- Email: [email protected]
Kinin B1 receptor blockade and ACE inhibition attenuate cardiac postinfarction remodeling and heart failure in rats
Toxicology and Applied Pharmacology 305 (2016) 153–160
Contents lists available at ScienceDirect
Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap
Kinin B1 receptor blockade and ACE inhibition attenuate cardiac postinfarction remodeling and heart failure in rats Xinchun Lin a, Christian Bernloehr b, Tobias Hildebrandt b, Florian J. Stadler c,⁎, Henri Doods b, Dongmei Wu a,d,⁎⁎ a
Department of Research, Mount Sinai Medical Center, Miami Beach, FL 33140, USA Boehringer Ingelheim Pharma GmbH & Co.KG, Biberach, Germany Shenzhen Engineering Laboratory for Advanced Technology of Ceramics, Shenzhen 518060, PR China d Department of BIN Convergence Technology, Chonbuk National University, South Korea b c
a r t i c l e
i n f o
Article history: Received 6 October 2015 Revised 18 May 2016 Accepted 6 June 2016 Available online 08 June 2016 Keywords: Hemodynamics Cardiac function Cardiac remodeling Kinin B1 receptor Angiotensin 1 converting enzyme
a b s t r a c t Introduction: The aim of the present study was to evaluate the effects of the novel kinin B1 receptor antagonist BI113823 on postinfarction cardiac remodeling and heart failure, and to determine whether B1 receptor blockade alters the cardiovascular effects of an angiotensin 1 converting enzyme (ACE) inhibitor in rats. Methods and results: Sprague Dawley rats were subjected to permanent occlusion of the left coronary artery. Cardiovascular function was determined at 6 weeks postinfarction. Treatment with either B1 receptor antagonist (BI113823) or an ACE inhibitor (lisinopril) alone or in combination significantly reduced the heart weight-tobody weight and lung weight-to-body weight ratios, and improved postinfarction cardiac function as evidenced by greater cardiac output, the maximum rate of left ventricular pressure rise (±dP/dtmax), left ventricle ejection fraction, fractional shorting, better wall motion, and attenuation of elevated left ventricular end diastolic pressure (LVEDP). Furthermore, all three treatment groups exhibited significant reduction in cardiac interstitial fibrosis, collagen deposition, CD68 positive macrophages, neutrophils, and proinflammatory cytokine production (TNFα and IL-1β), compared to vehicle controls. Conclusion: The present study shows that treatment with the novel kinin B1 receptor antagonist, BI113823, reduces postinfarction cardiac remodeling and heart failure, and does not influence the cardiovascular effects of the ACE inhibitor. © 2016 Elsevier Inc. All rights reserved.
1. Introduction Heart failure following myocardial infarction is linked with the development of cardiac remodeling, a process of geometric, morphologic, molecular, and functional changes that involve both infarcted and noninfarcted myocardium, resulting in chamber dilation and ventricular dysfunction (Yousef et al., 2000; Frangogiannis, 2014). Understanding the cellular pathways involved in the pathogenesis of post-infarction left ventricular dysfunction may be key to preventing progression to heart failure. Kinins are proinflammatory peptides that exert a broad spectrum of physiological and pathophysiological effects via the stimulation of bradykinin B1 and B2 receptors (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). The latter type are constitutively expressed and are believed to play an important role in mediating the beneficial effects of angiotensin 1 converting enzyme (ACE) inhibitors, which are used to treat cardiovascular diseases, but also affect the acute phases * Correspondence to: F.J. Stadler, Shenzhen University, China. ** Correspondence to: D. Wu, Chonbuk National University, Korea. E-mail addresses: [email protected] (F.J. Stadler), [email protected] (D. Wu).
http://dx.doi.org/10.1016/j.taap.2016.06.005 0041-008X/© 2016 Elsevier Inc. All rights reserved.
of inflammation and of somatic and visceral pain (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). Conversely, the B1 receptor is normally weakly expressed, but is upregulated in the presence of inflammation, tissue injury, or myocardial infarction (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). The functioning of the B2 receptors is thought to mediate most of the known cardiovascular beneficial effects of kinins, as well as the beneficial effects of angiotensin 1 converting enzyme (ACE) inhibitors (Golias et al., 2007; Leeb-Lundberg et al., 2005; Yin et al., 2007). The role of the B1 receptor in the heart, however, remains controversial (Yin et al., 2007; Xu et al., 2005; Lagneux et al., 2002a; Westermann et al., 2008, 2009). More recent studies have suggested that the function of the B1 receptors is opposed to that of the B2 receptors, and is therefore involved in the development of cardiac diseases (Yin et al., 2007; Lagneux et al., 2002a; Westermann et al., 2008, 2009). B1 receptor deletion in mice attenuates cardiac inflammation and fibrosis during the development of experimental diabetic cardiomyopathy (Westermann et al., 2009) and following doxorubicin-induced cardiomyopathy (Westermann et al., 2008). We recently reported that BI113823, an orally active small molecule kinin B1 receptor antagonist, exhibits a favorable cardiovascular profile (Wu et al., 2012; Murugesan et al., 2015). In a model of acute myocardial infarction (7 days) in rats, we showed that B1 receptor
154
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
inhibition with BI113823 improved cardiac function and did not influence the cardiovascular effects of AT1 receptor antagonist following MI (Wu et al., 2012). The present study was designed to further test the hypothesis that treatment with the B1 receptor antagonist BI113823 may attenuate cardiac remodeling and dysfunction following prolonged myocardial infarction. Furthermore, in addition to generate angiotensin II, ACE is also the main enzyme that destroys bradykinin (Hornig et al., 1997), and thus the beneficial cardio-protective effect of ACE inhibitors is mediated in part through kinin B2 receptors (Golias et al., 2007). ACE inhibitors are commonly used medications for chronic heart failure (Strauss and Hall, 2015; Raj et al., 2016). It is important to test kinin B1 receptor inhibitors in combination with ACE inhibitors to determine the efficacy as an “add-on” drug. Therefore, the potential effects of the B1 receptor antagonist on the cardio-protective and anti-remodeling effects of ACE inhibition were also examined.
ventricular pressure (LVP) and the maximum rate of left ventricular pressure rise (±dP/dtmax). At the end of the experiment, hearts and lungs from MI and shamoperated rats were collected and weighed. Left ventricles were cut from the apex to base into four transverse slices. Each of the three sections (left ventricle distal to the LAD ligation with infarcted areas) was scanned by a color image scanner and infarct size on the surface of each slice was determined by Photoshop program. The infarct area were traced manually on the digital images and automatically measured. In some sections, the infarcted and non-infarcted left ventricle areas were separated and snap-frozen until later analysis. One section of each left ventricle tissues was fixed in 10% formalin for histologic examination.
2. Methods
B1 receptor, ACE1, tumor necrosis factor (TNF)-α, matrix metalloproteinase (MMP)-2, B2 receptor and AT-1 receptor transcript levels were assessed by quantitative RT-PCR. Total RNA was extracted from both the non-infarcted and infarcted areas of the left ventricle. cDNA synthesis was performed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA) on 1 μg of RNA. For each RT-PCR reaction, 20 ng of cDNA was used in a QuantiFast Probe PCR kit (Qiagen, Hilden, Germany). The primers were targeted against rat B1 receptor (Bdkrb1, Rn02064589_s1), rat TNF-α (Rn01525859_g1), rat MMP-2 (Rn01538170_m1), rat B2 receptor (Bdkrb2) (Rn00597384_m1) (all from Applied Biosystems), rat ACE1 (Ace1_r_Forward Primer:ggttttcatgaggctattgga, Ace1_reverse Primer: ttagaaagttgatgtcatgctcgt), Ace Probe: (Roche Universal Probe Library probe #21, cat. no. 04686942001); and rat angiotensin II receptor, type 1a (Agtr1a; AT1) (forward: cacccgatcaccgatcac; reverse: cagccattttataccaatctctca; UPL probe set 53, cat. no. 04688503001, Roche, Basel, Switzerland). All data were normalized against GAPDH (Ss03375435_u1). Amplifications were performed in triplicate using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems).
2.1. Animals All animal studies were approved by the Institutional Animal Care and Use Committee of Mount Sinai Medical Center and complied with the Animal Welfare Act. Sprague Dawley rats weighing 275–325 g were used in all experiments. 2.2. Animal model and drug treatment Myocardial coronary artery ligation was performed in male Sprague Dawley rats (275–325 g) as previously described (Wu et al., 2012). Beginning 24 h after induction of myocardial ischemia (MI), animals received daily treatments of vehicle (0.1% natrosol), B1 receptor antagonist (BI113823, 30 mg/kg, b.i.d., p.o.), an ACE inhibitor (lisinopril, 10 mg/kg, b.i.d., p.o.), or both BI113823 and lisinopril. The experiment was terminated 6 weeks after coronary artery ligation.
2.5. Reverse-transcription polymerase chain reaction (RT-PCR)
2.3. Echocardiography
2.6. Interstitial fibrosis and collagen and cytokine contents in the heart
At 6 weeks after induction of MI, animals were anesthetized with ketamine (60 mg/kg, i.m.) plus xylazine (10 mg/kg, i.m.). Echocardiography (ECG) was performed with a Hewlett-Packard echocardiographic system SONOS 2000 with a 7.5/5.5 MHz transducer, as previously described (Wu et al., 2012). In each animal, a two-dimensional shortaxis view was taken at the mid-papillary muscle level to determine the left ventricular (LV) ejection fraction (EF). Linear dimensions were measured from two-dimensionally guided M-mode tracing, and fractional shortening (FS) measurements were obtained. An ECG tracing was recorded simultaneously with the echocardiogram. Wall motion score index (WMSI) was calculated as the sum of wall motion scores divided by the number of visualized segments. In this scoring system, higher scores indicate more severe wall motion abnormalities: 1 = normal, 2 = hypokinesis, 3 = akinesis, 4 = dyskinesis, 5 = aneurysm (Wu et al., 2012). All measurements were repeated three times, and the results represent the average of these measurements.
Left ventricular tissues were embedded in paraffin, and sections of 5μm thickness were cut and stained with Masson-Trichrome (American Master Tech Scientific, Inc. Lodi, CA, USA). Interstitial fibrosis was quantified in the non-infarcted region of left ventricles by using Image Pro Premier 9.1 software. The collagen content in the left ventricle was determined using a hydroxyproline assay kit (BioVision, Inc., Milpitas, CA, USA). Levels of tumor necrosis factor (TNF)-α (#438204, BioLegend, San Diego, CA, USA) and interleukin (IL)-1β (RLB00, R & D Systems, Minneapolis, MN, USA) in the left ventricle were determined using enzyme immunoassay kits.
2.4. Hemodynamic assessment and tissue harvest Animals were anesthetized with ketamine (60 mg/kg, i.m.) plus xylazine (10 mg/kg, i.m.). The left external jugular vein was cannulated for right atrial pressure measurement. A catheter (model SPR-838, Millar Instruments, Houston, TX, USA) was inserted into the right common carotid artery to quantify arterial blood pressure with a Powerlab data acquisition system (AD Instruments Inc., Colorado Springs, CO, USA). Heart rate was derived from the blood pressure signal. After the arterial blood pressure was measured, the catheter was introduced into the left ventricle through the right carotid artery to monitor left
2.7. Immunohistochemical imaging Immunohistochemical analysis for neutrophil elastase and CD68, in left ventricle sections (non-infarct region) were performed as previously described (Murugesan et al., 2015). Briefly, left ventricle sections were incubated with primary antibodies for neutrophil elastase (sc9518), and CD68 (sc-9139) antibodies (both from Santa Cruz Biotechnology, Santa Cruz, CA) overnight followed by a one hour incubation with FITC-labeled secondary antibody (sc-2012 or Sc-2777, Santa Cruz Biotechnology). In negative control sections, the primary or secondary antibody was replaced with phosphate buffered saline (PBS). Sections were counterstained with Ultra Cruz Mounting Medium with 4′,6diamidino-2-phenylindole (DAPI; sc-24941, Santa Cruz Biotechnology) and cover slipped. Fluorescent images were taken by a Nikon Eclipse TE2000-U fluorescence microscope (Nikon Corp., Tokyo, Japan) and a Nikon LWD 0.52 digital camera. Neutrophil elastase (NE) positive cells were quantified by randomly select 10 fields (× 20 magnification)
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
from each tissue slide and the number of NE-positive cells were calculated. Fluorescent intensity for CD68 was quantified using Image J software.
2.8. Statistical analysis All results are presented as means ± SEM. Data were analyzed using two-way analysis of variance (ANOVA) followed by post hoc intergroup comparisons using Student's t-tests with Bonferroni corrections. p values b 0.05 were considered statistically significant. 3. Results 3.1. Post-infarction heart hypertrophy and lung edema Thirty-three rats that survived 24 h of cardiac ischemia were randomly assigned to study groups; all but one (which was vehicle-treated) of these rats survived the entire experimental protocol. Eight sham-operated rats were included as a control group. At 6 weeks after MI, there was no significant difference in infarct size among the study groups (Fig. 2D). Heart hypertrophy and lung edema developed in the vehicle-treated animals at 6 weeks after MI, as evidenced by a significant increase in the heart weight-to-body weight ratios (HW/BW) and lung weight-to-body weight ratios (LW/BW), compared to sham control animals (Fig. 1). This increase was significantly attenuated in animals treated with BI113823 or lisinopril individually or in combination (p N 0.05) (Fig. 1). 3.2. Hemodynamic parameters and cardiac function Left ventricular function was impaired in vehicle-treated rats at 6 weeks after MI, as evidenced by a significant reduction in ejection fraction and fractional shorting, and impaired wall motion compared to sham control animals. All three treatment groups exhibited significant improvements in all three parameters, compared to vehicle controls (Fig. 2A, B, and C). Hemodynamic parameters are shown in Fig. 3. There was no significant change in heart rate in any of the study groups (data not shown). In vehicle-treated control animals, 6 weeks of MI resulted in a significant decrease in cardiac output, arterial blood pressure (BP), ± dP/ dtmax, and a significant elevation of left ventricle end-diastolic pressure (LVEDP). Arterial blood pressure was significantly improved in the BI113823-treated group, but not in animals that received lisinopril alone or in combination with BI113823. Cardiac output and ± dP/ dtmax were improved in all three treatment groups. Post-MI LVEDP elevation was also significantly attenuated in all three treatment groups compared to the vehicle control (Fig. 3).
155
3.3. Cardiac fibrosis Masson trichrome staining showed a marked increase of interstitial fibrosis in the left ventricle of vehicle-treated animals at 6 weeks of MI (Fig. 4A, B). Collagen content in the left ventricle was also significantly increased in vehicle-treated animals compared to sham control rats (Fig. 4C). The increase in interstitial fibrosis and collagen content (as per hydroxyproline assay) were significantly attenuated by treatment with BI113823 or lisinopril, administered individually or together (Fig. 4B and C). 3.4. Inflammatory mediators The production of TNF-α and IL-1β in the left ventricle were significantly reduced in all three treatment groups compared to vehicle controls (Fig. 5A and B). Furthermore, animals treated with BI113823 or lisinopril individually or in combination reduced CD68 positive macrophages (Fig. 5D, F) and neutrophils in left ventricles (non-infarct region), as evidenced by reductions in neutrophil elastase positive staining (Fig. 5C, E). 3.5. Cardiac mRNA expression Cardiac mRNA expression of B1, B2 and AT-1 receptor, ACE-1, and the inflammatory mediators TNF-α and MMP-2 were markedly increased in the left ventricles at 6 weeks following MI, and this upregulation was greater in infarcted regions (Fig. 6A–F). B1 receptor and ACE-1 mRNA upregulation were markedly reduced in animals treated with lisinopril alone, or with both BI113823 and lisinopril, but were not affected by treatment with BI113823 alone (Fig. 6A and B). TNF-α mRNA expression was significantly reduced in all three treatment groups (Fig. 6C). Treatment with lisinopril significantly reduced MMP-2 mRNA expression, while animals treated with BI113823, or both BI113823 and lisinopril, had reductions in MMP-2 mRNA expression of 21% and 34% (p N 0.05), respectively (Fig. 6D). Kinin B2 receptor expression was further increased by the treatment of BI113823, but was not affected by lisinopril or combination of BI113823 and lisinopril, compared to the vehicle group (Fig. 6E). AT-1 receptor expression was reduced in animals treated with lisinopril, but was not affected by treatment with BI113823 alone or in combination with lisinopril (Fig. 6F). 4. Discussion In the present study, we sought to define the effects of kinin B1 receptor blockade with BI113823 in prolonged myocardial infarction induced cardiac hypertrophy, fibrosis, and heart failure, and in comparison with a ACE inhibitor. We found that treatment with BI113823 is as efficient as ACE inhibition with lisinopril in attenuating post-infarction left ventricular remodeling and heart failure in rats, and that the effects of combination of both compounds are not additive. We also found that kinin B1 receptor blockade with BI113823 caused significant induction of B2
Fig. 1. Ratios of heart weight-to-body weight (HW/BW) and lung weight-to-body weight (LW/BW) at 6 weeks after myocardial infarction. Values are mean ± SEM, n = 7–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group. Control, sham-operated control rats without coronary occlusion; Vehicle, without any medication; BI1, treated with B1 receptor antagonist (BI113823); LIS, treated with ACE inhibitor (lisinopril); BI1 + LIS, treated with both BI113823 and lisinopril.
156
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
Fig. 2. Changes in left ventricular A): ejection fraction (EF), B): fractional shorting (FS), C): wall motion, and D): infarction size at 6 weeks following MI in rats. Values are mean ± SEM, n = 7–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
receptors. It is possible that selective kinin B1 receptor antagonist can block the B1 receptor-mediated pathological effects, but still retain the B2 receptor-mediated cardio-protective effects of the ACE inhibitor. Moreover, ACE inhibition with Lisinopril caused significant reductions the expressions of kinin B1 and AT-1 receptors and ACE-1. Therefore, the protective effects afforded by kinin B1 receptor blockade and ACE inhibition are mediated through divergent cellular pathways. 4.1. Cardiovascular performance Kinin production in the myocardium increases during cardiac ischemia, and this increase can continue for several weeks and perpetuate
further ischemic damage (Tschöpe et al., 2000). Bradykinin contributes to the regulation of vascular tone by initiating endothelium-dependent vasodilation resulting from nitric oxide and/or prostacyclin production via activation of B2 receptors (Golias et al., 2007; Leeb-Lundberg et al., 2005). In contrast, vascular function of B1 receptors is often opposed to that of the B2 receptors. Des-Arg9-BK (a B1 agonist) causes vasoconstriction in various vascular beds, including coronary and pulmonary arteries in the pig (More et al., 2014a, 2014b; Whitehurst et al., 1999). Studies have shown that bradykinin is cardioprotective via B2 receptor activation, which attenuates myocardial damage (Madeddu et al., 2000; Tanaka et al., 2004). In contrast, B1 receptor activation seems to have mostly detrimental effects on cardiac function (Lagneux et al., 2002a,
Fig. 3. Hemodynamic parameters at 6 weeks following MI in rats. Values are mean ± SEM, n = 6–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group. CI, cardiac index; BP, arterial blood pressure; ±dP/dtmax, first derivative of left ventricular pressure; LVEDP, left ventricle end-diastolic pressure.
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
157
Fig. 4. A–B): Masson trichrome staining for interstitial fibrosis in rat left ventricles at 6 weeks following MI. C): Collagen content in rat left ventricles as measured by hydroxyproline assay. Values are mean ± SEM, n = 6–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
2002b; Westermann et al., 2008, 2009; Wu et al., 2012; Murugesan et al., 2015). Using kinin B1 receptor knockout mice, previous studies have demonstrated that kinin B1 receptors are involved in the pathogenesis of cardiac dysfunction (Westermann et al., 2009). Kinin B1 receptor knockout mice showed an attenuation of diabetic cardiomyopathy with improved systolic and diastolic function in comparison with diabetic control mice (Westermann et al., 2009). Upregulation of B1 receptors occurs within hours and days after myocardial injury (Wu et al., 2012; Tschöpe et al., 2000). In the present study, mRNA for cardiac B1 receptors was still markedly upregulated 6 weeks following cardiac infarction. Prolonged myocardial infarction resulted in cardiac hypertrophy, contractile dysfunction, and heart failure. Treatment with BI113823 attenuated postinfarction cardiac hypertrophy and improved cardiac performance in rats. These findings confirm the detrimental effect of kinin B1 receptors on cardiac function. These results further suggest that kinin B1 receptors may contribute to the pathogenesis of heart failure. ACE inhibitors are effective in improving cardiac function in patients with myocardial infarction and heart failure (Hornig et al., 1997; Strauss and Hall, 2015). In the present study, treatment with lisinopril improved postinfarction cardiac function. No additive effect was observed in animals receiving the combination of BI113823 and lisinopril. 4.2. Inflammation and ventricular remodeling Ventricular remodeling after myocardial infarction is mediated by active processes of inflammation, fibrosis, and cardiomyocyte loss over the weeks and months following infarction (Frangogiannis, 2014;
Dorn, 2009; Nian et al., 2004). Myocardial infarction triggers an intense inflammatory response that is essential for cardiac repair, but which is also implicated in the pathogenesis of postinfarction remodeling and heart failure (Frangogiannis, 2014; Dorn, 2009; Nian et al., 2004). Activation of B1 receptors stimulates leukocyte activation and cytokine production, and also increases vascular permeability and tissue injury (Golias et al., 2007; Leeb-Lundberg et al., 2005). The expression of pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α is markedly and consistently increased in experimental models of myocardial infarction and in patients with heart failure (Herskowitz et al., 1995; Zhao and Zeng, 1997). A large number of reports have established the essential role of inflammatory cytokines in the progression of heart failure contributing to the processes of cardiac hypertrophy, fibrosis, and apoptosis (Yokoyama et al., 1993; Ceconi et al., 1998; Novoyatleva et al., 2014). B1 receptor deletion attenuates cardiac inflammation and fibrosis during experimental diabetic cardiomyopathy (Westermann et al., 2009). Pharmacological blockade of B1 receptor with BI113823 reduces inflammatory cell infiltration and cytokine production, and attenuates tissue remodeling in lung and heart (Murugesan et al., 2015). In the present study, treatment with BI113823 reduced cardiac inflammation as evidenced by reduction in tissue macrophage accumulation and proinflammatory cytokine production. It attenuated postinfarction cardiac fibrosis, cardiac hypertrophy and improved cardiac performance. These findings further support the hypothesis that B1 receptors may contribute to cardiac inflammation, remodeling, and cardiac dysfunction. ACE inhibitors improve prognosis in patients with post-myocardial infarction related cardiac dysfunction in part through decreasing cardiac inflammation and fibrosis (Strauss and Hall, 2015; Raj et al., 2016). In
158
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
this study, treatment with lisinopril alone or in combination with BI113823 equally reduced cardiac inflammation, remodeling and improved cardiac function following prolonged myocardial infarction. 4.3. B1 receptor inhibition and ACE inhibition Kinin B1 receptors are emerging therapeutic targets for chronic inflammation and pain (Doods et al., 2012). Patients with chronic inflammatory disorders are at increased cardiovascular risk (Charakida et al., 2011). ACE inhibitors are commonly used medications for myocardial
infarction and heart failure (Strauss and Hall, 2015; Raj et al., 2016). Moreover, the beneficial effects of ACE inhibitors are attributed to reduced angiotensin II generation and bradykinin degradation (Hornig et al., 1997; Erdös et al., 2010). ACE inhibitors enhance B2 and B1 receptor signaling and augment NO production. Greater B2 receptor signaling activates eNOS, yielding a short burst of NO; while activation of B1 receptor results in prolonged NO output by iNOS (Erdös et al., 2010; Kuhr et al., 2010). Kinin B1 receptor activation contributes to ANG II-induced aortic hypertrophy (Ceravolo et al., 2014). Studies have shown that the cardioprotective effects of ACE inhibitors are reduced by co-
Fig. 5. TNF-α (A) and IL-1β (B) content in rat left ventricles as measured by ELISA. (C, D) Representative staining of left ventricle sections (non-infarct region) for neutrophil elastase (N-E), and CD68 (magnification 20×). (E) Quantification of left ventricle neutrophil elastase positive staining, and (F) expression of CD68. Values are means ± SEM, n = 6. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
159
Fig. 5 (continued).
treatment with a B2 receptor antagonist (Stauss et al., 1994). It is not clear whether B1 receptor blockade affects the beneficial cardiovascular effects of ACE inhibitors after cardiac infarction. In the present study, treatment with BI113823 or lisinopril was equivalent in attenuating post-infarction cardiac remodeling and improving cardiac function. Combination treatment also attenuated the cardiac abnormalities without additive effect. B1 receptor blockade
neither reduced nor potentiated the cardiovascular effects of the ACE inhibitor after prolonged myocardial infarction. In this study, kinin B2 receptor expression was significantly increased by the treatment of B1 receptor antagonist BI113823, compared to vehicle controls or Lisinopril treatment. It is possible that the myocardial protection afforded by B1 receptor antagonism was in part due to increased B2 receptor activity. Furthermore, animals treated with lisinopril showed
Fig. 6. Endogenous expression of A): B1 receptor, B): ACE-1, C): TNF-α, D): MMP-2, E: B2 receptor, and F): AT-1 receptor mRNA in rat left ventricles at 6 weeks following MI. Sham control levels were set at 1, and all other values were normalized to the control group. Values are means ± SEM, n = 6. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group, †p b 0.05 vs. BI113823 group; ‡p b 0.05 vs. lisinopril group.
160
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
significant reduction in the expression of B1 and AT-1 receptors, and ACE-1. These findings suggest that the improvement afforded by kinin B1 receptor blockade or ACE-1 inhibition is mediated through divergent cellular pathways. It may also explain why no additive effect was observed with combined therapy. Because B1 receptors are only induced in the heart during inflammation and tissue injury, patients with chronic inflammatory and coronary diseases may still benefit from combined therapy of B1 receptor antagonist and ACE inhibitors. In summary, treatment with the orally active small molecule kinin B1 receptor antagonist BI113823 attenuated the progression of cardiac remodeling and dysfunction, and did not affect the cardiovascular effects of an ACE inhibitor. Our findings will contribute to a better understanding of disease progression involving kinin B1 receptors and heart failure. 4.4. Clinical implications Kinins are important inflammatory mediators (Golias et al., 2007; Leeb-Lundberg et al., 2005). Kinin production increases during inflammation and inflammatory cells are sources of tissue kallikrein (Lauredo et al., 2004). Kinins can mediate coronary smooth muscle contraction in inflammatory conditions (More et al., 2014a, 2014b). The expression of B1 receptors was significantly upregulated in human carotid atherosclerotic plaques compared to the control arteries (Guo et al., 2015). In the unstable plaques, the expression of B1 receptors was significantly higher compared to the stable plaques (Guo et al., 2015). Therefore, it is logical to presume that the local kinin production during inflammation can have pathological significance in coronary diseases. Small molecule orally active non-peptide B1 receptor antagonists are currently under development as novel anti-inflammatory agents (Doods et al., 2012). Our data suggest that B1 receptor antagonists may have a favorable cardiovascular profile under inflammatory conditions. Funding sources This work was supported by Boehringer Ingelheim Pharma GmbH & Co. KG, and in part by the Brain Korea 21 PLUS Project, NRF, and the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2012007331), Korea. Disclosures The authors declare that they have no conflicts of interest. Transparency document The Transparency document associated with this article can be found, in online version. References Ceconi, C., Curello, S., Bachetti, T., Corti, A., Ferrari, R., 1998. Tumor necrosis factor in congestive heart failure: a mechanism of disease for the new millennium? Prog. Cardiovasc. Dis. 41 (1 Suppl. 1), 25–30. Ceravolo, G.S., Montezano, A.C., Jordão, M.T., Akamine, E.H., Costa, T.J., Takano, A.P., Fernandes, D.C., Barreto-Chaves, M.L., Laurindo, F.R., Tostes, R.C., Fortes, Z.B., Chopard, R.P., Touyz, R.M., Carvalho, M.H., 2014. An interaction of renin-angiotensin and kallikrein-kinin systems contributes to vascular hypertrophy in angiotensin II-induced hypertension: in vivo and in vitro studies. PLoS One 9 (11), e111117. Charakida, M., O'Neil, F., Masi, S., Papageorgiou, N., Tousoulis, D., 2011. Inflammatory disorders and atherosclerosis: new therapeutic approaches. Curr. Pharm. Des. 17 (37), 4111–4120. Doods, H., Hauel, N., Kirsten, A., Kramer, G., Ceci, A., 2012. BI 113823, a novel B1 receptor antagonist exhibiting antinociceptive properties in inflammatory pain models. Pain Pract. 12, 18. Dorn II, G.W., 2009. Novel pharmacotherapies to abrogate postinfarction ventricular remodeling. Nat. Rev. Cardiol. 6 (4), 283–291. Erdös, E.G., Tan, F., Skidgel, R.A., 2010. Angiotensin I-converting enzyme inhibitors are allosteric enhancers of kinin B1 and B2 receptor function. Hypertension 55 (2), 214–220.
Frangogiannis, N.G., 2014. The inflammatory response in myocardial injury, repair, and remodelling. Nat. Rev. Cardiol. 11 (5), 255–265. Golias, C., Charalabopoulos, A., Stagikas, D., Charalabopoulos, K., Batistatou, A., 2007. The kinin system—bradykinin: biological effects and clinical implications. Multiple role of the kinin system—bradykinin. Hippokratia 11 (3), 124–128. Guo, Y., Liu, T., Li, X., Zhang, M., Shi, L., Liu, H., 2015. Expression of the genes encoding kinin receptors are increased in human carotid atherosclerotic plaques. Biomed. Rep. 3 (3), 398–402. Herskowitz, A., Choi, S., Ansari, A.A., Wesselingh, S., 1995. Cytokine mRNA expression in postischemic/reperfused myocardium. Am. J. Pathol. 146 (2), 419–428. Hornig, B., Kohler, C., Drexler, H., 1997. Role of bradykinin in mediating vascular effects of angiotensin-converting enzyme inhibitors in humans. Circulation 95 (5), 1115–1118. Kuhr, F., Lowry, J., Zhang, Y., Brovkovych, V., Skidgel, R.A., 2010. Differential regulation of inducible and endothelial nitric oxide synthase by kinin B1 and B2 receptors. Neuropeptides 44 (2), 145–154. Lagneux, C., Bader, M., Pesquero, J.B., Demenge, P., Ribuot, C., 2002a. Detrimental implication of B1 receptors in myocardial ischemia: evidence from pharmacological blockade and gene knockout mice. Int. Immunopharmacol. 2 (6), 815–822. Lagneux, C., Bader, M., Pesquero, J.B., Demenge, P., Ribuot, C., 2002b. Detrimental implication of B1 receptors in myocardial ischemia: evidence from pharmacological blockade and gene knockout mice. Int. Immunopharmacol. 2 (6), 815–822. Lauredo, I.T., Forteza, R.M., Botvinnikova, Y., Abraham, W.M., 2004. Leukocytic cell sources of airway tissue kallikrein. Am. J. Phys. Lung Cell. Mol. Phys. 286 (4), L734–L740. Leeb-Lundberg, L.M., Marceau, F., Muller-Esterl, W., Pettibone, D.J., Zuraw, B.L., 2005. International union of pharmacology. XLV. Classification of the kinin receptor family: from molecular mechanisms to pathophysiological consequences. Pharmacol. Rev. 57, 27–77. Madeddu, P., Emanueli, C., Maestri, R., Salis, M.B., Minasi, A., Capogrossi, M.C., Olivetti, G., 2000. Angiotensin II type 1 receptor blockade prevents cardiac remodeling in bradykinin B(2) receptor knockout mice. Hypertension 35 (1 Pt 2), 391–396. More, A.S., Kim, H.M., Khang, G., Hildebrandt, T., Bernlöhr, C., Doods, H., Vanhoutte, P.M., Wu, D., 2014a. Des-Arg9-bradykinin causes kinin B1 receptor mediated endotheliumindependent contractions in endotoxin-treated porcine coronary arteries. Pharmacol. Res. 90C, 18–24. More, A.S., Kim, H.M., Zhao, R., Khang, G., Hildebrandt, T., Bernlöhr, C., Doods, H., Lee, D., Lee, S.H., Vanhoutte, P.M., Wu, D., 2014b. COX-2 mediated induction of endothelium-independent contraction to bradykinin in endotoxin-treated porcine coronary artery. J. Cardiovasc. Pharmacol. 64 (3), 209–217. Murugesan, P., Hildebrandt, T., Bernlöhr, C., Lee, D., Khang, G., Doods, H., Wu, D., 2015. Inhibition of kinin B1 receptors attenuates pulmonary hypertension and vascular remodeling. Hypertension 66 (4), 906–912. Nian, M., Lee, P., Khaper, N., Liu, P., 2004. Inflammatory cytokines and postmyocardial infarction remodeling. Circ. Res. 94 (12), 1543–1553. Novoyatleva, T., Sajjad, A., Engel, F.B., 2014. TWEAK-Fn14 cytokine-receptor Axis: anew player of myocardial remodeling and cardiac failure. Front. Immunol. 5, 50. Raj, P., Aloud, B.M., Louis, X.L., Yu, L., Zieroth, S., Netticadan, T., 2016. Resveratrol is equipotent to perindopril in attenuating post-infarct cardiac remodeling and contractile dysfunction in rats. J. Nutr. Biochem. 28, 155–163. Stauss, H.M., Zhu, Y.C., Redlich, T., Adamiak, D., Mott, A., Kregel, K.C., Unger, T., 1994. Angiotensin-converting enzyme inhibition in infarct-induced heart failure in rats: bradykinin versus angiotensin II. J. Cardiovasc. Risk 1 (3), 255–262. Strauss, M.H., Hall, A.S., 2015. The divergent cardiovascular effects of angiotensin converting enzyme inhibitors and angiotensin receptor blockers on myocardial infarction and death. Prog. Cardiovasc. Dis. (pii: S0033-0620(15)30023-2). Tanaka, Y., Nagai, M., Date, T., Okada, T., Abe, Y., Seki, S., Taniguchi, M., Taniguchi, I., Mochizuki, S., 2004. Effects of bradykinin on cardiovascular remodeling in renovascular hypertensive rats. Hypertens. Res. 27 (11), 865–875. Tschöpe, C., Heringer-Walther, S., Walther, T., 2000. Regulation of the kinin receptors after induction of myocardial infarction: a mini-review. Braz. J. Med. Biol. Res. 33 (6), 701–708. Westermann, D., Lettau, O., Sobirey, M., Riad, A., Bader, M., Schultheiss, H.P., Tschöpe, C., 2008. Doxorubicin cardiomyopathy-induced inflammation and apoptosis are attenuated by gene deletion of the kinin B1 receptor. Biol. Chem. 389 (6), 713–718. Westermann, D., Walther, T., Savvatis, K., Escher, F., Sobirey, M., Riad, A., Bader, M., Schultheiss, H.P., Tschöpe, C., 2009. Gene deletion of the kinin receptor B1 attenuates cardiac inflammation and fibrosis during the development of experimental diabetic cardiomyopathy. Diabetes 58 (6), 1373–1381. Whitehurst, R.M., Laskey, R., Goldberg, R.N., Herbert, D., Van Breemen, C., 1999. Influence of group B streptococci on piglet pulmonary artery response to bradykinin. J. Appl. Physiol. 86 (1), 61–65. Wu, D., Lin, X., Bernloehr, C., Hildebrandt, T., Doods, H., 2012. Effects of a novel bradykinin B1 receptor antagonist and angiotensin II receptor blockade on experimental myocardial infarction in rats. PLoS One 7 (12), e51151. Xu, J., Carretero, O.A., Sun, Y., Shesely, E.G., Rhaleb, N.E., Liu, Y.H., Liao, T.D., Yang, J.J., Bader, M., Yang, X.P., 2005. Role of the B1 kinin receptor in the regulation of cardiac function and remodeling after myocardial infarction. Hypertension 45 (4), 747–753. Yin, H., Chao, J., Bader, M., Chao, L., 2007. Differential role of kinin B1 and B2 receptors in ischemia-induced apoptosis and ventricular remodeling. Peptides 28 (7), 1383–1389. Yokoyama, T., Vaca, L., Rossen, R.D., Durante, W., Hazarika, P., Mann, D.L., 1993. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J. Clin. Invest. 92 (5), 2303–2312. Yousef, Z.R., Redwood, S.R., Marber, M.S., 2000. Postinfarction left ventricular remodeling: a pathophysiological and therapeutic review. Cardiovasc. Drugs Ther. 14 (3), 243–252. Zhao, S.P., Zeng, L.H., 1997. Elevated plasma levels of tumor necrosis factor in chronic heart failure with cachexia. Int. J. Cardiol. 58 (3), 257–261.
Contents lists available at ScienceDirect
Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap
Kinin B1 receptor blockade and ACE inhibition attenuate cardiac postinfarction remodeling and heart failure in rats Xinchun Lin a, Christian Bernloehr b, Tobias Hildebrandt b, Florian J. Stadler c,⁎, Henri Doods b, Dongmei Wu a,d,⁎⁎ a
Department of Research, Mount Sinai Medical Center, Miami Beach, FL 33140, USA Boehringer Ingelheim Pharma GmbH & Co.KG, Biberach, Germany Shenzhen Engineering Laboratory for Advanced Technology of Ceramics, Shenzhen 518060, PR China d Department of BIN Convergence Technology, Chonbuk National University, South Korea b c
a r t i c l e
i n f o
Article history: Received 6 October 2015 Revised 18 May 2016 Accepted 6 June 2016 Available online 08 June 2016 Keywords: Hemodynamics Cardiac function Cardiac remodeling Kinin B1 receptor Angiotensin 1 converting enzyme
a b s t r a c t Introduction: The aim of the present study was to evaluate the effects of the novel kinin B1 receptor antagonist BI113823 on postinfarction cardiac remodeling and heart failure, and to determine whether B1 receptor blockade alters the cardiovascular effects of an angiotensin 1 converting enzyme (ACE) inhibitor in rats. Methods and results: Sprague Dawley rats were subjected to permanent occlusion of the left coronary artery. Cardiovascular function was determined at 6 weeks postinfarction. Treatment with either B1 receptor antagonist (BI113823) or an ACE inhibitor (lisinopril) alone or in combination significantly reduced the heart weight-tobody weight and lung weight-to-body weight ratios, and improved postinfarction cardiac function as evidenced by greater cardiac output, the maximum rate of left ventricular pressure rise (±dP/dtmax), left ventricle ejection fraction, fractional shorting, better wall motion, and attenuation of elevated left ventricular end diastolic pressure (LVEDP). Furthermore, all three treatment groups exhibited significant reduction in cardiac interstitial fibrosis, collagen deposition, CD68 positive macrophages, neutrophils, and proinflammatory cytokine production (TNFα and IL-1β), compared to vehicle controls. Conclusion: The present study shows that treatment with the novel kinin B1 receptor antagonist, BI113823, reduces postinfarction cardiac remodeling and heart failure, and does not influence the cardiovascular effects of the ACE inhibitor. © 2016 Elsevier Inc. All rights reserved.
1. Introduction Heart failure following myocardial infarction is linked with the development of cardiac remodeling, a process of geometric, morphologic, molecular, and functional changes that involve both infarcted and noninfarcted myocardium, resulting in chamber dilation and ventricular dysfunction (Yousef et al., 2000; Frangogiannis, 2014). Understanding the cellular pathways involved in the pathogenesis of post-infarction left ventricular dysfunction may be key to preventing progression to heart failure. Kinins are proinflammatory peptides that exert a broad spectrum of physiological and pathophysiological effects via the stimulation of bradykinin B1 and B2 receptors (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). The latter type are constitutively expressed and are believed to play an important role in mediating the beneficial effects of angiotensin 1 converting enzyme (ACE) inhibitors, which are used to treat cardiovascular diseases, but also affect the acute phases * Correspondence to: F.J. Stadler, Shenzhen University, China. ** Correspondence to: D. Wu, Chonbuk National University, Korea. E-mail addresses: [email protected] (F.J. Stadler), [email protected] (D. Wu).
http://dx.doi.org/10.1016/j.taap.2016.06.005 0041-008X/© 2016 Elsevier Inc. All rights reserved.
of inflammation and of somatic and visceral pain (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). Conversely, the B1 receptor is normally weakly expressed, but is upregulated in the presence of inflammation, tissue injury, or myocardial infarction (Golias et al., 2007; Leeb-Lundberg et al., 2005; More et al., 2014a). The functioning of the B2 receptors is thought to mediate most of the known cardiovascular beneficial effects of kinins, as well as the beneficial effects of angiotensin 1 converting enzyme (ACE) inhibitors (Golias et al., 2007; Leeb-Lundberg et al., 2005; Yin et al., 2007). The role of the B1 receptor in the heart, however, remains controversial (Yin et al., 2007; Xu et al., 2005; Lagneux et al., 2002a; Westermann et al., 2008, 2009). More recent studies have suggested that the function of the B1 receptors is opposed to that of the B2 receptors, and is therefore involved in the development of cardiac diseases (Yin et al., 2007; Lagneux et al., 2002a; Westermann et al., 2008, 2009). B1 receptor deletion in mice attenuates cardiac inflammation and fibrosis during the development of experimental diabetic cardiomyopathy (Westermann et al., 2009) and following doxorubicin-induced cardiomyopathy (Westermann et al., 2008). We recently reported that BI113823, an orally active small molecule kinin B1 receptor antagonist, exhibits a favorable cardiovascular profile (Wu et al., 2012; Murugesan et al., 2015). In a model of acute myocardial infarction (7 days) in rats, we showed that B1 receptor
154
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
inhibition with BI113823 improved cardiac function and did not influence the cardiovascular effects of AT1 receptor antagonist following MI (Wu et al., 2012). The present study was designed to further test the hypothesis that treatment with the B1 receptor antagonist BI113823 may attenuate cardiac remodeling and dysfunction following prolonged myocardial infarction. Furthermore, in addition to generate angiotensin II, ACE is also the main enzyme that destroys bradykinin (Hornig et al., 1997), and thus the beneficial cardio-protective effect of ACE inhibitors is mediated in part through kinin B2 receptors (Golias et al., 2007). ACE inhibitors are commonly used medications for chronic heart failure (Strauss and Hall, 2015; Raj et al., 2016). It is important to test kinin B1 receptor inhibitors in combination with ACE inhibitors to determine the efficacy as an “add-on” drug. Therefore, the potential effects of the B1 receptor antagonist on the cardio-protective and anti-remodeling effects of ACE inhibition were also examined.
ventricular pressure (LVP) and the maximum rate of left ventricular pressure rise (±dP/dtmax). At the end of the experiment, hearts and lungs from MI and shamoperated rats were collected and weighed. Left ventricles were cut from the apex to base into four transverse slices. Each of the three sections (left ventricle distal to the LAD ligation with infarcted areas) was scanned by a color image scanner and infarct size on the surface of each slice was determined by Photoshop program. The infarct area were traced manually on the digital images and automatically measured. In some sections, the infarcted and non-infarcted left ventricle areas were separated and snap-frozen until later analysis. One section of each left ventricle tissues was fixed in 10% formalin for histologic examination.
2. Methods
B1 receptor, ACE1, tumor necrosis factor (TNF)-α, matrix metalloproteinase (MMP)-2, B2 receptor and AT-1 receptor transcript levels were assessed by quantitative RT-PCR. Total RNA was extracted from both the non-infarcted and infarcted areas of the left ventricle. cDNA synthesis was performed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA) on 1 μg of RNA. For each RT-PCR reaction, 20 ng of cDNA was used in a QuantiFast Probe PCR kit (Qiagen, Hilden, Germany). The primers were targeted against rat B1 receptor (Bdkrb1, Rn02064589_s1), rat TNF-α (Rn01525859_g1), rat MMP-2 (Rn01538170_m1), rat B2 receptor (Bdkrb2) (Rn00597384_m1) (all from Applied Biosystems), rat ACE1 (Ace1_r_Forward Primer:ggttttcatgaggctattgga, Ace1_reverse Primer: ttagaaagttgatgtcatgctcgt), Ace Probe: (Roche Universal Probe Library probe #21, cat. no. 04686942001); and rat angiotensin II receptor, type 1a (Agtr1a; AT1) (forward: cacccgatcaccgatcac; reverse: cagccattttataccaatctctca; UPL probe set 53, cat. no. 04688503001, Roche, Basel, Switzerland). All data were normalized against GAPDH (Ss03375435_u1). Amplifications were performed in triplicate using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems).
2.1. Animals All animal studies were approved by the Institutional Animal Care and Use Committee of Mount Sinai Medical Center and complied with the Animal Welfare Act. Sprague Dawley rats weighing 275–325 g were used in all experiments. 2.2. Animal model and drug treatment Myocardial coronary artery ligation was performed in male Sprague Dawley rats (275–325 g) as previously described (Wu et al., 2012). Beginning 24 h after induction of myocardial ischemia (MI), animals received daily treatments of vehicle (0.1% natrosol), B1 receptor antagonist (BI113823, 30 mg/kg, b.i.d., p.o.), an ACE inhibitor (lisinopril, 10 mg/kg, b.i.d., p.o.), or both BI113823 and lisinopril. The experiment was terminated 6 weeks after coronary artery ligation.
2.5. Reverse-transcription polymerase chain reaction (RT-PCR)
2.3. Echocardiography
2.6. Interstitial fibrosis and collagen and cytokine contents in the heart
At 6 weeks after induction of MI, animals were anesthetized with ketamine (60 mg/kg, i.m.) plus xylazine (10 mg/kg, i.m.). Echocardiography (ECG) was performed with a Hewlett-Packard echocardiographic system SONOS 2000 with a 7.5/5.5 MHz transducer, as previously described (Wu et al., 2012). In each animal, a two-dimensional shortaxis view was taken at the mid-papillary muscle level to determine the left ventricular (LV) ejection fraction (EF). Linear dimensions were measured from two-dimensionally guided M-mode tracing, and fractional shortening (FS) measurements were obtained. An ECG tracing was recorded simultaneously with the echocardiogram. Wall motion score index (WMSI) was calculated as the sum of wall motion scores divided by the number of visualized segments. In this scoring system, higher scores indicate more severe wall motion abnormalities: 1 = normal, 2 = hypokinesis, 3 = akinesis, 4 = dyskinesis, 5 = aneurysm (Wu et al., 2012). All measurements were repeated three times, and the results represent the average of these measurements.
Left ventricular tissues were embedded in paraffin, and sections of 5μm thickness were cut and stained with Masson-Trichrome (American Master Tech Scientific, Inc. Lodi, CA, USA). Interstitial fibrosis was quantified in the non-infarcted region of left ventricles by using Image Pro Premier 9.1 software. The collagen content in the left ventricle was determined using a hydroxyproline assay kit (BioVision, Inc., Milpitas, CA, USA). Levels of tumor necrosis factor (TNF)-α (#438204, BioLegend, San Diego, CA, USA) and interleukin (IL)-1β (RLB00, R & D Systems, Minneapolis, MN, USA) in the left ventricle were determined using enzyme immunoassay kits.
2.4. Hemodynamic assessment and tissue harvest Animals were anesthetized with ketamine (60 mg/kg, i.m.) plus xylazine (10 mg/kg, i.m.). The left external jugular vein was cannulated for right atrial pressure measurement. A catheter (model SPR-838, Millar Instruments, Houston, TX, USA) was inserted into the right common carotid artery to quantify arterial blood pressure with a Powerlab data acquisition system (AD Instruments Inc., Colorado Springs, CO, USA). Heart rate was derived from the blood pressure signal. After the arterial blood pressure was measured, the catheter was introduced into the left ventricle through the right carotid artery to monitor left
2.7. Immunohistochemical imaging Immunohistochemical analysis for neutrophil elastase and CD68, in left ventricle sections (non-infarct region) were performed as previously described (Murugesan et al., 2015). Briefly, left ventricle sections were incubated with primary antibodies for neutrophil elastase (sc9518), and CD68 (sc-9139) antibodies (both from Santa Cruz Biotechnology, Santa Cruz, CA) overnight followed by a one hour incubation with FITC-labeled secondary antibody (sc-2012 or Sc-2777, Santa Cruz Biotechnology). In negative control sections, the primary or secondary antibody was replaced with phosphate buffered saline (PBS). Sections were counterstained with Ultra Cruz Mounting Medium with 4′,6diamidino-2-phenylindole (DAPI; sc-24941, Santa Cruz Biotechnology) and cover slipped. Fluorescent images were taken by a Nikon Eclipse TE2000-U fluorescence microscope (Nikon Corp., Tokyo, Japan) and a Nikon LWD 0.52 digital camera. Neutrophil elastase (NE) positive cells were quantified by randomly select 10 fields (× 20 magnification)
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
from each tissue slide and the number of NE-positive cells were calculated. Fluorescent intensity for CD68 was quantified using Image J software.
2.8. Statistical analysis All results are presented as means ± SEM. Data were analyzed using two-way analysis of variance (ANOVA) followed by post hoc intergroup comparisons using Student's t-tests with Bonferroni corrections. p values b 0.05 were considered statistically significant. 3. Results 3.1. Post-infarction heart hypertrophy and lung edema Thirty-three rats that survived 24 h of cardiac ischemia were randomly assigned to study groups; all but one (which was vehicle-treated) of these rats survived the entire experimental protocol. Eight sham-operated rats were included as a control group. At 6 weeks after MI, there was no significant difference in infarct size among the study groups (Fig. 2D). Heart hypertrophy and lung edema developed in the vehicle-treated animals at 6 weeks after MI, as evidenced by a significant increase in the heart weight-to-body weight ratios (HW/BW) and lung weight-to-body weight ratios (LW/BW), compared to sham control animals (Fig. 1). This increase was significantly attenuated in animals treated with BI113823 or lisinopril individually or in combination (p N 0.05) (Fig. 1). 3.2. Hemodynamic parameters and cardiac function Left ventricular function was impaired in vehicle-treated rats at 6 weeks after MI, as evidenced by a significant reduction in ejection fraction and fractional shorting, and impaired wall motion compared to sham control animals. All three treatment groups exhibited significant improvements in all three parameters, compared to vehicle controls (Fig. 2A, B, and C). Hemodynamic parameters are shown in Fig. 3. There was no significant change in heart rate in any of the study groups (data not shown). In vehicle-treated control animals, 6 weeks of MI resulted in a significant decrease in cardiac output, arterial blood pressure (BP), ± dP/ dtmax, and a significant elevation of left ventricle end-diastolic pressure (LVEDP). Arterial blood pressure was significantly improved in the BI113823-treated group, but not in animals that received lisinopril alone or in combination with BI113823. Cardiac output and ± dP/ dtmax were improved in all three treatment groups. Post-MI LVEDP elevation was also significantly attenuated in all three treatment groups compared to the vehicle control (Fig. 3).
155
3.3. Cardiac fibrosis Masson trichrome staining showed a marked increase of interstitial fibrosis in the left ventricle of vehicle-treated animals at 6 weeks of MI (Fig. 4A, B). Collagen content in the left ventricle was also significantly increased in vehicle-treated animals compared to sham control rats (Fig. 4C). The increase in interstitial fibrosis and collagen content (as per hydroxyproline assay) were significantly attenuated by treatment with BI113823 or lisinopril, administered individually or together (Fig. 4B and C). 3.4. Inflammatory mediators The production of TNF-α and IL-1β in the left ventricle were significantly reduced in all three treatment groups compared to vehicle controls (Fig. 5A and B). Furthermore, animals treated with BI113823 or lisinopril individually or in combination reduced CD68 positive macrophages (Fig. 5D, F) and neutrophils in left ventricles (non-infarct region), as evidenced by reductions in neutrophil elastase positive staining (Fig. 5C, E). 3.5. Cardiac mRNA expression Cardiac mRNA expression of B1, B2 and AT-1 receptor, ACE-1, and the inflammatory mediators TNF-α and MMP-2 were markedly increased in the left ventricles at 6 weeks following MI, and this upregulation was greater in infarcted regions (Fig. 6A–F). B1 receptor and ACE-1 mRNA upregulation were markedly reduced in animals treated with lisinopril alone, or with both BI113823 and lisinopril, but were not affected by treatment with BI113823 alone (Fig. 6A and B). TNF-α mRNA expression was significantly reduced in all three treatment groups (Fig. 6C). Treatment with lisinopril significantly reduced MMP-2 mRNA expression, while animals treated with BI113823, or both BI113823 and lisinopril, had reductions in MMP-2 mRNA expression of 21% and 34% (p N 0.05), respectively (Fig. 6D). Kinin B2 receptor expression was further increased by the treatment of BI113823, but was not affected by lisinopril or combination of BI113823 and lisinopril, compared to the vehicle group (Fig. 6E). AT-1 receptor expression was reduced in animals treated with lisinopril, but was not affected by treatment with BI113823 alone or in combination with lisinopril (Fig. 6F). 4. Discussion In the present study, we sought to define the effects of kinin B1 receptor blockade with BI113823 in prolonged myocardial infarction induced cardiac hypertrophy, fibrosis, and heart failure, and in comparison with a ACE inhibitor. We found that treatment with BI113823 is as efficient as ACE inhibition with lisinopril in attenuating post-infarction left ventricular remodeling and heart failure in rats, and that the effects of combination of both compounds are not additive. We also found that kinin B1 receptor blockade with BI113823 caused significant induction of B2
Fig. 1. Ratios of heart weight-to-body weight (HW/BW) and lung weight-to-body weight (LW/BW) at 6 weeks after myocardial infarction. Values are mean ± SEM, n = 7–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group. Control, sham-operated control rats without coronary occlusion; Vehicle, without any medication; BI1, treated with B1 receptor antagonist (BI113823); LIS, treated with ACE inhibitor (lisinopril); BI1 + LIS, treated with both BI113823 and lisinopril.
156
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
Fig. 2. Changes in left ventricular A): ejection fraction (EF), B): fractional shorting (FS), C): wall motion, and D): infarction size at 6 weeks following MI in rats. Values are mean ± SEM, n = 7–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
receptors. It is possible that selective kinin B1 receptor antagonist can block the B1 receptor-mediated pathological effects, but still retain the B2 receptor-mediated cardio-protective effects of the ACE inhibitor. Moreover, ACE inhibition with Lisinopril caused significant reductions the expressions of kinin B1 and AT-1 receptors and ACE-1. Therefore, the protective effects afforded by kinin B1 receptor blockade and ACE inhibition are mediated through divergent cellular pathways. 4.1. Cardiovascular performance Kinin production in the myocardium increases during cardiac ischemia, and this increase can continue for several weeks and perpetuate
further ischemic damage (Tschöpe et al., 2000). Bradykinin contributes to the regulation of vascular tone by initiating endothelium-dependent vasodilation resulting from nitric oxide and/or prostacyclin production via activation of B2 receptors (Golias et al., 2007; Leeb-Lundberg et al., 2005). In contrast, vascular function of B1 receptors is often opposed to that of the B2 receptors. Des-Arg9-BK (a B1 agonist) causes vasoconstriction in various vascular beds, including coronary and pulmonary arteries in the pig (More et al., 2014a, 2014b; Whitehurst et al., 1999). Studies have shown that bradykinin is cardioprotective via B2 receptor activation, which attenuates myocardial damage (Madeddu et al., 2000; Tanaka et al., 2004). In contrast, B1 receptor activation seems to have mostly detrimental effects on cardiac function (Lagneux et al., 2002a,
Fig. 3. Hemodynamic parameters at 6 weeks following MI in rats. Values are mean ± SEM, n = 6–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group. CI, cardiac index; BP, arterial blood pressure; ±dP/dtmax, first derivative of left ventricular pressure; LVEDP, left ventricle end-diastolic pressure.
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
157
Fig. 4. A–B): Masson trichrome staining for interstitial fibrosis in rat left ventricles at 6 weeks following MI. C): Collagen content in rat left ventricles as measured by hydroxyproline assay. Values are mean ± SEM, n = 6–8. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
2002b; Westermann et al., 2008, 2009; Wu et al., 2012; Murugesan et al., 2015). Using kinin B1 receptor knockout mice, previous studies have demonstrated that kinin B1 receptors are involved in the pathogenesis of cardiac dysfunction (Westermann et al., 2009). Kinin B1 receptor knockout mice showed an attenuation of diabetic cardiomyopathy with improved systolic and diastolic function in comparison with diabetic control mice (Westermann et al., 2009). Upregulation of B1 receptors occurs within hours and days after myocardial injury (Wu et al., 2012; Tschöpe et al., 2000). In the present study, mRNA for cardiac B1 receptors was still markedly upregulated 6 weeks following cardiac infarction. Prolonged myocardial infarction resulted in cardiac hypertrophy, contractile dysfunction, and heart failure. Treatment with BI113823 attenuated postinfarction cardiac hypertrophy and improved cardiac performance in rats. These findings confirm the detrimental effect of kinin B1 receptors on cardiac function. These results further suggest that kinin B1 receptors may contribute to the pathogenesis of heart failure. ACE inhibitors are effective in improving cardiac function in patients with myocardial infarction and heart failure (Hornig et al., 1997; Strauss and Hall, 2015). In the present study, treatment with lisinopril improved postinfarction cardiac function. No additive effect was observed in animals receiving the combination of BI113823 and lisinopril. 4.2. Inflammation and ventricular remodeling Ventricular remodeling after myocardial infarction is mediated by active processes of inflammation, fibrosis, and cardiomyocyte loss over the weeks and months following infarction (Frangogiannis, 2014;
Dorn, 2009; Nian et al., 2004). Myocardial infarction triggers an intense inflammatory response that is essential for cardiac repair, but which is also implicated in the pathogenesis of postinfarction remodeling and heart failure (Frangogiannis, 2014; Dorn, 2009; Nian et al., 2004). Activation of B1 receptors stimulates leukocyte activation and cytokine production, and also increases vascular permeability and tissue injury (Golias et al., 2007; Leeb-Lundberg et al., 2005). The expression of pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α is markedly and consistently increased in experimental models of myocardial infarction and in patients with heart failure (Herskowitz et al., 1995; Zhao and Zeng, 1997). A large number of reports have established the essential role of inflammatory cytokines in the progression of heart failure contributing to the processes of cardiac hypertrophy, fibrosis, and apoptosis (Yokoyama et al., 1993; Ceconi et al., 1998; Novoyatleva et al., 2014). B1 receptor deletion attenuates cardiac inflammation and fibrosis during experimental diabetic cardiomyopathy (Westermann et al., 2009). Pharmacological blockade of B1 receptor with BI113823 reduces inflammatory cell infiltration and cytokine production, and attenuates tissue remodeling in lung and heart (Murugesan et al., 2015). In the present study, treatment with BI113823 reduced cardiac inflammation as evidenced by reduction in tissue macrophage accumulation and proinflammatory cytokine production. It attenuated postinfarction cardiac fibrosis, cardiac hypertrophy and improved cardiac performance. These findings further support the hypothesis that B1 receptors may contribute to cardiac inflammation, remodeling, and cardiac dysfunction. ACE inhibitors improve prognosis in patients with post-myocardial infarction related cardiac dysfunction in part through decreasing cardiac inflammation and fibrosis (Strauss and Hall, 2015; Raj et al., 2016). In
158
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
this study, treatment with lisinopril alone or in combination with BI113823 equally reduced cardiac inflammation, remodeling and improved cardiac function following prolonged myocardial infarction. 4.3. B1 receptor inhibition and ACE inhibition Kinin B1 receptors are emerging therapeutic targets for chronic inflammation and pain (Doods et al., 2012). Patients with chronic inflammatory disorders are at increased cardiovascular risk (Charakida et al., 2011). ACE inhibitors are commonly used medications for myocardial
infarction and heart failure (Strauss and Hall, 2015; Raj et al., 2016). Moreover, the beneficial effects of ACE inhibitors are attributed to reduced angiotensin II generation and bradykinin degradation (Hornig et al., 1997; Erdös et al., 2010). ACE inhibitors enhance B2 and B1 receptor signaling and augment NO production. Greater B2 receptor signaling activates eNOS, yielding a short burst of NO; while activation of B1 receptor results in prolonged NO output by iNOS (Erdös et al., 2010; Kuhr et al., 2010). Kinin B1 receptor activation contributes to ANG II-induced aortic hypertrophy (Ceravolo et al., 2014). Studies have shown that the cardioprotective effects of ACE inhibitors are reduced by co-
Fig. 5. TNF-α (A) and IL-1β (B) content in rat left ventricles as measured by ELISA. (C, D) Representative staining of left ventricle sections (non-infarct region) for neutrophil elastase (N-E), and CD68 (magnification 20×). (E) Quantification of left ventricle neutrophil elastase positive staining, and (F) expression of CD68. Values are means ± SEM, n = 6. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group.
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
159
Fig. 5 (continued).
treatment with a B2 receptor antagonist (Stauss et al., 1994). It is not clear whether B1 receptor blockade affects the beneficial cardiovascular effects of ACE inhibitors after cardiac infarction. In the present study, treatment with BI113823 or lisinopril was equivalent in attenuating post-infarction cardiac remodeling and improving cardiac function. Combination treatment also attenuated the cardiac abnormalities without additive effect. B1 receptor blockade
neither reduced nor potentiated the cardiovascular effects of the ACE inhibitor after prolonged myocardial infarction. In this study, kinin B2 receptor expression was significantly increased by the treatment of B1 receptor antagonist BI113823, compared to vehicle controls or Lisinopril treatment. It is possible that the myocardial protection afforded by B1 receptor antagonism was in part due to increased B2 receptor activity. Furthermore, animals treated with lisinopril showed
Fig. 6. Endogenous expression of A): B1 receptor, B): ACE-1, C): TNF-α, D): MMP-2, E: B2 receptor, and F): AT-1 receptor mRNA in rat left ventricles at 6 weeks following MI. Sham control levels were set at 1, and all other values were normalized to the control group. Values are means ± SEM, n = 6. #p b 0.05 vs. control; *p b 0.05 vs. vehicle group, †p b 0.05 vs. BI113823 group; ‡p b 0.05 vs. lisinopril group.
160
X. Lin et al. / Toxicology and Applied Pharmacology 305 (2016) 153–160
significant reduction in the expression of B1 and AT-1 receptors, and ACE-1. These findings suggest that the improvement afforded by kinin B1 receptor blockade or ACE-1 inhibition is mediated through divergent cellular pathways. It may also explain why no additive effect was observed with combined therapy. Because B1 receptors are only induced in the heart during inflammation and tissue injury, patients with chronic inflammatory and coronary diseases may still benefit from combined therapy of B1 receptor antagonist and ACE inhibitors. In summary, treatment with the orally active small molecule kinin B1 receptor antagonist BI113823 attenuated the progression of cardiac remodeling and dysfunction, and did not affect the cardiovascular effects of an ACE inhibitor. Our findings will contribute to a better understanding of disease progression involving kinin B1 receptors and heart failure. 4.4. Clinical implications Kinins are important inflammatory mediators (Golias et al., 2007; Leeb-Lundberg et al., 2005). Kinin production increases during inflammation and inflammatory cells are sources of tissue kallikrein (Lauredo et al., 2004). Kinins can mediate coronary smooth muscle contraction in inflammatory conditions (More et al., 2014a, 2014b). The expression of B1 receptors was significantly upregulated in human carotid atherosclerotic plaques compared to the control arteries (Guo et al., 2015). In the unstable plaques, the expression of B1 receptors was significantly higher compared to the stable plaques (Guo et al., 2015). Therefore, it is logical to presume that the local kinin production during inflammation can have pathological significance in coronary diseases. Small molecule orally active non-peptide B1 receptor antagonists are currently under development as novel anti-inflammatory agents (Doods et al., 2012). Our data suggest that B1 receptor antagonists may have a favorable cardiovascular profile under inflammatory conditions. Funding sources This work was supported by Boehringer Ingelheim Pharma GmbH & Co. KG, and in part by the Brain Korea 21 PLUS Project, NRF, and the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2012007331), Korea. Disclosures The authors declare that they have no conflicts of interest. Transparency document The Transparency document associated with this article can be found, in online version. References Ceconi, C., Curello, S., Bachetti, T., Corti, A., Ferrari, R., 1998. Tumor necrosis factor in congestive heart failure: a mechanism of disease for the new millennium? Prog. Cardiovasc. Dis. 41 (1 Suppl. 1), 25–30. Ceravolo, G.S., Montezano, A.C., Jordão, M.T., Akamine, E.H., Costa, T.J., Takano, A.P., Fernandes, D.C., Barreto-Chaves, M.L., Laurindo, F.R., Tostes, R.C., Fortes, Z.B., Chopard, R.P., Touyz, R.M., Carvalho, M.H., 2014. An interaction of renin-angiotensin and kallikrein-kinin systems contributes to vascular hypertrophy in angiotensin II-induced hypertension: in vivo and in vitro studies. PLoS One 9 (11), e111117. Charakida, M., O'Neil, F., Masi, S., Papageorgiou, N., Tousoulis, D., 2011. Inflammatory disorders and atherosclerosis: new therapeutic approaches. Curr. Pharm. Des. 17 (37), 4111–4120. Doods, H., Hauel, N., Kirsten, A., Kramer, G., Ceci, A., 2012. BI 113823, a novel B1 receptor antagonist exhibiting antinociceptive properties in inflammatory pain models. Pain Pract. 12, 18. Dorn II, G.W., 2009. Novel pharmacotherapies to abrogate postinfarction ventricular remodeling. Nat. Rev. Cardiol. 6 (4), 283–291. Erdös, E.G., Tan, F., Skidgel, R.A., 2010. Angiotensin I-converting enzyme inhibitors are allosteric enhancers of kinin B1 and B2 receptor function. Hypertension 55 (2), 214–220.
Frangogiannis, N.G., 2014. The inflammatory response in myocardial injury, repair, and remodelling. Nat. Rev. Cardiol. 11 (5), 255–265. Golias, C., Charalabopoulos, A., Stagikas, D., Charalabopoulos, K., Batistatou, A., 2007. The kinin system—bradykinin: biological effects and clinical implications. Multiple role of the kinin system—bradykinin. Hippokratia 11 (3), 124–128. Guo, Y., Liu, T., Li, X., Zhang, M., Shi, L., Liu, H., 2015. Expression of the genes encoding kinin receptors are increased in human carotid atherosclerotic plaques. Biomed. Rep. 3 (3), 398–402. Herskowitz, A., Choi, S., Ansari, A.A., Wesselingh, S., 1995. Cytokine mRNA expression in postischemic/reperfused myocardium. Am. J. Pathol. 146 (2), 419–428. Hornig, B., Kohler, C., Drexler, H., 1997. Role of bradykinin in mediating vascular effects of angiotensin-converting enzyme inhibitors in humans. Circulation 95 (5), 1115–1118. Kuhr, F., Lowry, J., Zhang, Y., Brovkovych, V., Skidgel, R.A., 2010. Differential regulation of inducible and endothelial nitric oxide synthase by kinin B1 and B2 receptors. Neuropeptides 44 (2), 145–154. Lagneux, C., Bader, M., Pesquero, J.B., Demenge, P., Ribuot, C., 2002a. Detrimental implication of B1 receptors in myocardial ischemia: evidence from pharmacological blockade and gene knockout mice. Int. Immunopharmacol. 2 (6), 815–822. Lagneux, C., Bader, M., Pesquero, J.B., Demenge, P., Ribuot, C., 2002b. Detrimental implication of B1 receptors in myocardial ischemia: evidence from pharmacological blockade and gene knockout mice. Int. Immunopharmacol. 2 (6), 815–822. Lauredo, I.T., Forteza, R.M., Botvinnikova, Y., Abraham, W.M., 2004. Leukocytic cell sources of airway tissue kallikrein. Am. J. Phys. Lung Cell. Mol. Phys. 286 (4), L734–L740. Leeb-Lundberg, L.M., Marceau, F., Muller-Esterl, W., Pettibone, D.J., Zuraw, B.L., 2005. International union of pharmacology. XLV. Classification of the kinin receptor family: from molecular mechanisms to pathophysiological consequences. Pharmacol. Rev. 57, 27–77. Madeddu, P., Emanueli, C., Maestri, R., Salis, M.B., Minasi, A., Capogrossi, M.C., Olivetti, G., 2000. Angiotensin II type 1 receptor blockade prevents cardiac remodeling in bradykinin B(2) receptor knockout mice. Hypertension 35 (1 Pt 2), 391–396. More, A.S., Kim, H.M., Khang, G., Hildebrandt, T., Bernlöhr, C., Doods, H., Vanhoutte, P.M., Wu, D., 2014a. Des-Arg9-bradykinin causes kinin B1 receptor mediated endotheliumindependent contractions in endotoxin-treated porcine coronary arteries. Pharmacol. Res. 90C, 18–24. More, A.S., Kim, H.M., Zhao, R., Khang, G., Hildebrandt, T., Bernlöhr, C., Doods, H., Lee, D., Lee, S.H., Vanhoutte, P.M., Wu, D., 2014b. COX-2 mediated induction of endothelium-independent contraction to bradykinin in endotoxin-treated porcine coronary artery. J. Cardiovasc. Pharmacol. 64 (3), 209–217. Murugesan, P., Hildebrandt, T., Bernlöhr, C., Lee, D., Khang, G., Doods, H., Wu, D., 2015. Inhibition of kinin B1 receptors attenuates pulmonary hypertension and vascular remodeling. Hypertension 66 (4), 906–912. Nian, M., Lee, P., Khaper, N., Liu, P., 2004. Inflammatory cytokines and postmyocardial infarction remodeling. Circ. Res. 94 (12), 1543–1553. Novoyatleva, T., Sajjad, A., Engel, F.B., 2014. TWEAK-Fn14 cytokine-receptor Axis: anew player of myocardial remodeling and cardiac failure. Front. Immunol. 5, 50. Raj, P., Aloud, B.M., Louis, X.L., Yu, L., Zieroth, S., Netticadan, T., 2016. Resveratrol is equipotent to perindopril in attenuating post-infarct cardiac remodeling and contractile dysfunction in rats. J. Nutr. Biochem. 28, 155–163. Stauss, H.M., Zhu, Y.C., Redlich, T., Adamiak, D., Mott, A., Kregel, K.C., Unger, T., 1994. Angiotensin-converting enzyme inhibition in infarct-induced heart failure in rats: bradykinin versus angiotensin II. J. Cardiovasc. Risk 1 (3), 255–262. Strauss, M.H., Hall, A.S., 2015. The divergent cardiovascular effects of angiotensin converting enzyme inhibitors and angiotensin receptor blockers on myocardial infarction and death. Prog. Cardiovasc. Dis. (pii: S0033-0620(15)30023-2). Tanaka, Y., Nagai, M., Date, T., Okada, T., Abe, Y., Seki, S., Taniguchi, M., Taniguchi, I., Mochizuki, S., 2004. Effects of bradykinin on cardiovascular remodeling in renovascular hypertensive rats. Hypertens. Res. 27 (11), 865–875. Tschöpe, C., Heringer-Walther, S., Walther, T., 2000. Regulation of the kinin receptors after induction of myocardial infarction: a mini-review. Braz. J. Med. Biol. Res. 33 (6), 701–708. Westermann, D., Lettau, O., Sobirey, M., Riad, A., Bader, M., Schultheiss, H.P., Tschöpe, C., 2008. Doxorubicin cardiomyopathy-induced inflammation and apoptosis are attenuated by gene deletion of the kinin B1 receptor. Biol. Chem. 389 (6), 713–718. Westermann, D., Walther, T., Savvatis, K., Escher, F., Sobirey, M., Riad, A., Bader, M., Schultheiss, H.P., Tschöpe, C., 2009. Gene deletion of the kinin receptor B1 attenuates cardiac inflammation and fibrosis during the development of experimental diabetic cardiomyopathy. Diabetes 58 (6), 1373–1381. Whitehurst, R.M., Laskey, R., Goldberg, R.N., Herbert, D., Van Breemen, C., 1999. Influence of group B streptococci on piglet pulmonary artery response to bradykinin. J. Appl. Physiol. 86 (1), 61–65. Wu, D., Lin, X., Bernloehr, C., Hildebrandt, T., Doods, H., 2012. Effects of a novel bradykinin B1 receptor antagonist and angiotensin II receptor blockade on experimental myocardial infarction in rats. PLoS One 7 (12), e51151. Xu, J., Carretero, O.A., Sun, Y., Shesely, E.G., Rhaleb, N.E., Liu, Y.H., Liao, T.D., Yang, J.J., Bader, M., Yang, X.P., 2005. Role of the B1 kinin receptor in the regulation of cardiac function and remodeling after myocardial infarction. Hypertension 45 (4), 747–753. Yin, H., Chao, J., Bader, M., Chao, L., 2007. Differential role of kinin B1 and B2 receptors in ischemia-induced apoptosis and ventricular remodeling. Peptides 28 (7), 1383–1389. Yokoyama, T., Vaca, L., Rossen, R.D., Durante, W., Hazarika, P., Mann, D.L., 1993. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J. Clin. Invest. 92 (5), 2303–2312. Yousef, Z.R., Redwood, S.R., Marber, M.S., 2000. Postinfarction left ventricular remodeling: a pathophysiological and therapeutic review. Cardiovasc. Drugs Ther. 14 (3), 243–252. Zhao, S.P., Zeng, L.H., 1997. Elevated plasma levels of tumor necrosis factor in chronic heart failure with cachexia. Int. J. Cardiol. 58 (3), 257–261.