germ cell specific mouse model for KIF3A. Flagella development begins in very early spermatids, where basal body serves as a nucleation site to the developing axoneme. In KIF3A KO mice, the axoneme formation appears to be affected already in these early spermatids. We demonstrate that the expression of KIF3A is induced already in spermatocytes, which correlates well with the timing of axoneme formation. Despite the defects in axoneme formation, the polarization of round spermatids and the position of the basal body are correctly organized. In addition to axonemal underdevelopment, more impairments emerge during later steps of spermiogenesis when the dramatic differentiation of spermatids occurs. KIF3A localizes in the manchette, basal body, and tail of elongating spermatid and mature sperm suggesting that it has other functions in addition to its involvement in axoneme construction. Especially, the nuclear shaping is affected in the KIF3A KO spermatids, which seems to originate from the defects in the manchette organization. The defects are not prominent in round and early elongating spermatids where, for example, the perinuclear ring of the manchette appears unaffected. However,

at the time of nuclear chromatin condensation the perinuclear ring often becomes extended and a constriction at the juncture of the groove develops. Furthermore, the manchette appears abnormally long. These defects generate the typical malformed, knob-like, elongated head shape in KIF3A KO elongating spermatids. Sperm head shaping and tail organization seems to be mechanistically coupled and disrupted microtubule assembly or maintenance usually affects both processes (Mendoza-Lujambio et al., 2002). A previously published study of a microtubule-severing complex subunit, katanin p80, shows a similar manchette phenotype than our KIF3A KO model having a constricted perinuclear ring, a knob-like appearance of the sperm head, and elongated manchette. The sperm tail is also affected and axonemal microtubules or central pair and ODFs are missing (O’Donnell et al., 2012). Furthermore, Meig1-deficient mice have been shown to have severe defects in sperm flagellar structures and disrupted manchette structure resembling KIF3A KO mouse model (Zhang et al., 2009). These findings suggest that KIF3A-dependent mechanisms could be involved in the organization and remodeling of the microtubule network of the manchette as it moves over the nucleus. By mass spectrometry, we were able to identify several novel potential interacting partners for KIF3A in the testis. KIF3A has versatile localization patterns in the cytoplasm and in the specific structures of differentiating spermatid. Since KIF3A was immunoprecipitated from total testis cell lysate, it is not evident at which sites the interactions possibly occur. At the mRNA level, some of the interaction partners were expressed already in late spermatocytes suggesting that they could function together with KIF3A during the axonema construction. All the genes were highly expressed in late spermiogenesis, which supports their possible interaction with KIF3A during manchette appearance and flagellar assembly. One of these proteins, KBP, has previously been shown to interact

54

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55

with KIF3A via the KIF3A motor domain, which is known to be the site for the docking kinesins to microtubules (Alves et al., 2010). KBP has been suggested to mediate interaction between KIF3A and cargo or be involved in microtubule dynamics, but its localization pattern during spermatogenesis is not known. SMRP1 potentially interacts with KIF3A in the manchette since it has been reported to localize in this structure (Matsuoka et al., 2008). Enkur is thought to serve as an adaptor molecule that localizes Ca2+ sensitive signal transduction proteins to the canonical transient receptor potential (TRPC) channels through its interaction with TRPC (Sutton et al., 2004). Enkur localization has been detected in postmeiotic spermatid acrosome, in mature sperm acrosomal crescent, and the principal piece. The localization of KIF3A and Enkur in the mature sperm tail principal piece provides a possible interaction site. Interaction of KIF3A with ODF3, a known sperm tail accessory component (Kierszenbaum, 2002b), probably takes place during flagellar assembly. These identified interaction partners provide important insight into the further mechanistic studies on KIF3A-associated functions during sperm development and is a novel finding. One of the KIF3A-interacting proteins, MNS1 has been shown to be required for flagellar assembly in mice (Zhou et al., 2012). The majority of the observed sperm in MNS1 KO mouse have short and crooked tails with disorganized axoneme and accessory structures, very similar to the defects observed in the KIF3A KO sperm tails. The general spermatogenic expression pattern of these two proteins is similar, starting at a low level in early pachytene spermatocytes with increased expression in late spermatocytes and post-meiotic spermatids (Fig. 1A–D) (Zhou et al., 2012). The main difference between KIF3A and MNS1 KO phenotypes is that MNS1 depletion does not affect sperm head morphology (Zhou et al., 2012). In this study, we localized MNS1 in the acrosomal region, perinuclear ring, manchette and the principal piece of the sperm tail. The flagellar localization has also been demonstrated in previous studies (Zhou et al., 2012). MNS1 seems to be associated with the manchette during the elongation process, but it is not involved in manchette-mediated head shaping. Therefore, it is possible that MNS1 is transiently transported via manchette and on the basis of the known function of KIF3A as a microtubular motor protein, it is tempting to speculate that KIF3A could be involved in the transport of MNS1 to the developing sperm tail. This is supported by the abnormal retention of MNS1 in the manchette and acrosomal region in KIF3A KO spermatids. All the data supports the functional interaction between KIF3A and MNS1, however, defining of the exact roles that these proteins play in spermiogenic processes requires additional studies. 5. Conclusion In this study, we show that the depletion of KIF3A during spermatogenesis causes severe defects in functional sperm formation. In addition to the crucial role in spermatogenesis, we identified several interacting partners for KIF3A. Detailed analysis of MNS1 localization in the KIF3A KO mice testis, suggests defects in the transport mechanism of MNS1 into the developing tail. Altogether this study reveals for the first time the essential role of the kinesin II complex in the organization and function of two microbutular assemblies, the sperm tail axoneme and manchette in developing spermatozoa. The results highlight the importance of functional IFT, and the possible role of KIF3A in IMT, in the strictly orchestrated events during late spermatogenesis. Acknowledgements The UP-2284 antibody was kindly provided by PhD P. Jeremy Wang. The technical assistance of Anne Rokka (Proteomics Facility

of Turku Centre for Biotechnology), the staff of Electron Microscopy Laboratory and the Central Animal Laboratory of the University of Turku, Tarja Hovivuori and Johanna Rusi are greatly appreciated. The linquistic editing of this manuscript was performed by Robert M. Badeau, PhD of the Univerisity of Turku Graduate School. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.mce.2013.06.030. References Ahmed, E.A., de Rooij, D.G., 2009. Staging of mouse seminiferous tubule crosssections. Methods Mol. Biol. 558, 263–277. Alves, M.M., Burzynski, G., Delalande, J.M., Osinga, J., van der Goot, A., Dolga, A.M., de Graaff, E., Brooks, A.S., Metzger, M., Eisel, U.L., Shepherd, I., Eggen, B.J., Hofstra, R.M., 2010. KBP interacts with SCG10, linking Goldberg-Shprintzen syndrome to microtubule dynamics and neuronal differentiation. Hum. Mol. Genet. 19, 3642–3651. Bellve, A.R., Cavicchia, J.C., Millette, C.F., O’Brien, D.A., Bhatnagar, Y.M., Dym, M., 1977. Spermatogenic cells of the prepuberal mouse. Isolation and morphological characterization. J. Cell Biol. 74, 68–85. Desgraz, R., Herrera, P.L., 2009. Pancreatic neurogenin 3-expressing cells are unipotent islet precursors. Development 136, 3567–3574. Hall, E.S., Eveleth, J., Jiang, C., Redenbach, D.M., Boekelheide, K., 1992. Distribution of the microtubule-dependent motors cytoplasmic dynein and kinesin in rat testis. Biol. Reprod. 46, 817–828. Haycraft, C.J., Zhang, Q., Song, B., Jackson, W.S., Detloff, P.J., Serra, R., Yoder, B.K., 2007. Intraflagellar transport is essential for endochondral bone formation. Development 134, 307–316. Henson, J.H., Cole, D.G., Roesener, C.D., Capuano, S., Mendola, R.J., Scholey, J.M., 1997. The heterotrimeric motor protein kinesin-II localizes to the midpiece and flagellum of sea urchin and sand dollar sperm. Cell Motil. Cytoskeleton 38, 29– 37. Hermo, L., Pelletier, R.M., Cyr, D.G., Smith, C.E., 2010. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 1: background to spermatogenesis, spermatogonia, and spermatocytes. Microsc. Res. Tech. 73, 241–278. Hess, R., Franca, L., 2009. In: Cheng, C.Y. (Ed.), Spermatogenesis and Cycle of the Seminiferous Epithelium. Springer, New York, pp. 1–15. Horowitz, E., Zhang, Z., Jones, B.H., Moss, S.B., Ho, C., Wood, J.R., Wang, X., Sammel, M.D., Strauss 3rd, J.F., 2005. Patterns of expression of sperm flagellar genes: early expression of genes encoding axonemal proteins during the spermatogenic cycle and shared features of promoters of genes encoding central apparatus proteins. Mol. Hum. Reprod. 11, 307–317. Johnson, K.J., Hall, E.S., Boekelheide, K., 1996. Kinesin localizes to the trans-Golgi network regardless of microtubule organization. Eur. J. Cell Biol. 69, 276–287. Kierszenbaum, A.L., 2002a. Intramanchette transport (IMT): managing the making of the spermatid head, centrosome, and tail. Mol. Reprod. Dev. 63, 1–4. Kierszenbaum, A.L., 2002b. Keratins: unraveling the coordinated construction of scaffolds in spermatogenic cells. Mol. Reprod. Dev. 61, 1–2. Kierszenbaum, A.L., Tres, L.L., 2004. The acrosome–acroplaxome–manchette complex and the shaping of the spermatid head. Arch. Histol. Cytol. 67, 271– 284. Kierszenbaum, A.L., Rivkin, E., Tres, L.L., Yoder, B.K., Haycraft, C.J., Bornens, M., Rios, R.M., 2011. GMAP210 and IFT88 are present in the spermatid golgi apparatus and participate in the development of the acrosome–acroplaxome complex, head–tail coupling apparatus and tail. Dev. Dyn. 240, 723–736. Kolpakova-Hart, E., Jinnin, M., Hou, B., Fukai, N., Olsen, B.R., 2007. Kinesin-2 controls development and patterning of the vertebrate skeleton by Hedgehog- and Gli3dependent mechanisms. Dev. Biol. 309, 273–284. Korhonen, H.M., Meikar, O., Yadav, R.P., Papaioannou, M.D., Romero, Y., Da Ros, M., Herrera, P.L., Toppari, J., Nef, S., Kotaja, N., 2011. Dicer is required for haploid male germ cell differentiation in mice. PLoS One 6, e24821. Kotaja, N., Kimmins, S., Brancorsini, S., Hentsch, D., Vonesch, J.L., Davidson, I., Parvinen, M., Sassone-Corsi, P., 2004. Preparation, isolation and characterization of stage-specific spermatogenic cells for cellular and molecular analysis. Nat. Methods 1, 249–254. Kwitny, S., Klaus, A.V., Hunnicutt, G.R., 2010. The annulus of the mouse sperm tail is required to establish a membrane diffusion barrier that is engaged during the late steps of spermiogenesis. Biol. Reprod. 82, 669–678. Lin, F., Hiesberger, T., Cordes, K., Sinclair, A.M., Goldstein, L.S., Somlo, S., Igarashi, P., 2003. Kidney-specific inactivation of the KIF3A subunit of kinesin-II inhibits renal ciliogenesis and produces polycystic kidney disease. Proc. Natl. Acad. Sci. USA 100, 5286–5291. Lo, J.C., Jamsai, D., O’Connor, A.E., Borg, C., Clark, B.J., Whisstock, J.C., Field, M.C., Adams, V., Ishikawa, T., Aitken, R.J., Whittle, B., Goodnow, C.C., Ormandy, C.J., O’Bryan, M.K., 2012. RAB-Like 2 has an essential role in male fertility, sperm intra-flagellar transport, and tail assembly. PLoS Genet. 8, e1002969. Marszalek, J.R., Goldstein, L.S., 2000. Understanding the functions of kinesin-II. Biochim. Biophys. Acta 1496, 142–150.

M.S. Lehti et al. / Molecular and Cellular Endocrinology 377 (2013) 44–55 Marszalek, J.R., Ruiz-Lozano, P., Roberts, E., Chien, K.R., Goldstein, L.S., 1999. Situs inversus and embryonic ciliary morphogenesis defects in mouse mutants lacking the KIF3A subunit of kinesin-II. Proc. Natl. Acad. Sci. USA 96, 5043–5048. Marszalek, J.R., Liu, X., Roberts, E.A., Chui, D., Marth, J.D., Williams, D.S., Goldstein, L.S., 2000. Genetic evidence for selective transport of opsin and arrestin by kinesin-II in mammalian photoreceptors. Cell 102, 175–187. Matsuoka, Y., Miyagawa, Y., Tokuhiro, K., Kitamura, K., Iguchi, N., Maekawa, M., Takahashi, T., Tsujimura, A., Matsumiya, K., Okuyama, A., Nishimune, Y., Tanaka, H., 2008. Isolation and characterization of the spermatid-specific Smrp1 gene encoding a novel manchette protein. Mol. Reprod. Dev. 75, 967–975. Mendoza-Lujambio, I., Burfeind, P., Dixkens, C., Meinhardt, A., Hoyer-Fender, S., Engel, W., Neesen, J., 2002. The Hook1 gene is non-functional in the abnormal spermatozoon head shape (azh) mutant mouse. Hum. Mol. Genet. 11, 1647– 1658. Miller, M.G., Mulholland, D.J., Vogl, A.W., 1999. Rat testis motor proteins associated with spermatid translocation (dynein) and spermatid flagella (kinesin-II). Biol. Reprod. 60, 1047–1056. Nishimura, T., Kato, K., Yamaguchi, T., Fukata, Y., Ohno, S., Kaibuchi, K., 2004. Role of the PAR-3-KIF3 complex in the establishment of neuronal polarity. Nat. Cell Biol. 6, 328–334. O’Donnell, L., Rhodes, D., Smith, S.J., Merriner, D.J., Clark, B.J., Borg, C., Whittle, B., O’Connor, A.E., Smith, L.B., McNally, F.J., de Kretser, D.M., Goodnow, C.C., Ormandy, C.J., Jamsai, D., O’Bryan, M.K., 2012. An essential role for katanin p80 and microtubule severing in male gamete production. PLoS Genet. 8, e1002698. Rosenbaum, J.L., Witman, G.B., 2002. Intraflagellar transport. Nat. Rev. Mol. Cell Biol. 3, 813–825. Russell, L.D., Ettlin, R.A., Hikim, A.P.S., Clegg, E.D., 1993. Histological and histopathological evaluation of the testis. Int. J. Androl. 16, 83. Sipe, C.W., Lu, X., 2011. Kif3a regulates planar polarization of auditory hair cells through both ciliary and non-ciliary mechanisms. Development 138, 3441– 3449. Sironen, A., Hansen, J., Thomsen, B., Andersson, M., Vilkki, J., Toppari, J., Kotaja, N., 2010. Expression of SPEF2 during mouse spermatogenesis and identification of IFT20 as an interacting protein. Biol. Reprod. 82, 580–590.

55

Sutton, K.A., Jungnickel, M.K., Wang, Y., Cullen, K., Lambert, S., Florman, H.M., 2004. Enkurin is a novel calmodulin and TRPC channel binding protein in sperm. Dev. Biol. 274, 426–435. Takeda, S., Yamazaki, H., Seog, D.H., Kanai, Y., Terada, S., Hirokawa, N., 2000. Kinesin superfamily protein 3 (KIF3) motor transports fodrin-associating vesicles important for neurite building. J. Cell Biol. 148, 1255–1265. Toshimori, K., Ito, C., 2003. Formation and organization of the mammalian sperm head. Arch. Histol. Cytol. 66, 383–396. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D.R., Pimentel, H., Salzberg, S.L., Rinn, J.L., Pachter, L., 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562–578. Turner, R.M., 2003. Tales from the tail: what do we really know about sperm motility? J. Androl. 24, 790–803. Turner, R.M., 2006. Moving to the beat: a review of mammalian sperm motility regulation. Reprod. Fertil. Dev. 18, 25–38. Yamazaki, H., Nakata, T., Okada, Y., Hirokawa, N., 1995. KIF3A/B: a heterodimeric kinesin superfamily protein that works as a microtubule plus end-directed motor for membrane organelle transport. J. Cell Biol. 130, 1387–1399. Yamazaki, H., Nakata, T., Okada, Y., Hirokawa, N., 1996. Cloning and characterization of KAP3: a novel kinesin superfamily-associated protein of KIF3A/3B. Proc. Natl. Acad. Sci. USA 93, 8443–8448. Yoshida, S., Sukeno, M., Nakagawa, T., Ohbo, K., Nagamatsu, G., Suda, T., Nabeshima, Y., 2006. The first round of mouse spermatogenesis is a distinctive program that lacks the self-renewing spermatogonia stage. Development 133, 1495–1505. Zhang, Z., Shen, X., Gude, D.R., Wilkinson, B.M., Justice, M.J., Flickinger, C.J., Herr, J.C., Eddy, E.M., Strauss 3rd, J.F., 2009. MEIG1 is essential for spermiogenesis in mice. Proc. Natl. Acad. Sci. USA 106, 17055–17060. Zhang, Y., Ou, Y., Cheng, M., Saadi, H.S., Thundathil, J.C., van der Hoorn, F.A., 2012. KLC3 is involved in sperm tail midpiece formation and sperm function. Dev. Biol. 366, 101–110. Zhou, J., Yang, F., Leu, N.A., Wang, P.J., 2012. MNS1 is essential for spermiogenesis and motile ciliary functions in mice. PLoS Genet. 8, e1002516.