- Email: [email protected]
Kinetics of GDF9 expression in buffalo oocytes during in vitro maturation and their associated development ability
General and Comparative Endocrinology 178 (2012) 477–484
Contents lists available at SciVerse ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Kinetics of GDF9 expression in buffalo oocytes during in vitro maturation and their associated development ability Tripti Jain 1, Asit Jain 1, Parveen Kumar 2, S.L. Goswami, S. De, Dheer Singh, T.K. Datta ⇑ Animal Biotechnology Centre, National Dairy Research Institute, Karnal 132001, Haryana, India
a r t i c l e
i n f o
Article history: Received 11 April 2012 Revised 30 June 2012 Accepted 6 July 2012 Available online 16 July 2012 Keywords: Buffalo Oocyte GDF9
a b s t r a c t The capacity of fully grown oocytes to regulate their own microenvironment by secreted paracrine factors contribute to their developmental competence. In spite of growing evidence about the vital role of Growth Differentiation Factor 9 (GDF9) in determination of oocyte developmental competence, there is insufficient information about time dependent behavior of its expression during in vitro maturation (IVM) to have definite understanding about at what time point during IVM it plays most crucial role. The study reports the kinetics of GDF9 expression under four different IVM supplement conditions in buffalo oocytes and their concomitant development rate up to blastocyst. Oocytes matured under an ideal media condition with all supplements and those cultured with only FSH resulted in significantly higher cumulus expansion, nuclear maturation, cleavage and blastocyst rates. GDF9 expression at both mRNA and protein levels at different time points of IVM revealed that magnitude of mRNA abundance at 8 h of IVM was most important towards imparting development competence to buffalo oocytes. Appearance of GDF9 protein in maturing oocytes was found asynchronous with mRNA appearance in the time course of IVM suggesting possible posttranscriptional regulation of this gene under dynamic oocyte cumulus cell communication process. Abundance of mature GDF9 protein at 16 h was most consistently related with all oocyte development parameters. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction During the process of its maturation mammalian oocytes accumulate and store large amount of maternal mRNAs; an ordered regulation of which ultimately dictate the acquisition of developmental competence of oocytes and further embryonic development [50,58,33]. In a typical in vitro fertilization (IVF) procedure, in vitro maturation (IVM) of oocytes constitute the most challenging step because an orchestrated genes expression events during this time determines the efficiency of fertilization and subsequent embryonic division process leading to blastocyst formation and even successful implantation [49]. Aberrant degradation and/or maintenance of maternally inherited as well as de novo synthesized transcripts during oocyte maturation adversely affect the oocyte’s ability to undertake an orderly development [52]. A suboptimum IVM support results in persistent alterations of the
⇑ Corresponding author. Address: Genomics Lab, Animal Biotechnology Centre, National Dairy Research Institute, Karnal 132001, Haryana, India. Fax: +91 184 2250042. E-mail address: [email protected] (T.K. Datta). 1 These authors contributed equally to this work. 2 Present address: Division of Hematology and Transfusion Medicine, LUND University, Sweden. 0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2012.07.001
normal gene expression patterns and affect the developmental fate of IVF produced embryos very drastically [9,59,26]. Thus information on expression pattern of oocyte-expressed genes vis-à-vis their development fate is critical for deciding strategies for how more number of oocytes could be stimulated to gain optimum development competence eventually contributing to the success rate of various ART protocols in different livestock species [47]. GDF9 is an oocyte-specific paracrine factor which is expressed throughout most stages of folliculogenesis and persists after fertilization and play important role in bi-directional communication between oocytes and its surrounding cumulus cells [36,35]. GDF9 level in follicular fluid has been found significantly correlated with the nuclear maturation of the human oocytes and subsequent embryo quality [21]. Addition of exogenous GDF9 in oocyte maturation media has also enhanced subsequent development rate of oocytes in mice as well as bovine [60,25]. In spite of emerging evidence however, information about the kinetics of GDF9 expression during IVM remains incomplete and it is still not clear that at what stage of IVM GDF9 exerts most profound effect possibly in a species specific manner [7]. Buffaloes (Bubalus bubalis) in this regard remain a poorly understood species. Economic importance of this species as dairy animal in well documented and several ARTs have been successfully demonstrated [38,19] but, poor success rate of these procedures have kept pending their widespread adoption
478
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
[18,11]. The present study was planned to elucidate expression pattern of GDF9 gene in buffalo oocytes in course of in vitro maturation and their associated development competence. Appearance of GDF9 mRNA as well as its corresponding protein was tracked in buffalo oocytes at different time points of IVM to understand the dynamics of transcription and translation control of this gene and its relationship with development ability of oocytes [17,57,45]. 2. Materials and methods All media and chemicals were procured from Sigma Aldrich, St. Louis, MO, USA unless otherwise indicated. Disposable plastic wares used were from Falcon NJ, USA and Nunc, Denmark. Fetal bovine serum used was from Hyclone, Canada. 2.1. Production of buffalo embryos Buffalo ovaries were collected at an abattoir, regardless of the estrous cycle and transported within 3–4 h to the laboratory in phosphate buffer saline (PBS) containing strepto-penicillin (0.05 mg/ml). Ovaries were washed several times in normal saline and cumulus oocyte complexes (COCs) were aspirated from visible ovarian surface follicles in hepes-buffered hamster embryo culture (HH) medium [27]. COCs were picked up under stereo zoom microscope and washed three times in HH medium. They were evaluated according to morphological criteria and separated according to their quality. Only excellent grade oocytes with more than five compact layers of cumulus cells and homogenous cytoplasm were used for IVM and IVF. A group of 25 COCs were put for in vitro maturation (IVM) in 4 different supplementation media viz. (1) All supplementation group (Henceforth called Control): TCM-199 with 0.005% streptomycin, 0.01% sodium pyruvate and 0.005% glutamine, 64 lg/ml cysteamine and 50 ll ITS as base medium and supplemented with 10% fetal bovine serum (FBS), 5.0 lg/ml porcine follicle stimulating hormone (pFSH), 10 lg/ml luteinizing hormone (LH), 1 lg/ml estradiol 17-b (E2) and 50 ng/ml epidermal growth factor (EGF), (2) FSH group: TCM-199 base medium containing PVA (1 mg/ml) and 5.0 lg/ml porcine follicle stimulating hormone (3) IGF1 group: same as media 2 where FSH was replaced with 100 ng/ml of IGF1 and (4) estradiol group: same as media 2 where FSH was replaced with 1 lg/ml of estradiol 17 b (E2). For IVM, oocytes were placed in drops of 100 ll maturation media and overlaid with mineral oil. Oocytes were allowed to mature at 38.5 °C in an atmosphere of 5% CO2 in air. In vitro fertilization (IVF) was done in 100 ll droplets of BO medium [3] supplemented with 1% BSA (fatty acid free), 1.9 mg/ml caffeine sodium benzoate, 0.14 mg/ml sodium pyruvate and 0.01 mg/ml heparin. Prior to transfer in fertilization drops; matured COCs were washed thrice in BO medium. The frozen thawed buffalo semen was processed for in vitro capacitation as per the procedure described earlier [5] and 50 ll of the sperm suspension (at final concentration of 1 106/ml) was added to each fertilization drops having 15–20 COCs and incubated at 38.5 °C with 5% CO2 for 14 h. Presumptive zygotes were removed from the fertilization drops after 14 h of insemination (HPI), adhered cumulus cells were mechanically removed by vortexing and washed five times in mCR2aa medium [30]. After washing, 15–20 presumptive zygotes were co-cultured with monolayers of granulosa cells in 100 ll drops of IVC-I medium (mCR2aa supplemented with 0.8% BSA, 1 mM glucose, 0.33 mM pyruvate, 1 mM glutamine, 1 MEM essential amino acid, 1 non-essential amino acid and 50 lg/ml gentamycin. After 48 h of insemination (HPI) zygotes were evaluated for evidence of cleavage. At 72 HPI all cleaved embryos were transferred to IVC-II medium (same as IVC-I except BSA replaced with 10% FBS) and
maintained for 8 days at 5% CO2 and 38.5 °C with replacement of medium after every 48 h. 2.2. Observations made on developing oocytes and embryos All IVM and IVF experiments were repeated at least four times. After 24 h of IVM, levels of cumulus expansions was scored in a scale of 0–4 and the cumulus expansion index (CEI) was calculated as described before [13]. COCs with no cumulus expansion were scored as 0 and those with maximum degree of expanded cumulus mass were scored 4. Cumulus mass with intermediate expansions characterized by the detachment from oocytes or expansion of only the outer most layers was marked as 2 or 3 [54]. To determinate attainment of metaphase-II (M-II) denuded oocytes were stained with Hoechst 33342 using protocol described before [48] with slight modification. Briefly, denuded oocytes from all experimental groups were fixed in 4% paraformaldehyde solution (in PBS, pH 7.4) for 1 h at room temperature. After fixing and washing, groups of 50 oocytes were transferred to 200 ll drop of 10 lg/ml Hoechst 33342 dye solution for 20 min under dark condition. Stained oocytes were washed three times in PBS–PVP solution and placed on glass slides and mounted with Pro-Long mounting medium (Invitrogen, USA) and observed under the fluorescent microscope with UV filter (Olympus, Japan). Oocytes nuclei revealing two blue dots were considered as matured (M-II) oocytes. MII% was calculated for each IVM groups for at least 250 oocytes. Cleavage and blastocyst stages of the embryos were recorded on day 2 and 7 post insemination, respectively, in all four experimental groups. 2.3. RNA isolation and cDNA preparation Samples of a pool of 10 oocytes were used in 4 biological replicates for each experimental group. Total RNA was extracted from a fixed number of 10 oocytes were collected at different time intervals of maturation using the RNAqueous Micro Kit (Ambion) as per manufacturer’s instruction. Total RNA was eluted in elution buffer and treated with RNase-free DNase I (Ambion) to remove any contaminating genomic DNA. Total RNA (10 ll) from each samples were reverse-transcribed using Revert-Aid Kit (Fermentas, USA) following the manufacturer’s instructions using oligo-dT primers in a final volume of 20 ll. After termination of cDNA synthesis, each RT reactions were diluted with nuclease-free water to a final volume of 80 ll and stored at 80 °C till further use. 2.4. Quantitative real-time RT-PCR Quantification of GDF9 transcript was carried out by real-time PCR using Maxima SYBR Green qPCR Master Mix (Fermentas, USA). Primers used for GDF9 amplification were forward: CTCAGCACAAGCAAGCTCCT and reverse: GGGAAGGGAAAAGAAATGGA designed using the Beacon Designer 7.0 (Premier Biosoft, International) and derived from buffalo specific GDF9 sequences FJ529501.2. RSP18 transcripts were amplified as an internal calibrator using primers forward: GAAAATTGCCTTTGCCATCACTGC and reverse: GATCACACGTTCCACCTCATCCTC (Designed using bovine sequence NM_001033614). A working primer concentration of 10 pmol was used to set a primer matrix experiment to optimize the primer concentrations for valid transcript quantification [2]. Real time PCR reaction mixtures were consisted of 10 ll of syber green qPCR mix, 2 ll of cDNA template, optimized primer quantities and nuclease free water to make the total reaction volume of 20 ll. Reactions were performed in duplicate for each samples using Mx3005P real time PCR System (Stratagene). PCR conditions used were 95 °C for 10 min, then 40 cycles consisting of denaturation at 95 °C for 30 s, annealing at 57 °C for 20 s and extension
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
at 72 °C for 30 s. No template control reactions were carried to negate PCR contamination and dissociation curve analysis was performed to confirm authenticity of amplified products. Mean sample threshold cycle values (CT) for GDF9 and RSP18 were calculated for duplicate samples and relative transcript abundance for target gene expression was calculated using the formula 2 (DDCT) [34]. 2.5. Western blot analysis of GDF9 protein Detection of GDF9 protein in oocyte extracts (from a fixed number of 60 oocytes) was done by Western blot assay. Proteins in oocyte extract were resolved in 12% SDS polyacrylamide gel. Electrophoretically separated polypeptides were transferred to Polyvinylidene-fluoride (PVDF) membrane (Millipore, USA) using vertical electrophoresis system (Hoefer, UK). The membrane was blocked with 5% skimmed milk powder solution in 1 phosphate buffered saline Tween-20 (PBS-T) at room temperature for 1 h and then treated with goat anti GDF9 polyclonal primary antibody (1:200 dilutions) (Santa Cruz, USA, Cat # SC12244) and mouse anti
479
b-actin polyclonal primary antibody (1:200 dilution) (Santa Cruz, USA) at 4 °C for overnight. The specificity of GDF9 antibody used in the present study for Western blot and immuno histochemistry has been confirmed by previous workers [40,39]. Blots were washed with PBST and probed with optimized dilution of HRP conjugated anti-goat IgG (1:1000 dilution) (Santa Cruz, USA) and antimouse IgG (1:1000 dilution) secondary antibody (Santa Cruz, USA) for 1 h at room temperature. Membranes were washed extensively with PBS-T and DAB substrate (Bangalore Genei, India) was added to membrane for color development. When the signal was detectable, reaction was stopped by rinsing with distilled water. Intensity of signals was quantified using ImageJ (NIH) using b-actin as loading control. 2.6. Statistical analysis Data for development rate of oocytes/embryos and relative abundance values for GDF9 mRNA and proteins were analyzed using SYSTAT version 12 software packages. Differences of means were analyzed using one way ANOVA followed by Duncan’s multi-
Fig. 1. Expansion of cumulus mass (200) under different IVM supplements groups (A) all supplement (control) (B) FSH (C) IGF1 and (D) estradiol. The histogram represents cumulus expansion indices (CEI) under different IVM supplement groups. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
480
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
Fig. 3. Expression pattern of GDF9 gene in buffalo oocytes matured under different IVM supplements. Relative mRNA abundance values were measured at 0, 8, 16 and 24 h of maturation and presented in comparison to immature oocytes at 0 h of culture. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
cantly different. In control group, significantly higher percentage of cleaved eggs reached at blastocyst stage as compared to FSH supplement group the least was in IGF1 and E2 supplement alone (Fig. 2). 3.2. GDF9 expression in oocytes under different IVM supplementations
Fig. 2. Effect of different IVM supplements nuclear maturation (M-II), cleavage rate and blastocyst rates. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
ple range test (DMRT). Significance of differences between means was calculated at 5% level of significance (P < 0.05). Correlation values were calculated using Pearson product moment correlation analysis. Significance of correlation values were calculated at 5% (P < 0.05) and 1% levels (P < 0.01).
3. Results 3.1. Development rate of buffalo oocytes under different IVM media supplements Development rate of oocytes under different IVM media supplements were assessed in terms of cumulus expansion index (CEI), maturation (M-II)%, cleavage rate and blastocyst development rates. Oocytes matured in control and FSH IVM groups were observed to undergo maximum cumulus expansion with highest CEI value. Supplementing the IVM medium with IGF1 and E2 alone was not found enough to support optimum cumulus expansion (Fig. 1). Concomitant with higher cumulus expansion more number of oocytes were observed attaining nuclear maturation in control and FSH groups but about 75% and 69.8% of oocytes matured with individual supplementation of IGF1 and E2, respectively, were also found to reach at M-II state. The cleavage rates obtained in different groups followed the same trend as observed for CEI and M-II rates with significantly more oocytes found cleaved in control group as compared to other groups. The difference of cleavage rates between the E2 and other three IVM groups were signifi-
Expression of GDF9 gene was assayed in maturing buffalo oocytes at regular time intervals of 8 h to understand the temporal expression behavior of this gene in oocytes vis-à-vis efficiency of attaining their development ability. Fig. 3 represents trends of GDF9 expression in individual IVM supplement groups at respective time points where relative transcript abundance values as compared to immature oocytes (at 0 h just after collection) are depicted. At 8 h of IVM, GDF9 was found to be upregulated in control and FSH groups, the highest being in control group followed by FSH, IGF1 and E2. As an overall expression pattern during subsequent hour intervals GDF9 expression followed a downregulation trend in all IVM supplement group up to 24 h except. Very surprisingly however, GDF9 was found to be significantly upregulated at 16 h of IVM in IGF1 group. 3.3. Appearance of GDF9 protein in oocytes during maturation Western blot analysis of buffalo oocyte extracted proteins with GDF9 antibody demonstrated two unique bands of approximate molecular weights at 20 and 57 kDa (Figs. 4 and 5) and were interpreted as pro and mature protein fractions of GDF9 [12,24,20]. Beta actin antibody revealed a distinct 43 kDa band as expected (Fig. 4).
Fig. 4. Immunoblot analysis of oocytes revealed 2 distinct bands for of GDF9 at 20 kDa representing the mature GDF9 monomer and at 57 kDa representing GDF9 proprotein. b Actin revealed a single and distinct band at 43 kDa.
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
481
Fig. 5. Representative immunoblots of GDF9 pro-protein and mature proteins and b actin from a fixed number of 60 oocytes during oocyte maturation under different IVM supplement groups. b-Actin was used as loading control.
Fig. 6 represents the densitometric analysis of GDF9 protein appearance trend in oocytes at different time points of IVM. As an overall expression pattern in all IVM groups GDF9 pro-peptide was increased during maturation up to 16 h followed by a downregulation trend up to 24 h except in FSH group where it was found to be in increasing trend throughout maturation (Fig. 6). At 8 h of IVM, GDF9 pro-peptide level was found to be highest in control group as compared to other groups but at 16 h it was found significantly higher in control, FSH and IGF1 groups as compared E2. Mature GDF9 protein level was found increased during maturation up to 16 h in control and FSH groups only. The mature protein at 24 h did not reveal a definite trend across different IVM groups. 3.4. Correlation of GDF9 mRNA and protein expression with development rate of oocytes Correlation analysis of the pooled data across all IVM groups revealed that the GDF9 mRNA abundance levels were most consistently associated with all oocyte development rate criteria viz. CEI, M-II, cleavage and blastocyst rates at early phase of oocyte maturation. Pearson correlation values obtained for respective pairs of observations were highly significant for all criteria at 8 h of IVM. No consistent trend was observed however, at 16 and 24 h. Similarly appearance of GDF9 pro-protein in oocytes maintained a significant association at 8 h with cleavage rate and blastocyst rate. Interestingly appearance of mature GDF9 protein was most consistently associated with all development rate parameters at 16 h (Fig. 7). 4. Discussion The present investigation reports the effect of individual IVM media supplements on temporal expression behavior of GDF9 mRNA and proteins in buffalo oocytes and their association with development ability of oocytes. The study was specifically intended to understand the expression dynamics of GDF9 gene in oocytes in course of in vitro maturation to identify the most crucial time point during IVM for establishing an effective oocyte cumulus cross talk in buffalo COCs which eventually confers an optimum competence to buffalo oocytes [28]. In the present study the degree of cumulus expansion (CEI) observed with different supplements was supportive of the role of cumulus cells in imparting competence to buffalo oocytes [6,61]. Oocytes matured under the ideal condition of control along with those matured with only FSH revealed highest levels of cumulus expansion, nuclear maturation, cleavage and blastocyst rates (Figs. 1 and 2). For all oocyte development parameters individual supplements of IGF1 and estradiol (E2) yielded values significantly lower than the other two groups. During their expansion cumulus cells change from a compact cell mass into a dispersed structure and synthesize a mucoid intercellular matrix which is thought important for final stage of oocyte maturational changes [61]. It has been
reported earlier that during cumulus expansion the hyaluronan in a receptor mediated mechanism induces activation of maturation promoting factors (MPFs), resulting in germinal vesicle breakdown. Disruption of gap junctions in the COCs during a defined time of IVM also controls the incidence of meiotic resumption in the porcine oocytes [61]. As observed in the present study FSH has been known to be helpful for maturation of oocytes towards successful fertilization and further development of embryos in several species [37,51,41,16]. However, these FSH mediated functions have been reported to be critically dependent on the presence of oocyte secreted factors (OSFs) and associated activation of SMAD/ MAP kinase signaling pathways [10,60]. Effect of IGF1 on maturation of oocytes in the present study was however different than reported earlier [42] which could be due to different basal medium used and use of IGF1 and gonadotropin in combination. A complete description of the oocyte secreted factors (OSFs) however, still remains obscure [20]. Paracrine signaling of oocyte has been studied extensively in various species to hint that GDF9 along with BMP15 could be the most crucial oocyte derived factor/s to mediate its communication with surrounding cumulus cells [55,29]. A significant correlation between higher GDF9 proteins in the follicular fluid with oocyte maturation and embryo quality has been reported in human [21]. But, well planned experimental evidences are lacking to answer the key question of when or for how long the GDF9 expression is important during IVM? Possibility of wide species difference has been reported also with respect to exact chronology of events [53]. In present study we studied kinetics of GDF9 expression in relation to development competence in buffalo oocytes. On commencement of culture, GDF9 expression was found to be upregulated at 8 h of IVM in control and FSH groups and at this time the mRNA abundance values were highly correlated with development rate of embryos (Fig. 3). At 8 h of IVM the abundance level of GDF9 transcript was significantly lower in IGF1 and E2 groups and all development parameters viz. CEI, M-II, cleavage and blastocysts rates were also lower in these 2 groups. The down trend of GDF9 expression in all IVM groups was observed at 16 h (except in IGF1 group) and further downregulation towards the end of maturation at 24 h was as expected. Similar downregulation trend of GDF9 towards the end of IVM has been reported in bovine and porcine [43,15,32]. Like other oocyte expressed genes downregulation of GDF9 could be explained by either polyadenylation regulated expression of gene transcripts on resumption of meiosis [22,56]. It is generally considered that mRNAs stored during the oocyte growth phase are either degrade in a step wise manner or are translated to proteins which regulate subsequent embryonic developmental processes [8,14]. In bovine oocytes, the polyadenylation levels of several selected genes have been found to decrease at the terminal phase of in vitro maturation [4,31]. In present study Western blot analysis of buffalo oocytes demonstrated two unique bands of approximate molecular masses 20 and 57 kDa (Fig. 4), which are consistent with that of mouse and rat GDF9. The mature monomeric form of mouse and rat GDF9
482
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
Fig. 6. Expression pattern of GDF9 pro and mature proteins during maturation of buffalo oocytes. Abundance values for GDF9 proteins were normalized against bactin. Data are expressed as relative pixel density (Mean ± SEM). Different alphabets indicate significant difference (P < 0.05).
with one N-linked oligosaccharide is of 20 kDa whereas a 57 kDa product has been reported to correspond to the glycosylated, unprocessed form of 453 amino acids [12,24,20]. Across all IVM groups in the present study the GDF9 pro-protein was found to be significantly associated with cleavage rate and blastocyst rate at 8 h of IVM but the mature GDF9 protein which represents the functional molecule was found to be significantly correlated with all oocyte development parameters at 16 h of IVM (Fig. 7). Disagreement of the of pro and mature GDF9 protein data observed at 16 h of IGF1 group was however, very peculiar (Fig. 6). Albeit, such non parallel appearance of pro and mature proteins has been observed in human follicular fluid recently possibly due to aberrant post-transcriptional processing of GDF9 pro proteins [21]. A species specific difference in post transcriptional processing of BMP15 transcripts has also been indicated [23]. Interestingly, the association dynamics of GDF9 mRNA, pro-protein and mature protein with development fate of oocytes displayed an apparent asynchrony in the time course of IVM (Fig. 7). It has been reported that at the time of resumption of meiosis in oocytes, active transcription ceases, however, translation of the mRNA pool continues throughout till the end of meiosis [57]. The most common mechanisms that regulate gene expression in oocytes at the posttranscriptional level are mRNA adenylation and deadenylation and effective action of mRNA binding factors at the CAP structure of mRNAs [45,44]. In mouse oocytes representative transcripts with tails of 150 adenine (A) residues have been indicated for immediate use, whereas the mRNA with shorter poly-A tails of 90 constitute the storage form of RNA to be inducted for translation only after further elongation of the poly-A tail [1]. Also, the gap junction communication between oocytes and cumulus cells undergo dynamic remodeling in a gonadotropin-dependent manner concurrent with the resumption of oocyte meiosis which contributes to the time lag between mRNA and protein appearance in maturing oocytes and explains observation of present study [46]. In conclusion the present study conclude that buffalo oocytes remain heavily dependent on GDF9 expression particularly during
Fig. 7. Pearson correlation coefficients of oocyte development rate parameters (MII, CEI, Cleavage and Blastocyst rates) with GDF9 mRNA, pro-protein and mature protein levels at different time points of oocyte maturation (8, 16 and 24 h) (a) significant at P < 0.01 (b) significant at P < 0.05.
early phase of oocyte maturation and suboptimum expression of this gene severely affected the development potential of oocytes. Further, appearance of mature GDF9 proteins in oocytes followed a time lag between transcription and translation of this gene possibly mediated by dynamic bi-directional communication events in maturing oocytes. The information generated will be helpful in understanding typicalities of buffalo oocyte biology and will contribute to further optimizing the IVF protocol for this species towards gaining increased success rate of ART procedures. Acknowledgments The authors are thankful for support of fund under NAIP/C4/ C1056 to the corresponding author and CSIR Jr. Research Fellowship to Tripti Jain. Help of Mr. Gian Singh, Computer Centre, NDRI, Karnal for analysis of data is thankfully acknowledged. References [1] R. Bachvarova, A maternal tail of poly(A): the long and short of it, Cell 69 (1992) 895–897. [2] A. Bettegowda, O.V. Patel, K.B. Lee, K.E. Park, M. Salem, J. Yao, J.J. Ireland, G.W. Smith, Identification of novel bovine cumulus cell molecular markers predictive of oocyte competence: functional and diagnostic implications, Biol. Reprod. 79 (2008) 301–309.
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484 [3] B.G. Brackett, G. Oliphant, Capacitation of rabbit spermatozoa in vitro, Biol. Reprod. 12 (1975) 260–274. [4] T.A. Brevini-Gandolfi, L.A. Favetta, L. Mauri, A.M. Luciano, F. Cillo, F. Gandolfi, Changes in poly(A) tail length of maternal transcripts during in vitro maturation of bovine oocytes and their relation with developmental competence, Mol. Reprod. Dev. 52 (1999) 427–433. [5] M.S. Chauhan, S.K. Singla, P. Palta, R.S. Manik, M.L. Madan, In vitro maturation and fertilization, and subsequent development of buffalo (Bubalus bubalis) embryos: effect of oocytes quality and type of serum, Reprod. Fert. Dev. 10 (1998) 173–177. [6] L. Chen, P.T. Russell, W.J. Larsen, Functional significance of cumulus expansion in the mouse: roles for the preovulatory synthesis of hyaluronic acid within the cumulus mass, Mol. Reprod. Dev. 34 (1993) 87–93. [7] J.L. Crawford, K.P. McNatty, The ratio of growth differentiation factor 9: bone morphogenetic protein 15 mRNA expression is tightly co-regulated and differs between species over a wide range of ovulation rates, Mol. Cell Endocrinol. 348 (2012) 339–343. [8] N. Crozet, Nucleolar structure and RNA synthesis in mammalian oocytes, J. Reprod. Fert. 38 (1989) 9–16. [9] P.A. De sousa, M.E. Westhusin, A.J. Watson, Analysis of variation in relative mRNA abundance for specific gene transcripts in single bovine oocytes and early embryos, Mol. Reprod. Dev. 49 (1998) 119–130. [10] R.A. Dragovic, L.J. Ritter, S.J. Schulz, F. Amato, J.G. Thompson, D.T. Armstrong, R.B. Gilchrist, Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion, Biol. Reprod. 76 (2007) 848–857. [11] M. Drost, Advanced reproductive technology in the water buffalo, Theriogenology 68 (2007) 450–453. [12] J.A. Elvin, A.T. Clark, P. Wang, N.M. Wolfman, M.M. Matzuk, Paracrine actions of growth differentiation factor-9 in the mammalian ovary, Mol. Endocrinol. 13 (1999) 1035–1048. [13] C.F. Fagbohun, S.M. Downs, Maturation of the mouse oocyte–cumulus cell complex: stimulation by lectins, Biol. Reprod. 42 (1990) 413–423. [14] T. Fair, P. Hyttel, T. Greve, M. Boland, Nucleus structure and transcriptional activity in relation to oocyte diameter in cattle, Mol. Reprod. Dev. 43 (1996) 503–512. [15] T. Fair, F. Carter, S. Park, A.C.O. Evans, P. Lonergan, Global gene expression analysis during bovine oocyte in vitro maturation, Theriogenology 68 (2007) 91–97. [16] C.E. Farin, K.F. Rodriguez, J.E. Alexander, J.E. Hockney, J.R. Herrick, S.K. Stoskopf, The role of transcription in EGF- and FSH-mediated oocyte maturation in vitro, Anim. Reprod. Sci. 98 (2007) 97–112. [17] C.A. Fox, M.D. Sheets, E. Wahle, Polyadenylation of maternal mRNA during oocyte maturation: poly(A) addition in vitro requires a regulated RNA binding activity and a poly(A) polymerase, EMBO J. 11 (1992) 5021–5032. [18] B. Gasparrini, L. Boccia, J. Marchandise, R.D. Palo, F. George, I. Donnay, L. Zicarelli, Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: effects of cysteine on glutathione synthesis and embryo development, Theriogenology 65 (2006) 275–287. [19] A. George, R. Sharma, K.P. Singh, S.K. Panda, S.K. Singla, P. Palta, RS. Manik, M.S. Chauhan, Production of cloned and transgenic embryos using buffalo (Bubalus bubalis) embryonic stem cell-like cells isolated from in vitro fertilized and cloned blastocysts, Cell. Reprogram. 13 (2011) 539–549. [20] R.B. Gilchrist, L.J. Ritter, M. Cranfield, L.A. Jeffery, F. Amato, S.J. Scott, S Myllymaa, N.K. Oja, H. Lankinen, D.G. Mottershead, N.P. Groome, O. Ritvos, Immunoneutralization of growth differentiation factor 9 reveals it partially accounts for mouse oocyte mitogenic activity, Biol. Reprod. 71 (2004) 732– 739. [21] F. Gode, B. Gulekli, E. Dogan, P. Korhan, S. Dogan, O. Bige, D. Cimrin, N. Atabey, Influence of follicular fluid GDF9 and BMP15 on embryo quality, Fert. Steril. 95 (2011) 2274–2278. [22] R.G. Gosden, Oogenesis as a foundation for embryogenesis, Mol. Cell Endocrinol. 186 (2002) 149–153. [23] O. Hashimoto, R.K. Moore, S. Shimasaki, Posttranslational processing of mouse and human BMP-15: potential implication in the determination of ovulation quota, Proc. Natl. Acad. Sci. USA 102 (2005) 5426–5431. [24] M. Hayashi, E.A. McGee, G. Min, C. Klein, U.M. Rose, M. van Duin, A.J. Hsueh, Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles, Endocrinology 140 (1999) 1236–1244. [25] T.S. Hussein, J.G. Thompson, R.B. Gilchrist, Oocytes secreted factors enhance oocyte developmental competence, Development 296 (2006) 514–521. [26] G.M. Jones, D.S. Cram, B. Song, M.C. Magli, L. Gianaroli, O.L. Kaplan, J.K. Findlay, G. Jenkin, A.O. Trounson, Gene expression profiling of human oocytes following in vivo or in vitro maturation, Hum. Reprod. 23 (2008) 1138–1144. [27] C.L. Keefer, S.L. Stice, D.L. Matihews, Bovine inner cell mass cells as donor nuclei in the production of nuclear transfer embryos and calves, Biol. Reprod. 50 (1994) 935–939. [28] G.M. Kidder, B.C. Vanderhyden, Bidirectional communication between oocytes and follicle cells: ensuring oocyte developmental competence, Can. J. Physiol. Pharmacol. 88 (2010) 399–413. [29] P.G. Knight, C. Glister, TGF-b superfamily members and ovarian follicle development, Reproduction 132 (2006) 191–206. [30] D. Kumar, P. Palta, R.S. Manik, S.K. Singla, M.S. Chauhan, Effect of culture media and serum supplementation on the development of in vitro fertilized burno embryos, Indian J. Anim. Sci. 77 (2007) 697–701.
483
[31] A.S. Lequarre, J.M. Traverso, J. Marchandise, I. Donnay, Poly(A) RNA is reduced by half during bovine oocyte maturation but increases when meiotic arrest is maintained with CDK inhibitors, Biol. Reprod. 71 (2004) 425–431. [32] H.K. Li, T.Y. Kuo, H.S. Yang, L.R. Chen, S.S. Li, H.W. Huang, Differential gene expression of bone morphogenetic protein 15 and growth differentiation factor 9 during in vitro maturation of porcine oocytes and early embryos, Anim. Reprod. Sci. 103 (2008) 312–322. [33] R. Lin, Maternal mRNA and the polyA tail in oocytes, Nat. Educ. 3 (2010) 47. [34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (2001) 402–408. [35] M.M. Matzuk, K.H. Burns, M.M. Vivieros, J.J. Eppig, Intercellular communication in the mammalian ovary: oocytes carry the conversation, Science 296 (2002) 2178–2180. [36] S.A. McGrath, A.F. Esquela, S.J. Lee, Oocyte-specific expression of growth/ differentiation factor-9, Mol. Endocrinol. 9 (1995) 131–136. [37] J.A. Merriman, D.G. Whittingham, J. Carroll, The effect of follicle stimulating hormone and epidermal growth factor on the developmental capacity of invitro matured mouse oocytes, Hum. Reprod. 13 (1998) 690–695. [38] S. Nandi, H.M. Raghu, B.M. Ravindranatha, M.S. Chauhan, Production of buffalo (Bubalus bubalis) embryos in vitro: premises and promises, Reprod. Domest. Anim. 37 (2002) 65–74. [39] P.K. Nicholls, C.A. Harrison, R.B. Gilchrist, P.G. Farnworth, P.G. Stanton, Growth differentiation factor 9 is a germ cell regulator of sertoli cell function, Endocrinology 150 (2009) 2481–2490. [40] M. Orisaka, S. Orisaka, J.Y. Jiang, J. Craig, Y. Wang, F. Kotsuji, B.K. Tsang, Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage, Mol. Endocrinol. 20 (2006) 2456–2468. [41] J.Y. Park, Y.Q. Su, M. Ariga, E. Law, S.L. Jin, M. Conti, EGF-like growth factors as mediators of LH action in the ovulatory follicle, Science 303 (2004) 682–684. [42] C.H. Pawshe, K.B. Rao, S.M. Totey, Effect of insulin-like growth factor I and its interaction with gonadotropins on in vitro maturation and embryonic development, cell proliferation, and biosynthetic activity of cumulus–oocyte complexes and granulosa cells in buffalo, Mol. Reprod. Dev. 49 (1998) 277– 285. [43] S. Pennetier, S. Uzbekova, C. Perreau, P. Papollier, P. Mermillod, R. Dalbies-Tran, Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15 and VASA in bovine adult tissues, oocytes and preimplantation embryos, Biol. Reprod. 71 (2004) 1359–1366. [44] F. Piccioni, V. Zappavigna, A. Verrotti, Translational regulation during oogenesis and early development, the cap-poly(A) tail relationship, C. R. Biol. 328 (2005) 863–881. [45] U.E. Ritter, M. Peschke, Expression in in-vivo and in-vitro growing and maturing oocytes: focus on regulation of expression at the translational level, Hum. Reprod. 8 (2002) 21–41. [46] M. Sasseville, M.C. Gagnon, C. Guillemette, R. Sullivan, R.B. Gilchrist, F.J. Richard, Regulation of gap junctions in porcine cumulus–oocyte complexes: contributions of granulosa cell contact, gonadotropins, and lipid rafts, Mol. Endocrinol. 23 (2009) 700–710. [47] M.A. Sirard, F. Richard, P. Blondin, C. Robert, Contribution of the oocyte to embryo quality, Theriogenology 65 (2006) 126–136. [48] L.C. Smith, Membrane and intracellular effects of ultraviolet irradiation with Hoechst 33342 on bovine secondary oocytes matured in vitro, J. Reprod. Fert. 99 (1993) 39–44. [49] T. Somfai, K. Imai, M. Kaneda, S. Akagi, S. Watanabe, S. Haraguchi, E. Mizutani, T.Q. Dang-Nguyen, Y. Inaba, M. Geshi, T. Nagai, The effect of ovary storage and in vitro maturation on mRNA levels in bovine oocytes; a possible impact of maternal ATP1A1 on blastocyst development in slaughterhouse-derived oocytes, J. Reprod. Dev. 57 (2011) 723–730. [50] J.L. Song, G.M. Wessel, How to make an egg: transcriptional regulation in oocytes, Differentiation 73 (2005) 1–17. [51] Y.Q. Su, K. Wigglesworth, F.L. Pendola, M.J. O’Brien, J.J. Eppig, Mitogenactivated protein kinase activity in cumulus cells is essential for gonadotropininduced oocyte meiotic resumption and cumulus expansion in the mouse, Endocrinology 143 (2002) 2221–2232. [52] Y.Q. Su, K. Sugiura, Y. Woo, K. Wigglesworth, S. Kamdar, J. Affurtit, J.J. Eppig, Selective degradation of transcripts during meiotic maturation of mouse oocytes, Dev. Biol. 302 (2007) 104–117. [53] H. Suzuki, B.S. Jeong, X. Yang, Dynamic changes of cumulus–oocyte cell communication during in vitro maturation of porcine oocytes, Biol. Reprod. 63 (2000) 723–729. [54] B.C. Vanderhyden, P.J. Caron, R. Buccione, J.J. Eppig, Developmental pattern of the secretion of cumulus expansion-enabling factor by mouse oocytes and the role of oocytes in promoting granulosa cell differentiation, Dev. Biol. 140 (1990) 307–317. [55] B.C. Vanderhyden, E.A. Macdonald, E. Nagyova, A. Dhawan, Evaluation of members of the TGF beta superfamily as candidates for the oocyte factors that control mouse cumulus expansion and steroidogenesis, Reprod. Suppl. 61 (2003) 55–70. [56] Q.T. Wang, K. Piotrowska, M.A. Ciemerych, L. Milenkovic, M.P. Scott, R.W. Davis, M. Zernicka-Goetz, A genome wide study of gene activity reveals developmental signaling pathways in the preimplantation mouse embryo, Dev. Cell 6 (2004) 133–144. [57] P.M. Wassarman, C. Liu, E.S. Litscher, Constructing the mammalian zona pellucida: some new pieces of an old puzzle, J. Cell Sci. 109 (1996) 2001–2004.
484
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
[58] A.J. Watson, Oocyte cytoplasmic maturation: a key mediator of oocyte and embryo developmental competence, J. Anim. Sci. 85 (2007) E1–E3. [59] A.J. Watson, P. De Sousa, A. Caveney, L.C. Barcroft, D. Natale, J. Urquhart, M.E. Westhusin, Impact of bovine oocyte maturation media on oocyte transcript levels, blastocyst development, cell number, and apoptosis, Biol. Reprod. 62 (2000) 355–364.
[60] C.X. Yeo, R.B. Gilchrist, J.G. Thompson, M. Lane, Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice, Hum. Reprod. 23 (2008) 67– 73. [61] M. Yokoo, E. Sato, Cumulus–oocyte complex interactions during oocyte maturation, Int. Rev. Cytol. 91 (2004) 235–251.
Contents lists available at SciVerse ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Kinetics of GDF9 expression in buffalo oocytes during in vitro maturation and their associated development ability Tripti Jain 1, Asit Jain 1, Parveen Kumar 2, S.L. Goswami, S. De, Dheer Singh, T.K. Datta ⇑ Animal Biotechnology Centre, National Dairy Research Institute, Karnal 132001, Haryana, India
a r t i c l e
i n f o
Article history: Received 11 April 2012 Revised 30 June 2012 Accepted 6 July 2012 Available online 16 July 2012 Keywords: Buffalo Oocyte GDF9
a b s t r a c t The capacity of fully grown oocytes to regulate their own microenvironment by secreted paracrine factors contribute to their developmental competence. In spite of growing evidence about the vital role of Growth Differentiation Factor 9 (GDF9) in determination of oocyte developmental competence, there is insufficient information about time dependent behavior of its expression during in vitro maturation (IVM) to have definite understanding about at what time point during IVM it plays most crucial role. The study reports the kinetics of GDF9 expression under four different IVM supplement conditions in buffalo oocytes and their concomitant development rate up to blastocyst. Oocytes matured under an ideal media condition with all supplements and those cultured with only FSH resulted in significantly higher cumulus expansion, nuclear maturation, cleavage and blastocyst rates. GDF9 expression at both mRNA and protein levels at different time points of IVM revealed that magnitude of mRNA abundance at 8 h of IVM was most important towards imparting development competence to buffalo oocytes. Appearance of GDF9 protein in maturing oocytes was found asynchronous with mRNA appearance in the time course of IVM suggesting possible posttranscriptional regulation of this gene under dynamic oocyte cumulus cell communication process. Abundance of mature GDF9 protein at 16 h was most consistently related with all oocyte development parameters. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction During the process of its maturation mammalian oocytes accumulate and store large amount of maternal mRNAs; an ordered regulation of which ultimately dictate the acquisition of developmental competence of oocytes and further embryonic development [50,58,33]. In a typical in vitro fertilization (IVF) procedure, in vitro maturation (IVM) of oocytes constitute the most challenging step because an orchestrated genes expression events during this time determines the efficiency of fertilization and subsequent embryonic division process leading to blastocyst formation and even successful implantation [49]. Aberrant degradation and/or maintenance of maternally inherited as well as de novo synthesized transcripts during oocyte maturation adversely affect the oocyte’s ability to undertake an orderly development [52]. A suboptimum IVM support results in persistent alterations of the
⇑ Corresponding author. Address: Genomics Lab, Animal Biotechnology Centre, National Dairy Research Institute, Karnal 132001, Haryana, India. Fax: +91 184 2250042. E-mail address: [email protected] (T.K. Datta). 1 These authors contributed equally to this work. 2 Present address: Division of Hematology and Transfusion Medicine, LUND University, Sweden. 0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2012.07.001
normal gene expression patterns and affect the developmental fate of IVF produced embryos very drastically [9,59,26]. Thus information on expression pattern of oocyte-expressed genes vis-à-vis their development fate is critical for deciding strategies for how more number of oocytes could be stimulated to gain optimum development competence eventually contributing to the success rate of various ART protocols in different livestock species [47]. GDF9 is an oocyte-specific paracrine factor which is expressed throughout most stages of folliculogenesis and persists after fertilization and play important role in bi-directional communication between oocytes and its surrounding cumulus cells [36,35]. GDF9 level in follicular fluid has been found significantly correlated with the nuclear maturation of the human oocytes and subsequent embryo quality [21]. Addition of exogenous GDF9 in oocyte maturation media has also enhanced subsequent development rate of oocytes in mice as well as bovine [60,25]. In spite of emerging evidence however, information about the kinetics of GDF9 expression during IVM remains incomplete and it is still not clear that at what stage of IVM GDF9 exerts most profound effect possibly in a species specific manner [7]. Buffaloes (Bubalus bubalis) in this regard remain a poorly understood species. Economic importance of this species as dairy animal in well documented and several ARTs have been successfully demonstrated [38,19] but, poor success rate of these procedures have kept pending their widespread adoption
478
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
[18,11]. The present study was planned to elucidate expression pattern of GDF9 gene in buffalo oocytes in course of in vitro maturation and their associated development competence. Appearance of GDF9 mRNA as well as its corresponding protein was tracked in buffalo oocytes at different time points of IVM to understand the dynamics of transcription and translation control of this gene and its relationship with development ability of oocytes [17,57,45]. 2. Materials and methods All media and chemicals were procured from Sigma Aldrich, St. Louis, MO, USA unless otherwise indicated. Disposable plastic wares used were from Falcon NJ, USA and Nunc, Denmark. Fetal bovine serum used was from Hyclone, Canada. 2.1. Production of buffalo embryos Buffalo ovaries were collected at an abattoir, regardless of the estrous cycle and transported within 3–4 h to the laboratory in phosphate buffer saline (PBS) containing strepto-penicillin (0.05 mg/ml). Ovaries were washed several times in normal saline and cumulus oocyte complexes (COCs) were aspirated from visible ovarian surface follicles in hepes-buffered hamster embryo culture (HH) medium [27]. COCs were picked up under stereo zoom microscope and washed three times in HH medium. They were evaluated according to morphological criteria and separated according to their quality. Only excellent grade oocytes with more than five compact layers of cumulus cells and homogenous cytoplasm were used for IVM and IVF. A group of 25 COCs were put for in vitro maturation (IVM) in 4 different supplementation media viz. (1) All supplementation group (Henceforth called Control): TCM-199 with 0.005% streptomycin, 0.01% sodium pyruvate and 0.005% glutamine, 64 lg/ml cysteamine and 50 ll ITS as base medium and supplemented with 10% fetal bovine serum (FBS), 5.0 lg/ml porcine follicle stimulating hormone (pFSH), 10 lg/ml luteinizing hormone (LH), 1 lg/ml estradiol 17-b (E2) and 50 ng/ml epidermal growth factor (EGF), (2) FSH group: TCM-199 base medium containing PVA (1 mg/ml) and 5.0 lg/ml porcine follicle stimulating hormone (3) IGF1 group: same as media 2 where FSH was replaced with 100 ng/ml of IGF1 and (4) estradiol group: same as media 2 where FSH was replaced with 1 lg/ml of estradiol 17 b (E2). For IVM, oocytes were placed in drops of 100 ll maturation media and overlaid with mineral oil. Oocytes were allowed to mature at 38.5 °C in an atmosphere of 5% CO2 in air. In vitro fertilization (IVF) was done in 100 ll droplets of BO medium [3] supplemented with 1% BSA (fatty acid free), 1.9 mg/ml caffeine sodium benzoate, 0.14 mg/ml sodium pyruvate and 0.01 mg/ml heparin. Prior to transfer in fertilization drops; matured COCs were washed thrice in BO medium. The frozen thawed buffalo semen was processed for in vitro capacitation as per the procedure described earlier [5] and 50 ll of the sperm suspension (at final concentration of 1 106/ml) was added to each fertilization drops having 15–20 COCs and incubated at 38.5 °C with 5% CO2 for 14 h. Presumptive zygotes were removed from the fertilization drops after 14 h of insemination (HPI), adhered cumulus cells were mechanically removed by vortexing and washed five times in mCR2aa medium [30]. After washing, 15–20 presumptive zygotes were co-cultured with monolayers of granulosa cells in 100 ll drops of IVC-I medium (mCR2aa supplemented with 0.8% BSA, 1 mM glucose, 0.33 mM pyruvate, 1 mM glutamine, 1 MEM essential amino acid, 1 non-essential amino acid and 50 lg/ml gentamycin. After 48 h of insemination (HPI) zygotes were evaluated for evidence of cleavage. At 72 HPI all cleaved embryos were transferred to IVC-II medium (same as IVC-I except BSA replaced with 10% FBS) and
maintained for 8 days at 5% CO2 and 38.5 °C with replacement of medium after every 48 h. 2.2. Observations made on developing oocytes and embryos All IVM and IVF experiments were repeated at least four times. After 24 h of IVM, levels of cumulus expansions was scored in a scale of 0–4 and the cumulus expansion index (CEI) was calculated as described before [13]. COCs with no cumulus expansion were scored as 0 and those with maximum degree of expanded cumulus mass were scored 4. Cumulus mass with intermediate expansions characterized by the detachment from oocytes or expansion of only the outer most layers was marked as 2 or 3 [54]. To determinate attainment of metaphase-II (M-II) denuded oocytes were stained with Hoechst 33342 using protocol described before [48] with slight modification. Briefly, denuded oocytes from all experimental groups were fixed in 4% paraformaldehyde solution (in PBS, pH 7.4) for 1 h at room temperature. After fixing and washing, groups of 50 oocytes were transferred to 200 ll drop of 10 lg/ml Hoechst 33342 dye solution for 20 min under dark condition. Stained oocytes were washed three times in PBS–PVP solution and placed on glass slides and mounted with Pro-Long mounting medium (Invitrogen, USA) and observed under the fluorescent microscope with UV filter (Olympus, Japan). Oocytes nuclei revealing two blue dots were considered as matured (M-II) oocytes. MII% was calculated for each IVM groups for at least 250 oocytes. Cleavage and blastocyst stages of the embryos were recorded on day 2 and 7 post insemination, respectively, in all four experimental groups. 2.3. RNA isolation and cDNA preparation Samples of a pool of 10 oocytes were used in 4 biological replicates for each experimental group. Total RNA was extracted from a fixed number of 10 oocytes were collected at different time intervals of maturation using the RNAqueous Micro Kit (Ambion) as per manufacturer’s instruction. Total RNA was eluted in elution buffer and treated with RNase-free DNase I (Ambion) to remove any contaminating genomic DNA. Total RNA (10 ll) from each samples were reverse-transcribed using Revert-Aid Kit (Fermentas, USA) following the manufacturer’s instructions using oligo-dT primers in a final volume of 20 ll. After termination of cDNA synthesis, each RT reactions were diluted with nuclease-free water to a final volume of 80 ll and stored at 80 °C till further use. 2.4. Quantitative real-time RT-PCR Quantification of GDF9 transcript was carried out by real-time PCR using Maxima SYBR Green qPCR Master Mix (Fermentas, USA). Primers used for GDF9 amplification were forward: CTCAGCACAAGCAAGCTCCT and reverse: GGGAAGGGAAAAGAAATGGA designed using the Beacon Designer 7.0 (Premier Biosoft, International) and derived from buffalo specific GDF9 sequences FJ529501.2. RSP18 transcripts were amplified as an internal calibrator using primers forward: GAAAATTGCCTTTGCCATCACTGC and reverse: GATCACACGTTCCACCTCATCCTC (Designed using bovine sequence NM_001033614). A working primer concentration of 10 pmol was used to set a primer matrix experiment to optimize the primer concentrations for valid transcript quantification [2]. Real time PCR reaction mixtures were consisted of 10 ll of syber green qPCR mix, 2 ll of cDNA template, optimized primer quantities and nuclease free water to make the total reaction volume of 20 ll. Reactions were performed in duplicate for each samples using Mx3005P real time PCR System (Stratagene). PCR conditions used were 95 °C for 10 min, then 40 cycles consisting of denaturation at 95 °C for 30 s, annealing at 57 °C for 20 s and extension
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
at 72 °C for 30 s. No template control reactions were carried to negate PCR contamination and dissociation curve analysis was performed to confirm authenticity of amplified products. Mean sample threshold cycle values (CT) for GDF9 and RSP18 were calculated for duplicate samples and relative transcript abundance for target gene expression was calculated using the formula 2 (DDCT) [34]. 2.5. Western blot analysis of GDF9 protein Detection of GDF9 protein in oocyte extracts (from a fixed number of 60 oocytes) was done by Western blot assay. Proteins in oocyte extract were resolved in 12% SDS polyacrylamide gel. Electrophoretically separated polypeptides were transferred to Polyvinylidene-fluoride (PVDF) membrane (Millipore, USA) using vertical electrophoresis system (Hoefer, UK). The membrane was blocked with 5% skimmed milk powder solution in 1 phosphate buffered saline Tween-20 (PBS-T) at room temperature for 1 h and then treated with goat anti GDF9 polyclonal primary antibody (1:200 dilutions) (Santa Cruz, USA, Cat # SC12244) and mouse anti
479
b-actin polyclonal primary antibody (1:200 dilution) (Santa Cruz, USA) at 4 °C for overnight. The specificity of GDF9 antibody used in the present study for Western blot and immuno histochemistry has been confirmed by previous workers [40,39]. Blots were washed with PBST and probed with optimized dilution of HRP conjugated anti-goat IgG (1:1000 dilution) (Santa Cruz, USA) and antimouse IgG (1:1000 dilution) secondary antibody (Santa Cruz, USA) for 1 h at room temperature. Membranes were washed extensively with PBS-T and DAB substrate (Bangalore Genei, India) was added to membrane for color development. When the signal was detectable, reaction was stopped by rinsing with distilled water. Intensity of signals was quantified using ImageJ (NIH) using b-actin as loading control. 2.6. Statistical analysis Data for development rate of oocytes/embryos and relative abundance values for GDF9 mRNA and proteins were analyzed using SYSTAT version 12 software packages. Differences of means were analyzed using one way ANOVA followed by Duncan’s multi-
Fig. 1. Expansion of cumulus mass (200) under different IVM supplements groups (A) all supplement (control) (B) FSH (C) IGF1 and (D) estradiol. The histogram represents cumulus expansion indices (CEI) under different IVM supplement groups. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
480
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
Fig. 3. Expression pattern of GDF9 gene in buffalo oocytes matured under different IVM supplements. Relative mRNA abundance values were measured at 0, 8, 16 and 24 h of maturation and presented in comparison to immature oocytes at 0 h of culture. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
cantly different. In control group, significantly higher percentage of cleaved eggs reached at blastocyst stage as compared to FSH supplement group the least was in IGF1 and E2 supplement alone (Fig. 2). 3.2. GDF9 expression in oocytes under different IVM supplementations
Fig. 2. Effect of different IVM supplements nuclear maturation (M-II), cleavage rate and blastocyst rates. Bars indicate Mean ± SEM. Different alphabets indicate significant difference (P < 0.05).
ple range test (DMRT). Significance of differences between means was calculated at 5% level of significance (P < 0.05). Correlation values were calculated using Pearson product moment correlation analysis. Significance of correlation values were calculated at 5% (P < 0.05) and 1% levels (P < 0.01).
3. Results 3.1. Development rate of buffalo oocytes under different IVM media supplements Development rate of oocytes under different IVM media supplements were assessed in terms of cumulus expansion index (CEI), maturation (M-II)%, cleavage rate and blastocyst development rates. Oocytes matured in control and FSH IVM groups were observed to undergo maximum cumulus expansion with highest CEI value. Supplementing the IVM medium with IGF1 and E2 alone was not found enough to support optimum cumulus expansion (Fig. 1). Concomitant with higher cumulus expansion more number of oocytes were observed attaining nuclear maturation in control and FSH groups but about 75% and 69.8% of oocytes matured with individual supplementation of IGF1 and E2, respectively, were also found to reach at M-II state. The cleavage rates obtained in different groups followed the same trend as observed for CEI and M-II rates with significantly more oocytes found cleaved in control group as compared to other groups. The difference of cleavage rates between the E2 and other three IVM groups were signifi-
Expression of GDF9 gene was assayed in maturing buffalo oocytes at regular time intervals of 8 h to understand the temporal expression behavior of this gene in oocytes vis-à-vis efficiency of attaining their development ability. Fig. 3 represents trends of GDF9 expression in individual IVM supplement groups at respective time points where relative transcript abundance values as compared to immature oocytes (at 0 h just after collection) are depicted. At 8 h of IVM, GDF9 was found to be upregulated in control and FSH groups, the highest being in control group followed by FSH, IGF1 and E2. As an overall expression pattern during subsequent hour intervals GDF9 expression followed a downregulation trend in all IVM supplement group up to 24 h except. Very surprisingly however, GDF9 was found to be significantly upregulated at 16 h of IVM in IGF1 group. 3.3. Appearance of GDF9 protein in oocytes during maturation Western blot analysis of buffalo oocyte extracted proteins with GDF9 antibody demonstrated two unique bands of approximate molecular weights at 20 and 57 kDa (Figs. 4 and 5) and were interpreted as pro and mature protein fractions of GDF9 [12,24,20]. Beta actin antibody revealed a distinct 43 kDa band as expected (Fig. 4).
Fig. 4. Immunoblot analysis of oocytes revealed 2 distinct bands for of GDF9 at 20 kDa representing the mature GDF9 monomer and at 57 kDa representing GDF9 proprotein. b Actin revealed a single and distinct band at 43 kDa.
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
481
Fig. 5. Representative immunoblots of GDF9 pro-protein and mature proteins and b actin from a fixed number of 60 oocytes during oocyte maturation under different IVM supplement groups. b-Actin was used as loading control.
Fig. 6 represents the densitometric analysis of GDF9 protein appearance trend in oocytes at different time points of IVM. As an overall expression pattern in all IVM groups GDF9 pro-peptide was increased during maturation up to 16 h followed by a downregulation trend up to 24 h except in FSH group where it was found to be in increasing trend throughout maturation (Fig. 6). At 8 h of IVM, GDF9 pro-peptide level was found to be highest in control group as compared to other groups but at 16 h it was found significantly higher in control, FSH and IGF1 groups as compared E2. Mature GDF9 protein level was found increased during maturation up to 16 h in control and FSH groups only. The mature protein at 24 h did not reveal a definite trend across different IVM groups. 3.4. Correlation of GDF9 mRNA and protein expression with development rate of oocytes Correlation analysis of the pooled data across all IVM groups revealed that the GDF9 mRNA abundance levels were most consistently associated with all oocyte development rate criteria viz. CEI, M-II, cleavage and blastocyst rates at early phase of oocyte maturation. Pearson correlation values obtained for respective pairs of observations were highly significant for all criteria at 8 h of IVM. No consistent trend was observed however, at 16 and 24 h. Similarly appearance of GDF9 pro-protein in oocytes maintained a significant association at 8 h with cleavage rate and blastocyst rate. Interestingly appearance of mature GDF9 protein was most consistently associated with all development rate parameters at 16 h (Fig. 7). 4. Discussion The present investigation reports the effect of individual IVM media supplements on temporal expression behavior of GDF9 mRNA and proteins in buffalo oocytes and their association with development ability of oocytes. The study was specifically intended to understand the expression dynamics of GDF9 gene in oocytes in course of in vitro maturation to identify the most crucial time point during IVM for establishing an effective oocyte cumulus cross talk in buffalo COCs which eventually confers an optimum competence to buffalo oocytes [28]. In the present study the degree of cumulus expansion (CEI) observed with different supplements was supportive of the role of cumulus cells in imparting competence to buffalo oocytes [6,61]. Oocytes matured under the ideal condition of control along with those matured with only FSH revealed highest levels of cumulus expansion, nuclear maturation, cleavage and blastocyst rates (Figs. 1 and 2). For all oocyte development parameters individual supplements of IGF1 and estradiol (E2) yielded values significantly lower than the other two groups. During their expansion cumulus cells change from a compact cell mass into a dispersed structure and synthesize a mucoid intercellular matrix which is thought important for final stage of oocyte maturational changes [61]. It has been
reported earlier that during cumulus expansion the hyaluronan in a receptor mediated mechanism induces activation of maturation promoting factors (MPFs), resulting in germinal vesicle breakdown. Disruption of gap junctions in the COCs during a defined time of IVM also controls the incidence of meiotic resumption in the porcine oocytes [61]. As observed in the present study FSH has been known to be helpful for maturation of oocytes towards successful fertilization and further development of embryos in several species [37,51,41,16]. However, these FSH mediated functions have been reported to be critically dependent on the presence of oocyte secreted factors (OSFs) and associated activation of SMAD/ MAP kinase signaling pathways [10,60]. Effect of IGF1 on maturation of oocytes in the present study was however different than reported earlier [42] which could be due to different basal medium used and use of IGF1 and gonadotropin in combination. A complete description of the oocyte secreted factors (OSFs) however, still remains obscure [20]. Paracrine signaling of oocyte has been studied extensively in various species to hint that GDF9 along with BMP15 could be the most crucial oocyte derived factor/s to mediate its communication with surrounding cumulus cells [55,29]. A significant correlation between higher GDF9 proteins in the follicular fluid with oocyte maturation and embryo quality has been reported in human [21]. But, well planned experimental evidences are lacking to answer the key question of when or for how long the GDF9 expression is important during IVM? Possibility of wide species difference has been reported also with respect to exact chronology of events [53]. In present study we studied kinetics of GDF9 expression in relation to development competence in buffalo oocytes. On commencement of culture, GDF9 expression was found to be upregulated at 8 h of IVM in control and FSH groups and at this time the mRNA abundance values were highly correlated with development rate of embryos (Fig. 3). At 8 h of IVM the abundance level of GDF9 transcript was significantly lower in IGF1 and E2 groups and all development parameters viz. CEI, M-II, cleavage and blastocysts rates were also lower in these 2 groups. The down trend of GDF9 expression in all IVM groups was observed at 16 h (except in IGF1 group) and further downregulation towards the end of maturation at 24 h was as expected. Similar downregulation trend of GDF9 towards the end of IVM has been reported in bovine and porcine [43,15,32]. Like other oocyte expressed genes downregulation of GDF9 could be explained by either polyadenylation regulated expression of gene transcripts on resumption of meiosis [22,56]. It is generally considered that mRNAs stored during the oocyte growth phase are either degrade in a step wise manner or are translated to proteins which regulate subsequent embryonic developmental processes [8,14]. In bovine oocytes, the polyadenylation levels of several selected genes have been found to decrease at the terminal phase of in vitro maturation [4,31]. In present study Western blot analysis of buffalo oocytes demonstrated two unique bands of approximate molecular masses 20 and 57 kDa (Fig. 4), which are consistent with that of mouse and rat GDF9. The mature monomeric form of mouse and rat GDF9
482
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
Fig. 6. Expression pattern of GDF9 pro and mature proteins during maturation of buffalo oocytes. Abundance values for GDF9 proteins were normalized against bactin. Data are expressed as relative pixel density (Mean ± SEM). Different alphabets indicate significant difference (P < 0.05).
with one N-linked oligosaccharide is of 20 kDa whereas a 57 kDa product has been reported to correspond to the glycosylated, unprocessed form of 453 amino acids [12,24,20]. Across all IVM groups in the present study the GDF9 pro-protein was found to be significantly associated with cleavage rate and blastocyst rate at 8 h of IVM but the mature GDF9 protein which represents the functional molecule was found to be significantly correlated with all oocyte development parameters at 16 h of IVM (Fig. 7). Disagreement of the of pro and mature GDF9 protein data observed at 16 h of IGF1 group was however, very peculiar (Fig. 6). Albeit, such non parallel appearance of pro and mature proteins has been observed in human follicular fluid recently possibly due to aberrant post-transcriptional processing of GDF9 pro proteins [21]. A species specific difference in post transcriptional processing of BMP15 transcripts has also been indicated [23]. Interestingly, the association dynamics of GDF9 mRNA, pro-protein and mature protein with development fate of oocytes displayed an apparent asynchrony in the time course of IVM (Fig. 7). It has been reported that at the time of resumption of meiosis in oocytes, active transcription ceases, however, translation of the mRNA pool continues throughout till the end of meiosis [57]. The most common mechanisms that regulate gene expression in oocytes at the posttranscriptional level are mRNA adenylation and deadenylation and effective action of mRNA binding factors at the CAP structure of mRNAs [45,44]. In mouse oocytes representative transcripts with tails of 150 adenine (A) residues have been indicated for immediate use, whereas the mRNA with shorter poly-A tails of 90 constitute the storage form of RNA to be inducted for translation only after further elongation of the poly-A tail [1]. Also, the gap junction communication between oocytes and cumulus cells undergo dynamic remodeling in a gonadotropin-dependent manner concurrent with the resumption of oocyte meiosis which contributes to the time lag between mRNA and protein appearance in maturing oocytes and explains observation of present study [46]. In conclusion the present study conclude that buffalo oocytes remain heavily dependent on GDF9 expression particularly during
Fig. 7. Pearson correlation coefficients of oocyte development rate parameters (MII, CEI, Cleavage and Blastocyst rates) with GDF9 mRNA, pro-protein and mature protein levels at different time points of oocyte maturation (8, 16 and 24 h) (a) significant at P < 0.01 (b) significant at P < 0.05.
early phase of oocyte maturation and suboptimum expression of this gene severely affected the development potential of oocytes. Further, appearance of mature GDF9 proteins in oocytes followed a time lag between transcription and translation of this gene possibly mediated by dynamic bi-directional communication events in maturing oocytes. The information generated will be helpful in understanding typicalities of buffalo oocyte biology and will contribute to further optimizing the IVF protocol for this species towards gaining increased success rate of ART procedures. Acknowledgments The authors are thankful for support of fund under NAIP/C4/ C1056 to the corresponding author and CSIR Jr. Research Fellowship to Tripti Jain. Help of Mr. Gian Singh, Computer Centre, NDRI, Karnal for analysis of data is thankfully acknowledged. References [1] R. Bachvarova, A maternal tail of poly(A): the long and short of it, Cell 69 (1992) 895–897. [2] A. Bettegowda, O.V. Patel, K.B. Lee, K.E. Park, M. Salem, J. Yao, J.J. Ireland, G.W. Smith, Identification of novel bovine cumulus cell molecular markers predictive of oocyte competence: functional and diagnostic implications, Biol. Reprod. 79 (2008) 301–309.
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484 [3] B.G. Brackett, G. Oliphant, Capacitation of rabbit spermatozoa in vitro, Biol. Reprod. 12 (1975) 260–274. [4] T.A. Brevini-Gandolfi, L.A. Favetta, L. Mauri, A.M. Luciano, F. Cillo, F. Gandolfi, Changes in poly(A) tail length of maternal transcripts during in vitro maturation of bovine oocytes and their relation with developmental competence, Mol. Reprod. Dev. 52 (1999) 427–433. [5] M.S. Chauhan, S.K. Singla, P. Palta, R.S. Manik, M.L. Madan, In vitro maturation and fertilization, and subsequent development of buffalo (Bubalus bubalis) embryos: effect of oocytes quality and type of serum, Reprod. Fert. Dev. 10 (1998) 173–177. [6] L. Chen, P.T. Russell, W.J. Larsen, Functional significance of cumulus expansion in the mouse: roles for the preovulatory synthesis of hyaluronic acid within the cumulus mass, Mol. Reprod. Dev. 34 (1993) 87–93. [7] J.L. Crawford, K.P. McNatty, The ratio of growth differentiation factor 9: bone morphogenetic protein 15 mRNA expression is tightly co-regulated and differs between species over a wide range of ovulation rates, Mol. Cell Endocrinol. 348 (2012) 339–343. [8] N. Crozet, Nucleolar structure and RNA synthesis in mammalian oocytes, J. Reprod. Fert. 38 (1989) 9–16. [9] P.A. De sousa, M.E. Westhusin, A.J. Watson, Analysis of variation in relative mRNA abundance for specific gene transcripts in single bovine oocytes and early embryos, Mol. Reprod. Dev. 49 (1998) 119–130. [10] R.A. Dragovic, L.J. Ritter, S.J. Schulz, F. Amato, J.G. Thompson, D.T. Armstrong, R.B. Gilchrist, Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion, Biol. Reprod. 76 (2007) 848–857. [11] M. Drost, Advanced reproductive technology in the water buffalo, Theriogenology 68 (2007) 450–453. [12] J.A. Elvin, A.T. Clark, P. Wang, N.M. Wolfman, M.M. Matzuk, Paracrine actions of growth differentiation factor-9 in the mammalian ovary, Mol. Endocrinol. 13 (1999) 1035–1048. [13] C.F. Fagbohun, S.M. Downs, Maturation of the mouse oocyte–cumulus cell complex: stimulation by lectins, Biol. Reprod. 42 (1990) 413–423. [14] T. Fair, P. Hyttel, T. Greve, M. Boland, Nucleus structure and transcriptional activity in relation to oocyte diameter in cattle, Mol. Reprod. Dev. 43 (1996) 503–512. [15] T. Fair, F. Carter, S. Park, A.C.O. Evans, P. Lonergan, Global gene expression analysis during bovine oocyte in vitro maturation, Theriogenology 68 (2007) 91–97. [16] C.E. Farin, K.F. Rodriguez, J.E. Alexander, J.E. Hockney, J.R. Herrick, S.K. Stoskopf, The role of transcription in EGF- and FSH-mediated oocyte maturation in vitro, Anim. Reprod. Sci. 98 (2007) 97–112. [17] C.A. Fox, M.D. Sheets, E. Wahle, Polyadenylation of maternal mRNA during oocyte maturation: poly(A) addition in vitro requires a regulated RNA binding activity and a poly(A) polymerase, EMBO J. 11 (1992) 5021–5032. [18] B. Gasparrini, L. Boccia, J. Marchandise, R.D. Palo, F. George, I. Donnay, L. Zicarelli, Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: effects of cysteine on glutathione synthesis and embryo development, Theriogenology 65 (2006) 275–287. [19] A. George, R. Sharma, K.P. Singh, S.K. Panda, S.K. Singla, P. Palta, RS. Manik, M.S. Chauhan, Production of cloned and transgenic embryos using buffalo (Bubalus bubalis) embryonic stem cell-like cells isolated from in vitro fertilized and cloned blastocysts, Cell. Reprogram. 13 (2011) 539–549. [20] R.B. Gilchrist, L.J. Ritter, M. Cranfield, L.A. Jeffery, F. Amato, S.J. Scott, S Myllymaa, N.K. Oja, H. Lankinen, D.G. Mottershead, N.P. Groome, O. Ritvos, Immunoneutralization of growth differentiation factor 9 reveals it partially accounts for mouse oocyte mitogenic activity, Biol. Reprod. 71 (2004) 732– 739. [21] F. Gode, B. Gulekli, E. Dogan, P. Korhan, S. Dogan, O. Bige, D. Cimrin, N. Atabey, Influence of follicular fluid GDF9 and BMP15 on embryo quality, Fert. Steril. 95 (2011) 2274–2278. [22] R.G. Gosden, Oogenesis as a foundation for embryogenesis, Mol. Cell Endocrinol. 186 (2002) 149–153. [23] O. Hashimoto, R.K. Moore, S. Shimasaki, Posttranslational processing of mouse and human BMP-15: potential implication in the determination of ovulation quota, Proc. Natl. Acad. Sci. USA 102 (2005) 5426–5431. [24] M. Hayashi, E.A. McGee, G. Min, C. Klein, U.M. Rose, M. van Duin, A.J. Hsueh, Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles, Endocrinology 140 (1999) 1236–1244. [25] T.S. Hussein, J.G. Thompson, R.B. Gilchrist, Oocytes secreted factors enhance oocyte developmental competence, Development 296 (2006) 514–521. [26] G.M. Jones, D.S. Cram, B. Song, M.C. Magli, L. Gianaroli, O.L. Kaplan, J.K. Findlay, G. Jenkin, A.O. Trounson, Gene expression profiling of human oocytes following in vivo or in vitro maturation, Hum. Reprod. 23 (2008) 1138–1144. [27] C.L. Keefer, S.L. Stice, D.L. Matihews, Bovine inner cell mass cells as donor nuclei in the production of nuclear transfer embryos and calves, Biol. Reprod. 50 (1994) 935–939. [28] G.M. Kidder, B.C. Vanderhyden, Bidirectional communication between oocytes and follicle cells: ensuring oocyte developmental competence, Can. J. Physiol. Pharmacol. 88 (2010) 399–413. [29] P.G. Knight, C. Glister, TGF-b superfamily members and ovarian follicle development, Reproduction 132 (2006) 191–206. [30] D. Kumar, P. Palta, R.S. Manik, S.K. Singla, M.S. Chauhan, Effect of culture media and serum supplementation on the development of in vitro fertilized burno embryos, Indian J. Anim. Sci. 77 (2007) 697–701.
483
[31] A.S. Lequarre, J.M. Traverso, J. Marchandise, I. Donnay, Poly(A) RNA is reduced by half during bovine oocyte maturation but increases when meiotic arrest is maintained with CDK inhibitors, Biol. Reprod. 71 (2004) 425–431. [32] H.K. Li, T.Y. Kuo, H.S. Yang, L.R. Chen, S.S. Li, H.W. Huang, Differential gene expression of bone morphogenetic protein 15 and growth differentiation factor 9 during in vitro maturation of porcine oocytes and early embryos, Anim. Reprod. Sci. 103 (2008) 312–322. [33] R. Lin, Maternal mRNA and the polyA tail in oocytes, Nat. Educ. 3 (2010) 47. [34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (2001) 402–408. [35] M.M. Matzuk, K.H. Burns, M.M. Vivieros, J.J. Eppig, Intercellular communication in the mammalian ovary: oocytes carry the conversation, Science 296 (2002) 2178–2180. [36] S.A. McGrath, A.F. Esquela, S.J. Lee, Oocyte-specific expression of growth/ differentiation factor-9, Mol. Endocrinol. 9 (1995) 131–136. [37] J.A. Merriman, D.G. Whittingham, J. Carroll, The effect of follicle stimulating hormone and epidermal growth factor on the developmental capacity of invitro matured mouse oocytes, Hum. Reprod. 13 (1998) 690–695. [38] S. Nandi, H.M. Raghu, B.M. Ravindranatha, M.S. Chauhan, Production of buffalo (Bubalus bubalis) embryos in vitro: premises and promises, Reprod. Domest. Anim. 37 (2002) 65–74. [39] P.K. Nicholls, C.A. Harrison, R.B. Gilchrist, P.G. Farnworth, P.G. Stanton, Growth differentiation factor 9 is a germ cell regulator of sertoli cell function, Endocrinology 150 (2009) 2481–2490. [40] M. Orisaka, S. Orisaka, J.Y. Jiang, J. Craig, Y. Wang, F. Kotsuji, B.K. Tsang, Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage, Mol. Endocrinol. 20 (2006) 2456–2468. [41] J.Y. Park, Y.Q. Su, M. Ariga, E. Law, S.L. Jin, M. Conti, EGF-like growth factors as mediators of LH action in the ovulatory follicle, Science 303 (2004) 682–684. [42] C.H. Pawshe, K.B. Rao, S.M. Totey, Effect of insulin-like growth factor I and its interaction with gonadotropins on in vitro maturation and embryonic development, cell proliferation, and biosynthetic activity of cumulus–oocyte complexes and granulosa cells in buffalo, Mol. Reprod. Dev. 49 (1998) 277– 285. [43] S. Pennetier, S. Uzbekova, C. Perreau, P. Papollier, P. Mermillod, R. Dalbies-Tran, Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15 and VASA in bovine adult tissues, oocytes and preimplantation embryos, Biol. Reprod. 71 (2004) 1359–1366. [44] F. Piccioni, V. Zappavigna, A. Verrotti, Translational regulation during oogenesis and early development, the cap-poly(A) tail relationship, C. R. Biol. 328 (2005) 863–881. [45] U.E. Ritter, M. Peschke, Expression in in-vivo and in-vitro growing and maturing oocytes: focus on regulation of expression at the translational level, Hum. Reprod. 8 (2002) 21–41. [46] M. Sasseville, M.C. Gagnon, C. Guillemette, R. Sullivan, R.B. Gilchrist, F.J. Richard, Regulation of gap junctions in porcine cumulus–oocyte complexes: contributions of granulosa cell contact, gonadotropins, and lipid rafts, Mol. Endocrinol. 23 (2009) 700–710. [47] M.A. Sirard, F. Richard, P. Blondin, C. Robert, Contribution of the oocyte to embryo quality, Theriogenology 65 (2006) 126–136. [48] L.C. Smith, Membrane and intracellular effects of ultraviolet irradiation with Hoechst 33342 on bovine secondary oocytes matured in vitro, J. Reprod. Fert. 99 (1993) 39–44. [49] T. Somfai, K. Imai, M. Kaneda, S. Akagi, S. Watanabe, S. Haraguchi, E. Mizutani, T.Q. Dang-Nguyen, Y. Inaba, M. Geshi, T. Nagai, The effect of ovary storage and in vitro maturation on mRNA levels in bovine oocytes; a possible impact of maternal ATP1A1 on blastocyst development in slaughterhouse-derived oocytes, J. Reprod. Dev. 57 (2011) 723–730. [50] J.L. Song, G.M. Wessel, How to make an egg: transcriptional regulation in oocytes, Differentiation 73 (2005) 1–17. [51] Y.Q. Su, K. Wigglesworth, F.L. Pendola, M.J. O’Brien, J.J. Eppig, Mitogenactivated protein kinase activity in cumulus cells is essential for gonadotropininduced oocyte meiotic resumption and cumulus expansion in the mouse, Endocrinology 143 (2002) 2221–2232. [52] Y.Q. Su, K. Sugiura, Y. Woo, K. Wigglesworth, S. Kamdar, J. Affurtit, J.J. Eppig, Selective degradation of transcripts during meiotic maturation of mouse oocytes, Dev. Biol. 302 (2007) 104–117. [53] H. Suzuki, B.S. Jeong, X. Yang, Dynamic changes of cumulus–oocyte cell communication during in vitro maturation of porcine oocytes, Biol. Reprod. 63 (2000) 723–729. [54] B.C. Vanderhyden, P.J. Caron, R. Buccione, J.J. Eppig, Developmental pattern of the secretion of cumulus expansion-enabling factor by mouse oocytes and the role of oocytes in promoting granulosa cell differentiation, Dev. Biol. 140 (1990) 307–317. [55] B.C. Vanderhyden, E.A. Macdonald, E. Nagyova, A. Dhawan, Evaluation of members of the TGF beta superfamily as candidates for the oocyte factors that control mouse cumulus expansion and steroidogenesis, Reprod. Suppl. 61 (2003) 55–70. [56] Q.T. Wang, K. Piotrowska, M.A. Ciemerych, L. Milenkovic, M.P. Scott, R.W. Davis, M. Zernicka-Goetz, A genome wide study of gene activity reveals developmental signaling pathways in the preimplantation mouse embryo, Dev. Cell 6 (2004) 133–144. [57] P.M. Wassarman, C. Liu, E.S. Litscher, Constructing the mammalian zona pellucida: some new pieces of an old puzzle, J. Cell Sci. 109 (1996) 2001–2004.
484
T. Jain et al. / General and Comparative Endocrinology 178 (2012) 477–484
[58] A.J. Watson, Oocyte cytoplasmic maturation: a key mediator of oocyte and embryo developmental competence, J. Anim. Sci. 85 (2007) E1–E3. [59] A.J. Watson, P. De Sousa, A. Caveney, L.C. Barcroft, D. Natale, J. Urquhart, M.E. Westhusin, Impact of bovine oocyte maturation media on oocyte transcript levels, blastocyst development, cell number, and apoptosis, Biol. Reprod. 62 (2000) 355–364.
[60] C.X. Yeo, R.B. Gilchrist, J.G. Thompson, M. Lane, Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice, Hum. Reprod. 23 (2008) 67– 73. [61] M. Yokoo, E. Sato, Cumulus–oocyte complex interactions during oocyte maturation, Int. Rev. Cytol. 91 (2004) 235–251.