Kinetics of gene expression and signaling in bovine cumulus cells throughout IVM in different mediums in relation to oocyte developmental competence, cumulus apoptosis and progesterone secretion

Available online at www.sciencedirect.com

Theriogenology 75 (2011) 90 –104 www.theriojournal.com

Kinetics of gene expression and signaling in bovine cumulus cells throughout IVM in different mediums in relation to oocyte developmental competence, cumulus apoptosis and progesterone secretion M. Salhaba, L. Toscaa, C. Cabaub, P. Papilliera, C. Perreaua, J. Duponta, P. Mermilloda, S. Uzbekovaa,* a

INRA, UMR85 Physiologie de la Reproduction et des Comportements, CNRS, UMR6175, Université de Tours; F-37380 Nouzilly, France b INRA, SIGENAE, UR83, Recherches Avicoles, F-37380, Nouzilly, France Received 31 May 2010; received in revised form 16 July 2010; accepted 18 July 2010

Abstract In vitro maturation of oocytes is a crucial step in assisted reproductive technologies in cattle; however, the molecular mechanisms of cumulus contribution to oocyte developmental potential require more investigation. Based on transcriptomic data, we studied by using real-time RT-PCR and western blot in bovine cumulus cells, the kinetics of expression of several candidate genes involved in oxidative stress response, apoptosis, steroid metabolism and signal transmission throughout IVM. Phosphorylations of the components of the main signaling pathways were also analyzed. In addition, IVM was performed in different maturation mediums which influenced the cumulus apoptosis, progesterone secretion and oocyte developmental competence. Glutathione-S-transferase A1 (GSTA1) transcript and protein abundance significantly decreased throughout IVM progression. Similarly, transcript levels of FSH receptor and aromatase (CYP19A1) and protein levels of three steroidogenic enzymes (steroidogenic acute regulatory protein, cytochrome P450scc and 3-beta-hydroxysteroid dehydrogenase) decreased along with progression of maturation and especially since 10 hours of IVM. Expression of progesterone receptor (PGR) and clusterin (CLU) mRNA and phosphorylations of protein kinases AKT, MAPK P38 and SMAD2 were particularly increased at 10 hours of IVM. This expression pattern supposed the role of these factors during oocyte metaphase-I check point of meiosis. Levels of CLU, GSTA1 and FSHR transcripts were higher in 199 basic hormone-free medium as compared to the medium 199EM, enriched in gonadotropins and growth factors, in which we recorded the higher developmental rate and progesterone secretion. Higher phosphorylation levels of SMAD2, AKT and MAP kinase JNK1, but not of MAP kinases ERK1/ERK2 or P38, was positively correlated with oocyte developmental competence and progesterone secretion and negatively correlated with cumulus apoptosis rate. These factors and signaling pathways in cumulus cells are potentially involved in controlling different stages of oocyte nuclear maturation and acquirement of its developmental potential. © 2011 Elsevier Inc. All rights reserved. Keywords: Cow; Oocyte maturation; Cumulus; GSTA1; Clusterin; SMAD2; MAP kinase

1. Introduction

* Corresponding author. Tel. : ⫹33 2 47 42 79 51; fax ⫹33 2 47 42 77 43. E-mail address: [email protected] (S. Uzbekova). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.07.014

For several decades, in vitro maturation (IVM) has become a routine application in assisted reproduction technologies in cattle, notably in vitro embryo produc-

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

tion (IVP). Although IVP technologies in this species have significantly progressed [1–3], the potential of bovine oocytes matured in vitro to develop to transferable embryos remains lower versus in vivo matured ones [4-7]. Once retrieved from the follicle, oocyte nuclear maturation occurs spontaneously without any additives in basic maturation medium and oocyte achieved metaphase-II stage [8]. In contrast, cytoplasm maturation, which mainly influences the oocyte developmental potential, depends on maturation environmental conditions [9]. Although the intrinsic quality of the oocytes remains the key factor determining their developmental potential during IVP [7], the improvement of IVM techniques allows the increase in embryo production [10,11] but still requires a better understanding of different aspects of oocyte maturation. One of them is the involvement of cumulus cells (CC), specialized granulosa cells surrounding the oocyte, in the acquisition of its developmental competence during IVM. Cumulus cells play important roles during oocyte growth, maturation, ovulation and fertilization and thus influence the oocyte quality [12,13]. Cumulus oophorus protects the oocytes from oxidative stress [14]. Both the oocyte and CC have their own enzymatic antioxidant systems which regulate, in part, reactive oxygen species (ROS) levels during IVM [15]. During maturation, the CC synthesised the active components of extracellular matrix under the control of endocrine- and oocyteproduced factors. Consequent extensive expansion of the cumulus is essential for ovulation, efficient passage of the oocyte through the oviduct, and for fertilization in vivo [12,16,17] and in vitro [18]. EGF and FSH have a proven beneficial effect on oocyte developmental competence during IVM [19-21] and act likely through CC, which expressed FSH receptor, FSHR [22]. During IVM, a small part of cumulus cells continue to proliferate (about 10% of CC in basic 199 medium [23]), while some CC spontaneously undergo apoptosis whatever maturation medium composition [24]. Oocyte-secreted factors, in particular the members of transforming growth factor beta (TGF-beta) superfamily, are involved in the maintenance the low incidence of cumulus cell apoptosis by establishing a localised gradient of bone morphogenetic proteins BMP15 and BMP6 [25]. The lower degree of apoptosis in cumulus cells was reported to correlate with oocyte developmental potential both in human and cattle [26,27]. During IVM, bovine COCs are able to produce and to secrete steroid hormones [28], and expression of genes related to steroidogenesis, like STAR (steroidogenic acute regulatory protein) and CYP11A1 (aro-

91

Fig. 1. Kinetics of oocyte maturation in relation to cumulus cells activities as function of oocyte nuclear maturation stages: steroids’ secretion, cumulus apoptosis rate, cumulus expansion and ROS concentration as determined by our experiences and/or bibliography analysis: estrogens [32]; progesterone [33]; apoptosis [24]; reactive oxygen species (ROS) in cumulus [15] and in oocyte [31]. Oocyte stages: GV: germinal vesicle; GVBD: germinal vesicle breakdown; Meta-I: metaphase-I; Meta-II: metaphase-II.

matase), was reported in cumulus [29]. Inhibition of endogenous steroids production during maturation drastically decreased the percentage of metaphase-II oocytes and completely abolished the cumulus expansion in bovine cumulus-oocyte complexes (COCs) after IVM [30]. As summarised in Figure 1, experimental data from our laboratory and other studies demonstrated progressive cumulus expansion and an increase in apoptotic rate of cumulus cells throughout in vitro maturation in basic medium supplemented with serum [24]. ROS level per cumulus cell diminished through IVM [15], and in oocytes it was minimal at 12 h of IVM [31]. Also, increase of progesterone and decrease of estradiol concentrations in maturation medium after germinal vesicle break down (GVBD) due to their secretion by COCs were observed [28,32,33]. The most significant changes in the kinetics of these processes occurred since 8 –10 h after the beginning of IVM, closely associated with the period of oocyte metaphase-I to metaphase-II transition and the most extensive cumulus expansion (10 –22 h). Steroid hormones regulate the expression of numerous genes in ovarian tissues via their receptors/transcription factors, such as progesterone receptor (PGR) and estrogen receptor, (ERS) (for review see [34]). In addition to transcriptional effects, steroid hormones rapidly activate cytoplasmic signaling cascades. A number of protein kinases expressed in the oocyte and in cumulus cells and are involved in the control of oocyte maturation in bovine via different signaling pathways. Among them, there are MAP kinases ERK1/ERK2 (alias MAPK3 and MAPK1) and Jun N-terminal kinases JNK1/2 [35], MAP kinase p38 (alias MAPK14) [36] and AKT (alias protein kinase B) [37]. The phosphatidylinositol 3-ki-

92

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

nase/AKT pathway and also JNK and p38 MAP kinases were reported to be involved in apoptosis in bovine granulosa cells [38]. From the other side, apoptosis of differentiated granulosa cells is promoted through a mechanism involving a component of the TGF-beta signaling pathway, SMAD2 (Mothers against decapentaplegic homolog 2) signaling [39]. The objective of present work was, first, to establish the expression profiles of a number of genes and signaling pathways in bovine cumulus throughout IVM. We therefore studied the expression pattern of genes related to apoptosis, oxidative stress response, steroid metabolism and signal transmission as well as phosphorylation pattern of several proteins involved in the signaling cascades. Second, to access the potential relationship of these factors with oocyte developmental competence, we analyzed their expression and phosphorylation in different maturation mediums which influenced cumulus apoptosis, progesterone secretion and oocyte developmental potential after in vitro maturation and fertilization. 2. Materials and methods 2.1. Ethics All procedures were approved by the Agricultural and Scientific Research Government Committees in accordance with the guidelines for Care and Use of Agricultural Animals in Agricultural Research and Teaching (approval A37801). 2.2. Materials All substances where the name of commercial supplier is not mentioned were purchased from Sigma (Saint Quentin Fallavier, France). 2.3. Samples collection 2.3.1. IVM of bovine cumulus-oocyte complexes Bovine ovaries were collected from a slaughterhouse. Cumulus-oocyte complexes (COCs) were aspirated from 3– 6 mm antral follicles. COCs with several layers of compact cumulus cells surrounding the oocyte were selected and washed several times in TCM199/ Hepes medium supplemented with 50 mg/L of Gentamycin and 0.1% of BSA. Groups of 50 COC were subjected to in vitro maturation (IVM) at 38.8 °C for 22 hours in a humidified atmosphere containing 5% CO2 in 500 ␮l of maturation medium. IVM of COCs, used for time course analysis of maturation and macroarray hybridization, was per-

formed in TCM199 medium supplemented with 10 ng/mL EGF and 10% of foetal bovine serum (199ES). COCs were sampled at four time-points of IVM, corresponding to the different stages of maturation progression: 3 h (oocytes are at germinal vesicle stage, compact cumulus), 6h (germinal vesicle breakdown, beginning of the expansion of cumulus cells), 10 h (metaphase-I, intensive expansion of CC) and 22 h (metaphase-II, highly expanded cumulus, rupture of gap-junctions). In experiments on different mediums comparison, medium used were the following: either TCM199 medium alone (199), or TCM199 medium supplemented with 10 ng/mL EGF (199EGF), or TCM199 medium supplemented with 10 ng/mL EGF and 10% of foetal bovine serum (199ES), or TCM199 enriched medium (199EM) containing EGF (10 ng/mL), IGF-1 (19 ng/ mL), FGF (2.2 ng/mL), hCG (5 IU/mL), PMSG (10 IU/mL), insulin (5 ␮g/mL), transferrin (5 ␮g/mL), selenium (5 ng/mL), L-cystein (90 ␮g/mL), beta-mercaptoethanol (0.1 mM), ascorbic acid (75 ␮g/mL), glycine (720 ␮g/mL), glutamine (0.1 mg/mL) and pyruvate (110 ␮g/mL) as described [40]. Experiments were repeated four times for each IVM condition. Meiotic status of oocytes at different times and in different IVM medium was established by chromatin labelling of ethanol-fixed denuded oocytes with Hoechst33342 (Sigma, 1 ␮g/mL diluted in 0.1% of sodium citrate) and observed using Axioplan Zeiss fluorescent microscope with excitation filter BP365/12 and emission filter LP 397. At least 50 oocytes were analyzed for each condition. 2.3.2. In vitro fertilization (IVF) and in vitro development (IVD) of bovine oocytes After 24 h of IVM, COCs were washed in fertilization medium (Tyrode medium with 25 mM Na-bicarbonate, 10 mM lactate, 1 mM pyruvate, 6 mg/mL fatty acid free BSA, 100 ␮g/mL heparin and 40 ␮g/mL gentamycin) and transferred into four-well dishes (50 COCs/250 ␮L fertilization medium/well). Motile spermatozoa, obtained by centrifugation of frozen/thawed semen on a discontinuous percoll (Pharmacia, Uppsala, Sweden) density gradient (45/90%), were diluted in fertilization medium (2.106 spermatozoa/mL). COCs and spermatozoa (250 ␮L of the previous suspension/ well) were incubated together for 18 h at 38.8 °C in a humidified atmosphere with 5% CO2 in 95% air. At the end of the fertilization period, presumptive zygotes were mechanically denuded and washed in modified synthetic oviduct fluid (mSOF) [41] with 5% FBS (MP Biomedicals, Illkirch, France). Then, they were cultured in a microdrop of mSOF with 5% FBS (25 em-

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

bryos/25 ␮L) under paraffin oil at 38.8 °C for 8 days in a water-saturated atmosphere of 5% CO2, 5% O2 and 90% N2. Embryonic cleavage (stage of 5 to 8 cells) and blastocyst rates were determined 48 h and 7 days after IVF of COCs, respectively. At least four IVF/IVD experiments were considered for each maturation conditions. 2.3.3. Cumulus cells collection Cumulus cells were mechanically separated from COCs immediately after collection by repetitive aspiration/expulsion movements using a micropipette in 100 ␮L drops of TCM199/Hepes culture medium. Oocytes were then removed from the drops containing the cumulus cells. Cells were washed in PBS, pelleted by centrifugation and then kept frozen at ⫺80 °C in Trizol Reagent (Invitrogen, Cergy Pontoise, France) until RNA extraction or in Laemmli buffer for western blot analysis. The following groups of CC were collected: immature groups from small follicles before IVM, 0 h; IVM groups after 3, 6, 10 and 22 h of IVM in 199EGF/ FBS; after 22 h of IVM in either 199 or 199EGF, or 199EM. Each group contained at least 10 COCs, each experiment were repeated at least 4 times. 2.4. Apoptotic cells detection DeadEnd™ Fluorometric TUNEL System kit was used according to manufacturer’s instructions (Promega, France). Briefly, pellets of detached cumulus cells were fixed in 4% paraformaldehyde in PBS for 20 min, washed twice with PBS and then incubated with terminal deoxynucleotidyl transferase at 37 °C for 1 h in the presence of fluorescein-12-dUTP. Cells were washed in PBS and pelleted by centrifugation 3 times, then put on slides in minimal volume of PBS, air dried, and mounted with Mowiol supplemented with 1 mg/mL of anti-fading DABCO and 1 ␮g/␮Lof Hoechst33342. All nuclei were visualized as blue fluorescence and apoptotic nuclei were observed as green fluorescence by using Axioplan Zeiss fluorescent microscope with appropriate filters (excitation BP 365/12 and BP450-490, emission LP397 and LP 520). At least 500 cumulus cells for each condition were analyzed. 2.5. RNA analysis 2.5.1. Total RNA preparation Total RNA was extracted from cumulus cells using TriZol reagent according to manufacturer’s instructions. Integrity and concentration and of each RNA sample was determined on an Agilent 2100 Bioanalyzer with 6000 Nano LabChip kits (Agilent Technologies,

93

Böbligen, Germany) and NanoDrop spectrophotometer (Nyxor Biotech, Paris, France). To avoid contamination with genomic DNA, all total RNA preparations were treated by RQ1 DNAse (Promega) 15 min at 37 °C as described in the manufacturer’s protocol. 2.5.2. Macroarray hybridisation Nylon non-commercial MEM cDNA macroarrays containing 1896 bovine cDNA clones from embryonic, mammary gland and muscle tissues [42] were hybridized with the P33-labelled probes generated from cumulus cells RNA and the signals of each spot were quantified and normalised as described [43]. Ratios of normalised signal intensities of immature (0 h) to IVM (6 h, 10 h, 22 h) were calculated for each spot, and correspondent cDNA clones where this ratio was more than two, were considered as potentially differentially expressed. Sequence analyses and cDNA clones identification were performed using software applications proposed by National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). 2.5.3. RT-PCR Two series of reverse transcription (RT) were performed, the first on 125 ng and the second on 200 ng of total RNA from cumulus cells treated by RQ1 DNAse. In totality, six independent samples of complementary DNA (cDNA) for each maturation condition were obtained. Complementary DNA (cDNA) was extended from oligo-(dT)15 primers (0.25 ␮g per reaction) for 1 h at 37 °C by mouse Moloney leukaemia virus reverse transcriptase (Invitrogen) as per manufacturer’s instructions. To validate the primers, PCR was performed using SYBR Green supermix (Bio-Rad, Marnes la Coquette, France) and specific primers (Table 1) from 1% of obtained cDNA as a template for each gene. PCR products were visualised by migration on 1.5% agarose gel. To confirm the specificity of amplified fragments, PCR products were cloned into pCRII vector using TA cloning Kit (Invitrogen) and sequenced. 2.5.4. Real-time RT-PCR Real-time PCR was performed on MyiQ Cycler apparatus (Bio-Rad). Reactions were performed in total volume of 20 ␮L using SYBR green Biorad supermix and 0.25 pM of specific primers in triplicates for each sample. To measure CYP19A1, PGR, FSHR, ERS2 and BAX mRNA abundance, equivalent of 5 ng of cDNA (converted RNA) per reaction was used; 50 pg, 500 pg, and 1000 pg of cDNA were used for quantification of CLU, SCD and STAR transcripts respectively. A threestep protocol (95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 20 sec) was repeated for 40 cycles, followed by

94

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

Table 1 Oligonucleotide primer sequences used for real-time RT-PCRs. Gene CLU BAX PGR STAR FSHR ESR2 CYP19A1 GSTA1 SCD RPL19

Primer

Sequence (5=–3=)

Accession number

Product size (bp)

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

TCTTCAACTCCTTCCCCATCACAG TCAGCAAACGCAGGCATTAGTG CATGGGCTGGACATTGGACTTC GGTGAGCGAGGCGGTGAG TCAGGCTGGCATGGTTCTTGG CTTAGGGCTTGGCTTTCGTTTGG ACACCATGTGGAATGTCAGGC CACACCTTTCAACAAGCAACCC ATCTTAAGAAGCTGCGGGCCAA TCAGGGGAGCAAGTCACATCAA GGAGGACAGTGAGAGCAAAGAGG GCCACAGGAAGGACCACATAGC TGACCCTAAGCCAAGAGCAACAAG ACTGCCAAACAGCAGGATGAGA AATGGACGTGGCAGAATGGAGT GGGCACAGTGGTAAATGCATGA TGAAAGAGAGGGGGCTTGAAGA ACCTTCTGAATCCCCCAGCAAT AATCGCCAATGCCAACTC CCCTTTCGCTTACCTATACC

NM_173902

307

NM_173894

150

XM_583951

125

NM_174189

262

NM_174061

328

Y18017

180

NM_174305

366

NM_177515

305

NM_173959

170

BC102223

156

CLU, clusterin; BAX, bcl2-associated X protein; PGR, progesterone receptor; STAR, steroidogenic acute regulatory protein; FSHR, follicle stimulating hormone receptor; ERS2, estrogen receptor 2-beta; CYP19A1, cytochrome P450, family 19, subfamily A, polypeptide 1 (aromatase); GSTA1, glutathione S-transferase alpha 1; RPL19, ribosomal protein L19; SCD, (Stearoyl-Coenzyme A Desaturase).

acquisition of the melt curve. The standard curve for each gene was deduced from serial dilutions of plasmids containing the correspondent cDNA fragment from 1 pg to 0, 0001 pg. Correlation coefficients and PCR efficiencies were more than 0, 99 and 92% respectively. The relative level of mRNA expression was calculated as following. The median value from technical triplicates for each sample was extrapolated from standard curves of PCR for each gene of interest. Then this value was divided by the correspondent median value of RPL19 (Ribosomal Protein L19), considered as the internal reference genes given their levels were unchanged during IVM in bovine cumulus cells. Relative mRNA expression levels for each treatment (ratio gene of interest/internal control gene) are presented as mean ⫾ SEM of at least four independent cumulus samples and have been subjected to one way Analysis of Variance (ANOVA) following by Fisher’s PLSD test when P ⬍ 0.05. 2.6. Protein analysis 2.6.1. Antibodies Mouse monoclonal GSTA1 and total JNK (clone D-2) antibodies, rabbit polyclonal JNK phosphorylated at Thr183/Tyr185 antibody, total ERK2 (MAPK1 or MAPK42, C14) and total p38 alpha (MAPK14, C20)

rabbit polyclonal antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibodies against phospho-ERK1/2 (MAPK3/ MAPK1 phosphorylated at Thr202/Tyr204 respectively), phospho-p38 (phospho-MAPK14) phosphorylated at Thr180/Tyr182, phospho-SMAD2 phosphorylated at Ser465/467 and total SMAD2, phospho-Ser473-AKT and total AKT were purchased from Cell Signaling (Danvers, MA). Rabbit polyclonal antibodies to CYP11A1, STAR and HSD3B were generously provided by Dr. Dale Buchanan Hales (University of Illinois, Chicago, USA) and Dr. Van Luu-The (CHUL Research Center and Laval University, Canada). All primary antibodies used were raised against highly homologous human antigens and therefore cross-reacted with corresponding bovine proteins. Mouse monoclonal antibody to vinculin (clone hVIN-1) was purchased from SigmaAldrich. Horseradish peroxidase (HRP) conjugated goat anti-rabbit antibodies were purchased from Cell Signaling Technology (Ozyme, Saint Quentin Yvelines, France); HRP-conjugated goat anti-mouse IgG was from Lab Vision (Fremont, CA). 2.6.2. Western immunoblotting Groups of a known number of COCs were lysed in Tris-saline-EGTA buffer (pH 7.5) supplemented with 2 mM sodium orthovanadate and 1 ␮L/mL of protease

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

inhibitor cocktail (Sigma); then freeze-thawed three times by rapid incubation in liquid nitrogen followed by immersion in a warm water bath at 30 °C. Before loading, concentrated reducing Laemmli buffer, containing 80 mM dithiothreitol at final concentration was added to all protein extracts and samples were boiled for 8 min and then centrifuged 5 min at 12000g. Proteins extracts (equivalent of 3–5 COCs per line) were resolved on gradient 8 –20% or 12% SDS-PAGE gels and transferred onto nitrocellulose membranes. Blots were blocked with 5% of milk powder in Tris-buffered saline/0.1% Tween 20 for 1 h at room temperature (RT) and probed with the various antibodies overnight at 4 °C. Dilutions were 1/1000 for all proteins except GSTA1 (1/400) and 1/2000 for vinculin primary antibodies. After washing, immunoreactivity was detected using the appropriate HRP-conjugated secondary antibodies (diluted 1/5000, incubated 1 h at RT) and revealed by Western Lightning Western Blot Chemiluminescence Reagent Plus kit (PerkinElmer, Courtaboeuf, France). Densitometry was performed by scanning the original radiographs and then by analysing the bands with Scion Image for Windows (Scion Corporation, Maryland, USA). At least three independent samples were analyzed for each experimental condition. The data are expressed as a ratio of signal intensities in arbitrary units of studied protein to vinculin, VINC (for GSTA1, HSD3B, STAR and CYP11A1) or as a ratio of phosphorylated isoforms to correspondent total proteins (for AKT, ERK1/2, JNK, P38 and SMAD2). Normalised data was subjected to one-way ANOVA/Fisher’s PLSD test. 2.6.3. Progesterone radioimmunoassay The concentration of progesterone secreted by groups of COCs was measured by a radioimmunoassay protocol [44] by using 50 ␮L of different spent maturation mediums sampled from individual wells after 22 hours of culturing, as described [43]. The total level of progesterone detected in each sample was divided by the number of COCs in the correspondent well. 2.7. Statistics All statistical analyses were performed using the software StatView for Windows (Abacus Concepts, Inc., USA) as described. ANOVA and Fisher’s PLSD test were applied. All results were considered statistically significant at P ⬍ 0.05.

95

3. Results 3.1. Gene expression profiles in cumulus cells during IVM We performed a set of macroarray hybridisations of cumulus cells RNA from COCs subjected to IVM at different time points [43]. Here, using these quantifications, we have compared the ratio of expression values in cumulus cells at 3, 10 and 22 hours of IVM relative to immature state. Fifteen genes showed more than two-fold increase at 10 h and then a decrease of expression, while thirteen genes progressively decreased during IVM (Table 2). Among the genes which were overexpressed at 10 h of IVM, we identified clusterin (CLU), known to be related to multiply cellular functions including apoptosis. Among the genes that progressively decreased their expression during IVM, we identified Glutathione S-transferase A1 (GSTA1), involved in oxidative stress response regulation. We then analyzed by real-time RT-PCR the kinetics of expression of these and other candidate genes involved in regulation of apoptosis, stress responses and steroidogenesis in cumulus cells at 0 h, 3 h, 6 h, 10 and 22 h of IVM in 199ES medium (Fig. 2). In concordance with macroarray analysis, relative mRNA abundance of GSTA1 decreased since 3 h and remained relatively stable up to 10 hours and than dropped being ten fold less at 22 h IVM as compared to immature state (P ⬍ 0.001). Similar variations were found for CYP19A1 (aromatase) and FSHR (FSH receptor) mRNA, except that FSHR level decreased more progressively between 3 h and 10 h. Expression pattern was also confirmed for CLU which expression increased progressively up to 10 h IVM and then decreased to immature level. PGR (progesterone receptor) varied similarly during IVM (more than ten-fold increase at 10 h in comparison with initial level in cumulus cells from immature COCs) and then mRNA level decreased but remained significantly higher than before IVM. The same profile was also observed for SCD transcript (Stearoyl-Coenzyme A desaturase). STAR (steroidogenic acute regulatory protein) transcript level significantly increased at 22 h IVM (P ⬍ 0.05), whereas no significant changes were found in ERS2 (estrogen receptor 2, data not shown) and BAX (Bcl2-associated X protein) mRNA expression throughout maturation. 3.2. Profiles of protein expression and phosphorylation in cumulus cells during IVM Relative abundance of three enzymes controlling the different stages of steroidogenesis–STAR (steroidogenic acute regulatory protein), CYP11A1 (Cytochrome P450 side-chain cleavage) and HSD3B (3-beta-hydroxysteroid

96

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

Table 2 List of genes differently expressed in bovine cumulus cells during in vitro maturation as detected by hybridisation of MEM macroarray at 0 h, 3 h, 10 h and 22 h of IVM. Relative expression as ratio to 0 h Over-expressed at 10 h IVM

Progressively decreased

GENES

3 h IVM

10 h IVM

22 h IVM

Clone accession

Gene symbol

Gene description

2.9 2.6 1.7 2.1 2.0 1.9 2.1 1.4 1.3 2.9 1.4 1.3 1.6 1.9 1.2 1 1.1 0.8 1.4 0.8 1 1.1 0.4 1.1 0.9 1.1 0.8 0.9

3.7 3.3 2.1 2.7 3.1 2.5 2.1 2.1 2.1 3.4 2.2 2.1 2.6 2.1 2.2 0.5 0.7 0.7 1.1 0.7 0.7 0.7 0.5 0.8 0.5 0.7 0.5 0.6

2.5 1.7 1.7 1.6 1.6 1.6 1.6 1.5 1.4 1.3 1.3 1.2 1.1 1.0 0.9 0.6 0.6 0.6 0.6 0.6 0.6 0.5 0.5 0.5 0.5 0.5 0.5 0.2

CR383034 Bt.12504 CR382572 Bt.12309 CR383227 CR451494 CR383559 CR383549 CR382714 Bt.3562 CR382970 CR382970 CR383126 CR382730 CR382754 CR451444 CR382861 CR455339 CR382885 CR451480 Bt.4439 CR382858 CR453141 CR383053 CR382726 CR382789 CR451361 Bt.227

CRABP2 CLU PROF1 HSPA8 LIM GDE1 RPS23 CON CSDE1 LDLR TPM1 NDUB9 NU1M PPIB KIF1C ERF1 H33 AP3B1 CX7A2 SMC3 PLA2G1B ENOA STXB6 RPS5 TPM1 CAPN10 PDIA3 GSTA1

Cellular retinoic acid-binding protein 2 Clusterin Profilin-1 Heat shock 70kDa protein 8 LIM domain binding 3 Glycerophosphodiester phosphodiesterase 1 Ribosomal protein S23 Connectin Cold shock domain containing E1 Low density lipoprotein receptor Tropomyosin alpha-1 chain NADH dehydrogenase 1B subcomplex subunit 9 NADH-ubiquinone oxidoreductase chain 1 Peptidyl-prolyl cis-trans isomerase B Kinesin-like protein KIF1C isoform 2 Eukaryotic peptide chain release factor subunit 1 Histone H3.3 Adapter-related protein complex 3 subunit beta-1 Cytochrome c oxidase polypeptide 7A2 Structural maintenance of chromosomes protein 3 Phospholipase A2, group IB Alpha-enolase Syntaxin-binding protein 6 Ribosomal protein S5 Tropomyosin alpha-1 chain Calcium-activated neutral proteinase 10) Protein disulfide-isomerase A3 precursor Glutathione S-transferase A1

dehydrogenase) diminished in CC during IVM in 199ES, as detected by western blot at different time points (0, 3 h, 6 h, 10 h, 22 h) and normalised to vinculin cellular content (Figure 3a). GSTA1 was detected as a 26 kDa protein, and its relative abundance also decreased in the same conditions (Figure 3b). To monitor the activation of signaling pathways in COCs during IVM, the phosphorylation of AKT, SMAD2, MAP kinases ERK1/2, P38 and JNK was analyzed. Relative levels of phospho-Ser473AKT (Fig. 3c) and phospho-Ser465/467SMAD2 (Fig. 3e) transiently increased at 10 h IVM, as compared to other timepoints. MAPK P38 also demonstrated the same phosphorylation pattern however significant increase was detected already at 6h IVM and this high level persisted at 10 h as compared to the stages before (0 h) and after (22 h) IVM culturing (Fig. 3d). Relative abundance of phosphorylated MAPK ERK1/2 at Thr202/Tyr204 Fig. 3f) and JNK1 at Thr183/Tyr185 (Fig. 3g) did not change significantly throughout IVM. For most of genes and proteins studied, expression

profiles in CCs after IVM were similar in 199ES as in 199EM (serum free enriched medium), except for phospho-AKT which level was higher after 22 h of IVM in 199EM as compared to immature state (P ⬍ 0.05, data not shown). 3.3. Effects of different maturation mediums 3.3.1. Effect on oocyte developmental potential after IVM/IVF To estimate an effect of different maturation conditions on COCs developmental potential in vitro, we first compared the cleavage and blastocyst rates of correspondent oocytes after IVM in four mediums, three of them were serum-free: 1) 199 medium alone (here 199); 2) ⫺ 199 medium supplemented with only 10 ng/mL EGF (here 199EGF); 3) 199 enriched medium containing 10 ng/mL EGF and the mix of gonadotrophins and growth factors (199EM); and 4) 199 medium supplemented with 10 ng/mL EGF and 10% of fetal bovine serum (199ES). Embryo in vitro development

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

97

Fig. 2. Real-time RT-PCR analysis of gene expression in bovine cumulus cells during IVM in 199ES. STAR: steroidogenic acute regulatory protein; PGR: progesteron receptor; CYP19A1: aromatase; ERS2: estrogen receptor 2-beta; FSHR: FSH receptor; BAX: Bcl2-associated X protein; CLU: clusterin; SCD: Stearoyl-coenzyme A desaturase); GSTA1: glutathione S-transferase A1. Relative levels of mRNA expression (normalised against ribosomal protein 19, RPL19) are presented as a mean ⫾ SEM of four independent samples, relative to point 0 hours of IVM, considered as 1. Different superscripts designated significant difference at P ⬍ 0.05.

was recorded as cleavage rate at day 2 and blastocyst rate at day 7 after IVF. Significantly lower rates of cleaved zygotes and blastocysts were observed when COCs matured in 199 alone (59.8 ⫾ 3.3% and 14.6 ⫾ 2.5%, respectively, P ⬍ 0.01), as compared with three other mediums (Table 3). These mediums, 199EGF, 199EM and 199ES, did not differed significantly in term of oocyte capacity to cleave and to form a blastocyst, although blastocyst rate was the highest (39.1 ⫾ 5.3%) in serum free enriched 199EM. The rate of apoptosis detected by the counting of TUNEL-positive cumulus cells was the highest in 199 medium, the supplementation with EGF decreased it in a half, and the lowest level of cumulus apoptosis was detected in 199EM and 199ES (Table 3). Since similar developmental rates were obtained for COCs matured in 199ES and in 199EM, and as the presence of serum was shown to down-regulate gene expression in bovine COCs [45], we further studied the effect of only serum-free mediums 199, 199EGF and 199EM on different aspects of COCs modifications during maturation.

3.3.2. Effect on progesterone secretion Progesterone secretion level per COC in spent mediums 22 h after IVM was significantly higher (P ⬍ 0.05) in 199EM as compared to only 199 (129.9 ⫾ 15.4 pg and 87.2. ⫾ 9.9 pg, respectively) but not to 199EGF which showed intermediate value between 199 and 199EM (120.7 ⫾ 10.1 pg). 3.3.3. Effect on kinetics of oocyte nuclear maturation In all three medium the most of oocytes overcame GVBD while similar percentage of oocytes remained immature after 22 h IVM (Figure 4a). When matured in 199, smaller number of oocytes achieved metaphase II but more oocytes remained in Meta-I as compared to 199EGF and to 199EM, P ⬍ 0.05 (Figure 4a). 3.3.4. Effect on genes’ expression, GSTA1 abundance and proteins’ phosphorylation By real-time RT-PCR we observed that BAX mRNA level in CC was significantly lower (P ⬍ 0.05) and CLU level was significantly higher (P ⬍ 0.01) in 199 as compared to 199EM (Figure 4b). Both BAX and CLU genes were expressed similarly in 199 and 199EGF. GSTA1 mRNA expression in CC didn’t differ significantly between three above mediums (Figure 3b).

98

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

Fig. 3. Detection of proteins by western blot in bovine COCs at different times during IVM in 199ES. (a) Relative to vinculin abundance of STAR (steroidogenic acute regulatory protein), CYP11A1 (cytochrome P450 cholesterol side chain cleavage), HSD3B (3 beta-hydroxysteroid dehydrogenase). (b) Relative to vinculin (VINC) abundance of GSTA1 (glutathione S-transferase A1). Phosphorylation of protein kinase AKT (c), MAP kinase P38 (d), SMAD2 (e), MAP kinases ERK1/2 (f) and JNK1 (g) is presented as a ratio of phosphorylated protein to total protein. Representative blot images are shown. Values are means ⫾ SEM of four samples. Different superscripts denoted significant difference at P ⬍ 0.05.

FSHR mRNA level was five fold higher in 199 as compared to 199EGF, and was extremely low in 199EM. Relative GSTA1 protein abundance (as measured by western blot and normalized to vinculin) in bovine COCs was higher in 199 as compared to 199EGF and 199EM mediums (Fig. 5). As shown by the quantification of phosphorylated isoforms, MAP kinases ERK1/2 and P38 were similarly activated whatever maturation medium. SMAD2 and JNK1 phosphorylation was significantly up-regulated in 199EM as compared with 199 alone (P ⬍ 0.05), and showed the intermediate expression levels in 199EGF. Phosphory-

lation of AKT was significantly higher in 199EM as compared to 199 and 199EGF at 22 of IVM (P ⬍ 0.01).

4. Discussion Here, by analysis of cumulus cells, we showed that in routinely used culture conditions, notably in the presence of EGF/serum or in enriched 199EM medium, the expression of several genes and proteins, involved in stress response, apoptosis, steroidogenesis and signaling, varied differently throughout IVM and might be

M. Salhab et al. / Theriogenology 75 (2011) 90 –104 Table 3 Cleavage and blastocyst rate after IVF and the percentage of apoptotic cells in cumulus of bovine COCs matured in different IVM mediums. IVM medium

Number of oocytes

Cleavage rate (%)

Blastocyst rate (%)

Cumulus apoptosis (%)

199 199EGF 199EM 199ES

555 594 552 496

59.8 ⫾ 3.3a 71.7 ⫾ 0.8b 76.1 ⫾ 2.8b 78.5 ⫾ 1.7b

14.6 ⫾ 2.5a 32.2 ⫾ 3.3b 39.1 ⫾ 5.3b 31.2 ⫾ 4.2b

37.2 ⫾ 2.8a 15.9 ⫾ 0.9b 10.0 ⫾ 0.9c 8.3 ⫾ 0.7c

199, TCM199 medium; 199EGF, TCM199 medium supplemented with 10 ng/mL EGF; 199EM, TCM199 enriched medium; 199ES, TCM199 medium supplemented with 10 ng/ml EGF and 10% of foetal bovine serum. Cleavage and blastocyst rates displayed as a proportion of total oocytes. Data presented as mean ⫾ SEM from four independent experiments for each situation. Different superscripts denoted significant difference at P ⬍ 0.05.

related to the key stages of correspondent oocyte maturation and cumulus cells metabolism. In three serum free IVM conditions (199, 199EGF and 199EM), the percentage of GVBD occurrence was similar independent of maturation medium. However, we showed that 199EM promoted the transition from Meta-I to Meta-II more effectively than 199 and 199EGF. This suggests that the lack of trophic factors in the medium had an effect mainly on the Meta-I to Meta-II transition. In bovine, the period of 10 –22 h of IVM, when oocyte transits Meta-I to Meta–II [46], corresponded to the most active progesterone secretion by the COCs [33], cumulus expansion and apoptosis occurrence. At 10 h of IVM, we demonstrated the transient increase in expression of CLU (clusterin) and PGR (progesterone receptor) transcripts and the peak of phosphorylation of SMAD2, AKT and MAPK P38 in cumulus, suggesting their particular involvement in the regulation of cumulus-oocyte interaction during this period. Effectively, most of bovine oocytes could not pass the Meta-I stage when PI3-kinase/AKT pathway was inhibited [37,47]; AKT inactivation affected polar body extrusion and microtubules organisation in mice [48]. Similarly, the use of the P38 inhibitor during IVM in porcine blocked the oocytes in Meta-I [49]. We showed that MAPK ERK1/2 constantly expressed in cumulus cells in bovine similarly to mice and porcine [50,51]. The presence of specific inhibitor U0126 during IVM in bovine decreased ERK1/2 phosphorylation in cumulus cells and arrested the oocytes in the pro-metaphase-I stage [33]. Moreover, the U0126treatment of mouse COCs led to decrease of progesterone but increased estradiol related genes Star and Cyp11a1 and the up-regulation of Cyp19a1 [52]. In our IVM kinetics experiments, decrease of CYP19A1 and

99

increase of STAR mRNA throughout IVM was observed, in accordance with previous studies [29]. Interestingly, steroidogenesis enzyme protein levels decreased significantly after 10 h IVM; at the same time, FSHR expression decreased. This reduction of cumulus sensitivity to gonadotrophins could probably explain in part the regression of STAR, CYP11A1 and HSD3B protein expression at the end of IVM culture. The period after 10 h of IVM is that of significant increase of progesterone level in IVM medium [33]. Also, progesterone could negatively influence on its own syn-

Fig. 4. In vitro maturation of bovine COCs in different maturation mediums. (a) Analysis of oocyte nuclear maturation stage after 22 h IVM in either 199, or 199 supplemented with EGF (199EGF) or 199 enriched medium (199EM). Oocyte stages: GV: germinal vesicle; GVBD: germinal vesicle breakdown; Meta-I: metaphase-I; Meta-II: metaphase-II. (b) Real-time RT-PCR analysis of BAX (Bcl2-associated X protein), CLU (clusterin), GSTA1 (glutathione S-transferase A1) and FSHR (FSH receptor) relative to RPL19 (ribosomal protein L19) expression in bovine cumulus cells in different mediums after 22 h of IVM. Data are means ⫾ SEM of five different samples for each condition. Different superscripts denoted significant difference at P ⬍ 0.05.

100

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

Fig. 5. Detection of glutathione S-transferase A1 (GSTA1) protein and phosphorylation of protein kinase AKT, SMAD2, MAP kinases P38, ERK1/2 and JNK in cumulus cells before and after 22 h IVM in either 199, or 199 supplemented with EGF (199EGF) or 199 enriched medium (199EM). Data are presented as a ratio GSTA1 to vinculin (VINC) and as a ratio of phosphorylated protein to total protein. Representative blot images are shown. Data are means ⫾ SEM of four samples. Different superscripts denoted significant difference at P ⬍ 0.05.

thesis, and its accumulation in CC at 10 IVM possibly promoted a decrease of these steroidogenic enzymes’ abundance by the post-transcriptional regulation. In addition, the factors secreted by oocyte could participate in the control of progesterone synthesis in cumulus cells as shown in bovine [53] and in porcine where the

expression of steroidogenesis-related genes and FSHR was affected in CC in the presence of the oocytes [54]. Reported here, the lower rate of cumulus cells apoptosis in 199EGF, 199EM and 199ES was associated with the best oocyte competence in term of fertilization and blastocyst rates as compared with 199 alone and

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

with progesterone secretion by correspondent COC during IVM. Levels of SMAD2, JNK and AKT phosphorylation after IVM seemed negatively correlated to apoptosis rate and positively to progesterone secretion. Therefore, it is possible that progesterone is involved in the inhibition of cumulus cells apoptosis through some of these pathways. Indeed, in bovine luteal cells, treatment with progesterone for 24 h decreased caspase-3 activity and the ratio of BAX/BCL2 transcripts while inhibition of CYP11A1 (cytochrome P450scc) increased caspase-3 activity and therefore the apoptosis in these cells [55]. In bovine granulosa cells, gonadotropins’ surge induced expression of PGR (progesterone receptor) and withdrawal from the cell cycle, and these events promote their resistance to apoptosis [56]. Shown here, the significant over-expression of PGR in bovine CC at 10 h of IVM coincided with the increase of CLU mRNA level that might indicate the establishment of anti-apoptotic actions during this period. In fact, in human cancer cells, clusterin inhibited apopoptosis by interfering with BAX pro-apoptotic activities [57]. Clusterin is a stress-activated secreted glycoprotein that is implicated in a variety of physiological processes, including cell– cell interaction, lipid transport, tissue remodelling and apoptosis. In rodents, clusterin protein and its mRNA are only expressed in granulosa cells of only atretic but not healthy follicles obtained from PMSG-treated rats [58]. Moreover, a dramatic increase in the levels of CLU expression was reported in granulosa cells in cultures without trophic support compared to cells cultured in serum-supplemented medium [58]. Similarly, in our experiments on COCs’ maturation in different mediums, the highest levels of CLU expression and apoptosis occurrence was observed in 199 and 199EGF as compared with 199EM supplemented with a mix of gonadotrophins and growth factors. Clusterin was considered as a novel heat-shock protein (HSP) with chaperone activity and therefore it is involved in protection of cell from the stress [59]. In fact, among 15 genes with similar to CLU expression pattern in CC during IVM revealed by our transcriptomic analysis, we identified two shock-induced proteins (HSPA8 and CSDE1) and three genes, GDE1, NDUB9, and NU1M, which are involved in oxidoreductase activity. In tumour cells, CLU enhanced TGF-betainduced transcriptional activity and increased the level of SMAD2/3 proteins [60] and it was shown to bind TGF-beta receptors [61]. In our experiments, SMAD2 phosphorylation was at the highest level at 10 h of IVM

101

similarly to CLU. Therefore, in cumulus CLU might act via TGF-beta signaling actors largely present in bovine follicular cells [62], notably SMAD2. In this study we analyzed here for the first time the expression of phosphorylated SMAD2, an activated form of a component of the TGF-beta signaling pathway in bovine cumulus cells during IVM. According to our findings, SMAD2 might be involved in the regulation of the final stages of oocyte meiotic maturation, notably Meta-I/II transition; and SMAD2 expression is dependent on gonadotropins and/or the growth factors in vitro. In mice, different phosphorylated SMAD proteins including SMAD2 were detected in granulosa cells of preantral follicle and in the cumulus cells surrounding the oocyte in antral follicles as well as in oocytes [63]. Inhibition of SMAD2/3 pathway by specific inhibitor SB-431542 during IVM in mice resulted in decreasing of cumulus expansion, sperm entry and foetal survival [64]. In addition, SMAD2/3-dependent pathway is involved in oocyte-induced expression of EGF-receptor in cumulus cells in mice [65], which indicates that ovarian follicular responses to LH and oocyte maturation might be regulated by SMAD2/3 pathway. Therefore, the fact that SMAD2 pathway is active in bovine COC raises questions regarding the role of TGF-beta superfamily members, notably via activin/SMAD2 signaling pathway, in promoting oocyte maturation and the role of oocyte-cumulus interaction during this process. Clusterin binds to a wide array of biological ligands, including immunoglobulins, complement components, lipids and others; one of them is glutathione-S-transferase [59]. Glutathione-S-transferases enzymes function in the detoxification of electrophilic compounds and products of oxidative stress, by conjugation with glutathione. In our experiments we found that mRNA and protein levels of GSTA1 significantly decreased during IVM. Class alpha glutathione-S-transferase enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. GSTA1 was shown to express in bovine steroidogenic organs: ovary, testis, FSH-treated granulosa cells and corpus luteum and possibly linked to steroidogenesis and is hormonally regulated by gonadotropins [66]. Recently GSTA1 was found to exhibit enzymatic activities towards non-steroid substrates but also it was as efficient as bovine HSD3B as a steroid isomerase [67]. In our study GSTA1 protein showed the same expression profile that STAR, CYP11A1 and HSD3B enzymes possibly implicating its involvement in

102

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

steroidogenesis in cumulus cells. Glutathione S-transferase A1 was detected by immunocytochemistry in follicular fluid of large antral follicles, and GSTA mRNA expression more than three fold decreased in bovine granulosa cells isolated from preovulatory follicles 12 h post-hCG injection as compared to those before treatment [66]. In our condition, GSTA1 protein expression decreased significantly at the end of IVM. This decrease was very significant in gonadotropins enriched medium 199EM as compared to 199, while transcript level didn’t differ. Therefore, GSTA1 might be more intensively secreted during IVM in 199EM medium and this could be regulated by gonadotropins. GSTA1 expression in bovine CC during IVM could also be linked to reactive oxygen species (ROS) released during steroid hormones synthesis and metabolism. Decrease of GSTA1 protein abundance correlated with diminished ROS concentration per cumulus cell during IVM [15]. The reduction of GSTA1 expression in CC at the end of IVM was concomitant with the reduction of estrogens concentration in IVM medium [32]. GSTA1 could be probably secreted to IVM medium for detoxification of the xenobiotics arising from the catabolism of estrogens. In conclusion, the expression patterns of several factors including GSTA1, CLU, PGR and FSHR and SMAD2 phosphorylation were for the first time studied in cumulus cells throughout in vitro maturation in relation to oocyte nuclear maturation and developmental competence, cumulus apoptosis rate and progesterone secretion. Products of PGR and CLU genes and activity of SMAD2, AKT and MAPK P38 in cumulus cells might be involved in the regulation of metaphase-I to metaphase-II transition in oocyte. GSTA1 expression was correlated with progesterone production by cumulus cells and it seemed to be regulated by gonadotropins. Phosphorylation of SMAD2, AKT and JNK1 but not of ERKs or P38 was positively correlated with progesterone secretion and negatively with apoptosis in cumulus cells. Therefore, these actors could be involved in the regulation of different stages of oocyte meiotic maturation through surrounding cumulus cells.

Acknowledgments We thank Florence Guignot and Aurore Thélie for their help in IVM and embryo production, Thierry Delpuech and Gael Ramé for technical assistance in slaughterhouse. We are very grateful to Dr. Hannah Brown for careful correction of English text. This work was a part of the program ANR-08-GENM-033

(OSCILE), sponsored by the grant of French National Research Agency.

References [1] Donnay I, Faerge I, Grondahl C, Verhaeghe B, Sayoud H, Ponderato N, Galli C, Lazzari G. Effect of prematuration, meiosis activating sterol and enriched maturation medium on the nuclear maturation and competence to development of calf oocytes. Theriogenology 2004;62:1093–107. [2] Nagai T. The improvement of in vitro maturation systems for bovine and porcine oocytes. Theriogenology 2001;55:1291– 301. [3] Sagirkaya H, Misirlioglu M, Kaya A, First NL, Parrish JJ, Memili E. Developmental potential of bovine oocytes cultured in different maturation and culture conditions. Anim Reprod Sci 2007;101:225– 40. [4] Leibfried-Rutledge ML, Critser ES, Eyestone WH, Northey DL, First NL. Development potential of bovine oocytes matured in vitro or in vivo. Biol Reprod 1987;36:376 – 83. [5] Hendriksen PJ, Vos PL, Steenweg WN, Bevers MM, Dieleman SJ. Bovine follicular development and its effect on the in vitro competence of oocytes. Theriogenology 2000;53:11–20. [6] Humblot P, Holm P, Lonergan P, Wrenzycki C, Lequarre AS, Joly CG, Herrmann D, Lopes A, Rizos D, Niemann H, Callesen H. Effect of stage of follicular growth during superovulation on developmental competence of bovine oocytes. Theriogenology 2005;63:1149 – 66. [7] Lonergan P, Fair T. In vitro-produced bovine embryos: dealing with the warts. Theriogenology 2008;69:17–22. [8] Sirard MA, Richard F, Mayes M. Controlling meiotic resumption in bovine oocytes: a review. Theriogenology 1998;49:483– 97. [9] Mermillod P, Oussaid B, Cognie Y. Aspects of follicular and oocyte maturation that affect the developmental potential of embryos. J Reprod Fertil Suppl 1999;54:449 – 60. [10] Sutton ML, Gilchrist RB, Thompson JG. Effects of in-vivo and in-vitro environments on the metabolism of the cumulus-oocyte complex and its influence on oocyte developmental capacity. Hum Reprod Update 2003;9:35– 48. [11] Gilchrist RB, Thompson JG. Oocyte maturation: emerging concepts and technologies to improve developmental potential in vitro. Theriogenology 2007;67:6 –15. [12] Tanghe S, Van Soom A, Nauwynck H, Coryn M, de Kruif A. Minireview: Functions of the cumulus oophorus during oocyte maturation, ovulation, and fertilization. Mol Reprod Dev 2002; 61:414 –24. [13] Van Soom A, Tanghe S, De Pauw I, Maes D, De Kruif A. Function of the cumulus oophorus before and during Mammalian fertilization. Reprod Domest Anim 2002;37:144 –51. [14] Tatemoto H, Sakurai N, Muto N. Protection of porcine oocytes against apoptotic cell death caused by oxidative stress during In vitro maturation: role of cumulus cells. Biol Reprod 2000;63: 805–10. [15] Cetica PD, Pintos LN, Dalvit GC, Beconi MT. Antioxidant enzyme activity and oxidative stress in bovine oocyte in vitro maturation. IUBMB Life 2001;51:57– 64. [16] Buccione R, Schroeder AC, Eppig JJ. Interactions between somatic cells and germ cells throughout mammalian oogenesis. Biol Reprod 1990;43:543–7.

M. Salhab et al. / Theriogenology 75 (2011) 90 –104 [17] Russell DL, Salustri A. Extracellular matrix of the cumulusoocyte complex. Semin Reprod Med 2006;24:217–27. [18] Furnus CC, de Matos DG, Moses DF. Cumulus expansion during in vitro maturation of bovine oocytes: relationship with intracellular glutathione level and its role on subsequent embryo development. Mol Reprod Dev 1998;51:76 – 83. [19] Harper KM, Brackett BG. Bovine blastocyst development after in vitro maturation in a defined medium with epidermal growth factor and low concentrations of gonadotropins. Biol Reprod 1993;48:409 –16. [20] Lonergan P, Carolan C, Van Langendonckt A, Donnay I, Khatir H, Mermillod P. Role of epidermal growth factor in bovine oocyte maturation and preimplantation embryo development in vitro. Biol Reprod 1996;54:1420 –9. [21] Sirard MA, Desrosier S, Assidi M. In vivo and in vitro effects of FSH on oocyte maturation and developmental competence. Theriogenology 2007;68 Suppl 1:S71– 6. [22] Nuttinck F, Charpigny G, Mermillod P, Loosfelt H, Meduri G, Freret S, Grimard B, Heyman Y. Expression of components of the insulin-like growth factor system and gonadotropin receptors in bovine cumulus-oocyte complexes during oocyte maturation. Domest Anim Endocrinol 2004;27:179 –95. [23] Kolle S, Stojkovic M, Boie G, Wolf E, Sinowatz F. Growth Hormone-Related Effects on Apoptosis, Mitosis, and Expression of Connexin 43 in Bovine In Vitro Maturation CumulusOocyte Complexes. Biol Reprod 2002;68:1584 –9. [24] Ikeda S, Imai H, Yamada M. Apoptosis in cumulus cells during in vitro maturation of bovine cumulus-enclosed oocytes. Reproduction 2003;125:369 –76. [25] Hussein TS, Froiland DA, Amato F, Thompson JG, Gilchrist RB. Oocytes prevent cumulus cell apoptosis by maintaining a morphogenic paracrine gradient of bone morphogenetic proteins. J Cell Sci 2005;118:5257– 68. [26] Lee KS, Joo BS, Na YJ, Yoon MS, Choi OH, Kim WW. Cumulus cells apoptosis as an indicator to predict the quality of oocytes and the outcome of IVF-ET. J Assist Reprod Genet 2001;18:490 – 8. [27] Yuan YQ, Van Soom A, Leroy JL, Dewulf J, Van Zeveren A, de Kruif A, Peelman LJ. Apoptosis in cumulus cells, but not in oocytes, may influence bovine embryonic developmental competence. Theriogenology 2005;63:2147– 63. [28] Mingoti GZ, Garcia JM, Rosa-e-Silva AA. Steroidogenesis in cumulus cells of bovine cumulus-oocyte-complexes matured in vitro with BSA and different concentrations of steroids. Anim Reprod Sci 2002;69:175– 86. [29] Nuttinck F, Marquant-Le Guienne B, Clement L, Reinaud P, Charpigny G, Grimard B. Expression of genes involved in prostaglandin E2 and progesterone production in bovine cumulus-oocyte complexes during in vitro maturation and fertilization. Reproduction 2008;135:593– 603. [30] Wang HF, Isobe N, Kumamoto K, Yamashiro H, Yamashita Y, Terada T. Studies of the role of steroid hormone in the regulation of oocyte maturation in cattle. Reprod Biol Endocrinol 2006;4:4. [31] Morado SA, Cetica PD, Beconi MT, Dalvit GC. Reactive oxygen species in bovine oocyte maturation in vitro. Reprod Fertil Dev 2009;21:608 –14. [32] Schoenfelder M, Schams D, Einspanier R. Steroidogenesis during in vitro maturation of bovine cumulus oocyte complexes and possible effects of tri-butyltin on granulosa cells. J Steroid Biochem Mol Biol 2003;84:291–300.

103

[33] Tosca L, Uzbekova S, Chabrolle C, Dupont J. Possible Role of 5=AMP-Activated Protein Kinase in the Metformin-Mediated Arrest of Bovine Oocytes at the Germinal Vesicle Stage During In Vitro Maturation. Biol Reprod 2007;77:452– 65. [34] Brosens JJ, Tullet J, Varshochi R, Lam EW. Steroid receptor action. Best Pract Res Clin Obstet Gynaecol 2004;18:265– 83. [35] Vigneron C, Perreau C, Dupont J, Uzbekova S, Prigent C, Mermillod P. Several signaling pathways are involved in the control of cattle oocyte maturation. Mol Reprod Dev 2004;69: 466 –74. [36] Uzbekova S, Salhab M, Perreau C, Mermillod P, Dupont J. Glycogen synthase kinase 3B in bovine oocytes and granulosa cells: possible involvement in meiosis during in vitro maturation. Reproduction 2009;138:235– 46. [37] Tomek W, Smiljakovic T. Activation of Akt (protein kinase B) stimulates metaphase I to metaphase II transition in bovine oocytes. Reproduction 2005;130:423–30. [38] Hu C-L, Cowan RG, Harman RM, Quirk SM. Cell Cycle Progression and Activation of Akt Kinase Are Required for InsulinLike Growth Factor I-Mediated Suppression of Apoptosis in Granulosa Cells. Mol Endocrinol 2004;18:326 –38. [39] Wang H, Tsang BK. Nodal signalling and apoptosis. Reproduction 2007;133:847–53. [40] Donnay I, Auquier P, Kaidi S, Carolan C, Lonergan P, Mermillod P, Massip A. Vitrification of in vitro produced bovine blastocysts: methodological studies and developmental capacity. Anim Reprod Sci 1998;52:93–104. [41] Holm P, Booth PJ, Schmidt MH, Greve T, Callesen H. High bovine blastocyst development in a static in vitro production system using SOFaa medium supplemented with sodium citrate and myo-inositol with or without serum-proteins. Theriogenology 1999;52:683–700. [42] Bernard C, Degrelle S, Ollier S, Campion E, Cassar-Malek I, Charpigny G, Dhorne-Pollet S, Hue I, Hocquette JF, Le Provost F, Leroux C, Piump F, Rolland G, Uzbekova S, Zalachas E, Martin P. A cDNA macro-array resource for gene expression profiling in ruminant tissues involved in reproduction and production (milk and beef) traits. J Physiol Pharmacol 2005;56 Suppl 3:215–24. [43] Salhab M, Papillier P, Perreau P, Guyader-Joly C, Dupont J, Mermillod P, Uzbekova S. Thymosins beta-4 and beta-10 are expressed in bovine ovarian follicles and upregulated in cumulus cells during meiotic maturation. Reprod Fertil Dev 2010 (in press, epub 19 May 2010). [44] Tosca L, Froment P, Solnais P, Ferre P, Foufelle F, Dupont J. Adenosine 5=-Monophosphate-Activated Protein Kinase Regulates Progesterone Secretion in Rat Granulosa Cells. Endocrinology 2005;146:4500 –13. [45] Calder MD, Caveney AN, Sirard MA, Watson AJ. Effect of serum and cumulus cell expansion on marker gene transcripts in bovine cumulus-oocyte complexes during maturation in vitro. Fertil Steril 2005;83 Suppl 1:1077– 85. [46] Sirard MA, Florman HM, Leibfried-Rutledge ML, Barnes FL, Sims ML, First NL. Timing of nuclear progression and protein synthesis necessary for meiotic maturation of bovine oocytes. Biol Reprod 1989;40:1257– 63. [47] Anas MK, Shimada M, Terada T. Possible role for phosphatidylinositol 3-kinase in regulating meiotic maturation of bovine oocytes in vitro. Theriogenology 1998;50:347–56. [48] Hoshino Y, Sato E. Protein kinase B (PKB/Akt) is required for the completion of meiosis in mouse oocytes. Dev Biol 2008; 314:215–23.

104

M. Salhab et al. / Theriogenology 75 (2011) 90 –104

[49] Villa-Diaz LG, Miyano T. Activation of p38 MAPK during porcine oocyte maturation. Biol Reprod 2004;71:691– 6. [50] Su YQ, Wigglesworth K, Pendola FL, O’Brien MJ, Eppig JJ. Mitogen-activated protein kinase activity in cumulus cells is essential for gonadotropin-induced oocyte meiotic resumption and cumulus expansion in the mouse. Endocrinology 2002;143: 2221–32. [51] Ebeling S, Schuon C, Meinecke B. Mitogen-activated protein kinase phosphorylation patterns in pig oocytes and cumulus cells during gonadotrophin-induced resumption of meiosis in vitro. Zygote 2007;15:139 – 47. [52] Su YQ, Nyegaard M, Overgaard MT, Qiao J, Giudice LC. Participation of mitogen-activated protein kinase in luteinizing hormone-induced differential regulation of steroidogenesis and steroidogenic gene expression in mural and cumulus granulosa cells of mouse preovulatory follicles. Biol Reprod 2006;75: 859 – 67. [53] Li R, Norman RJ, Armstrong DT, Gilchrist RB. Oocyte-secreted factor(s) determine functional differences between bovine mural granulosa cells and cumulus cells. Biol Reprod 2000;63:839 – 45. [54] Paradis F, Moore HS, Pasternak JA, Novak S, Dyck MK, Dixon WT, Foxcroft GR. Pig preovulatory oocytes modulate cumulus cell protein and gene expression in vitro. Mol Cell Endocrinol 2010;320:87–96. [55] Liszewska E, Rekawiecki R, Kotwica J. Effect of progesterone on the expression of bax and bcl-2 and on caspase activity in bovine luteal cells. Prostaglandins Other Lipid Mediat 2005;78: 67– 81. [56] Quirk SM, Cowan RG, Harman RM. Progesterone receptor and the cell cycle modulate apoptosis in granulosa cells. Endocrinology 2004;145:5033– 43. [57] Zhang H, Kim JK, Edwards CA, Xu Z, Taichman R, Wang CY. Clusterin inhibits apoptosis by interacting with activated Bax. Nat Cell Biol 2005;7:909 –15.

[58] Zwain I, Amato P. Clusterin protects granulosa cells from apoptotic cell death during follicular atresia. Exp Cell Res 2000; 257:101–10. [59] Wilson MR, Easterbrook-Smith SB. Clusterin is a secreted mammalian chaperone. Trends Biochem Sci 2000;25:95– 8. [60] Lee KB, Jeon JH, Choi I, Kwon OY, Yu K, You KH. Clusterin, a novel modulator of TGF-beta signaling, is involved in Smad2/3 stability. Biochem Biophys Res Commun 2008;366: 905–9. [61] Reddy KB, Karode MC, Harmony AK, Howe PH. Interaction of transforming growth factor beta receptors with apolipoprotein J/clusterin. Biochemistry 1996;35:309 –14. [62] Knight PG, Glister C. Local roles of TGF-beta superfamily members in the control of ovarian follicle development. Anim Reprod Sci 2003;78:165– 83. [63] Tian X, Halfhill AN, Diaz FJ. Localization of phosphorylated SMAD proteins in granulosa cells, oocytes and oviduct of female mice. Gene Expr Patterns 2010;10:105–12. [64] Yeo CX, Gilchrist RB, Lane M. Disruption of bidirectional oocyte-cumulus paracrine signaling during in vitro maturation reduces subsequent mouse oocyte developmental competence. Biol Reprod 2009;80:1072– 80. [65] Su YQ, Sugiura K, Li Q, Wigglesworth K, Matzuk MM, Eppig JJ. Mouse Oocytes Enable LH-Induced Maturation of the Cumulus-Oocyte Complex via Promoting EGF Receptor-Dependent Signaling. Mol Endocrinol 2010;24:1230 –9. [66] Rabahi F, Brule S, Sirois J, Beckers JF, Silversides DW, Lussier JG. High expression of bovine alpha glutathione S-transferase (GSTA1, GSTA2) subunits is mainly associated with steroidogenically active cells and regulated by gonadotropins in bovine ovarian follicles. Endocrinology 1999;140:3507–17. [67] Raffalli-Mathieu F, Persson D, Mannervik B. Differences between bovine and human steroid double-bond isomerase activities of Alpha-class glutathione transferases selectively expressed in steroidogenic tissues. Biochim Biophys Acta 2007; 1770:130 – 6.