- Email: [email protected]
Klotho is a target gene of PPAR-γ
original article
http://www.kidney-international.org & 2008 International Society of Nephrology
see commentary on page 702
Klotho is a target gene of PPAR-c Hong Zhang1,2, Yuanyuan Li1, Yanbo Fan1, Jing Wu3, Beilei Zhao1, Youfei Guan2,3, Shu Chien4 and Nanping Wang1,2 1
Institute of Cardiovascular Sciences, Peking University Health Science Center, Beijing, China; 2Diabetes Center, Peking University Health Science Center, Beijing, China; 3Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, China and 4Department of Bioengineering, University of California San Diego, La Jolla, California, USA
Klotho is an anti-aging gene whose expression is regulated by many stimuli. Here we examined the transcriptional regulation of the klotho gene by peroxisome proliferator-activated receptor-c (PPAR-c). The PPAR-c agonists thiazolidinediones increased both klotho mRNA and protein expression in HEK293 cells and several renal epithelial cell lines. The induction was blocked by PPAR-c antagonists or small-interfering RNA-mediated gene silencing of PPAR-c, suggesting a PPAR-c-dependent mechanism. Chromatin immuno-precipitation and gel shift assays found a noncanonical PPAR-responsive element within the 50 -flanking region of the human klotho gene with promoter–reporter assays further confirming transcriptional functionality. Moreover, thiazolidinediones or adenovirus-mediated overexpression of PPAR-c increased klotho expression in mouse kidneys while renal klotho expression was attenuated in mice treated with PPAR-c antagonists. These results demonstrate that klotho is a target gene of PPAR-c. Kidney International (2008) 74, 732–739; doi:10.1038/ki.2008.244; published online 11 June 2008 KEYWORDS: gene expression; transcription factor; diabetic nephropathy
The klotho gene encodes a type I transmembrane protein that shares homology with b-glucosidase. Klotho deficiency in mice results in a phenotype resembling human aging, including arteriosclerosis, neural degeneration, defective hearing, skin and gonadal atrophy, ectopic calcification in various soft tissue, pulmonary emphysema, and greatly shortened lifespan.1 The klotho gene is predominantly expressed in the kidney and, to a lesser extent, in the brain and reproductive and endocrine organs. The expression of the klotho gene is regulated in response to various physiological and pathological conditions such as thyroid hormone, oxidative stress, long-term hypertension, chronic renal failure,2 and so on. To date, little has been known about the transcriptional mechanisms underlying the regulated expression of the klotho gene. Peroxisome proliferator-activated receptors (PPARs) are a family of ligand-activated nuclear hormone receptor and transcription factors.3,4 Among the three isoforms a, b/d, and g, PPAR-g is predominantly expressed in adipose tissues and, to a lesser extent, in other tissues including kidneys.5,6 PPAR-g is activated by various natural and synthetic ligands and plays important roles in adipogenesis 7 and insulin sensitivity.8 An earlier study showed that troglitazone, an insulin sensitizer and agonist for PPAR-g, augmented the renal klotho mRNA expression in OLETF (Otsuka LongEvans Tokushima Fatty) rats, which exhibit pathophysiological changes that resemble metabolic syndrome in human, including hypertension, obesity, severe hyperglycemia, and hypertriglyceridemia.9 It has also been recently described that klotho promotes adipocyte differentiation in cultured preadipocytes10 and that, in transgenic mice, overexpression of klotho slows the aging process through induction of insulin resistance. However, the role of PPAR-g in the regulation of the klotho gene expression remains unknown. Therefore, this study was performed to characterize the specific role of PPAR-g in the induction of the klotho gene both in vitro and in vivo.
Correspondence: Nanping Wang, Institute of Cardiovascular Sciences, Peking University Health Science Center, Beijing 100083, China. E-mail: [email protected] or [email protected]
RESULTS Thiazolidinediones increased expression of klotho mRNA in dose- and time-dependent manners
Received 21 July 2007; revised 24 March 2008; accepted 1 April 2008; published online 11 June 2008
To determine the effect of PPAR-g on the expression of klotho gene, we treated 293 cells with PPAR-g agonists
732
Kidney International (2008) 74, 732–739
original article
a
6
Relative klotho mRNA
H Zhang et al.: Klotho gene is a PPAR-c target
5
**
4
**
**
3
**
2 1 0 Control DMSO 10
b
7
Relative klotho mRNA
0
6
50
50 Troglitazone (µM)
10
12
24
**
**
5
h
Characterization of the PPRE within the 50 -flanking region of human klotho gene
**
4 3
*
2 1 0
Control DMSO 10 0
25 12
10
25 24
Ciglitazone (µM) h
Figure 1 | TZDs increased klotho expression in a dose- and time-dependent manner. HEK293 cells were treated with control medium, the solvent DMSO, and the TZDs troglitazone (a) or ciglitazone (b) for the indicated time periods. Relative mRNA level of klotho gene was determined by using qRT-PCR and, after normalization with b-actin, expressed as the fold induction in relation to the control. Data represent means±s.e.m. of three independent experiments. *Po0.05, **Po0.01 vs control.
troglitazone and ciglitazone, both being thiazolidinediones (TZDs), at various concentrations for different time periods. Klotho mRNA level was measured by quantitative reversetranscriptase-PCR (qRT-PCR). As shown in Figure 1, both troglitazone and ciglitazone significantly increased the mRNA expression of klotho gene in 293 cells in a timeand dose-dependent manner. To ascertain whether TZDs also induce klotho gene expression in differentiated renal tubular epithelial cells, we further examined the effect of troglitazone in IMCD (inner medullary collecting ducts cells), MCT (proximal tubular epithelial cells),11 and MDCK (distal tubule cells)12,13 cell lines. Northern analysis confirmed that klotho gene was expressed to different extent in all the three cell lines tested, and the expression was similarly induced by troglitazone (Figure 2b). Thiazolidinedione induction of klotho expression was dependent on PPAR-c activation
To examine whether the TZD-induced expression of klotho was mediated by PPAR-g activation, cells were pretreated with a selective PPAR-g antagonist GW9662 (20 mM for 1 h) prior to the incubation with troglitazone. Both qRT-PCR and northern blotting demonstrated that GW9662 blocked the troglitazone-induced increase of klotho mRNA (Figure 2a and b). Similarly, bisphenol-A diglycidyl ether (BADGE), another PPAR-g antagonist, also reduced the induction of Kidney International (2008) 74, 732–739
klotho expression by troglitazone (Figure 2a, lower panel). To further confirm the role of endogenous PPAR-g on the expression of klotho mRNA, the cells were transfected with PPAR-g-specific short interfering RNA (siRNA) or green fluorescence protein (GFP)-siRNA as a control. As shown in Figure 2c, the expression level of the endogenous PPAR-g was reduced by approximately 90% compared with the control siRNA-transfected cells. Knockdown of PPAR-g abrogated the trogilatazone-induced expression of klotho. Taken together, these results suggested that TZD-induced klotho expression was dependent on the activation of endogenous PPAR-g.
Sequence analysis of the 50 -flanking region of human klotho gene revealed no typical binding site for PPARs. However, two noncanonical PPAR-responsive element (PPRE) motifs were found, one at –3698 bp (GAACTCCTGACCT) and the other at 2760 bp (ACTGGATGAAGGA) upstream of the ATG start codon. The binding activities of these regions to PPAR-g were examined by chromatin immunoprecipitation (ChIP) assay, which showed that the region harboring the distal PPRE could be immunoprecipitated by PPAR-g antibody but not the control IgG (Figure 3a), indicating that PPAR-g was able to bind to this region of the klotho gene in 293 cells. To further examine whether the noncanonical PPRE (–3698) motif binds PPAR-g and whether the binding was affected by the PPAR-g ligand, we performed EMSA (electrophoretic mobility shift assay) with the oligonucleotide probe. The results showed that the probe containing the region between 3698 and 3686 bp was shifted by the nuclear proteins. The DNA binding was increased by the troglitazone treatment and abolished by the unlabeled probes (Figure 3b). However, the oligonucleotide probe containing the PPRE-2 (–2760/2746 bp) was not shifted by the nuclear extract (data no showed). In addition, the PPAR-g antibody resulted in a super-shifted band (Figure 3b). Thus, these results indicated that PPAR-g may directly bind to the noncanonical PPRE to activate the klotho gene. To further validate the transcriptional functionality of this noncanonical PPRE, we transfected the luciferase reporterdriven by 2 KL-PPRE into human embryonic kidney (HEK) 293 (HEK293 cells; 293 cell line was used because it has a better transfection efficiency). As shown in Figure 3c, rosiglitazone increased the transcriptional activity of the reporter and the induced activity was abolished in the presence of GW9662. These results indicated that PPAR-g activated klotho expression through a functional cis-element within the klotho gene. Effects of TZDs and PPAR-c antagonist on the expression of klotho gene in vivo
To determine whether klotho is a target gene of PPAR-g in vivo, we have treated C57BL/6 mice with or without troglitazone (200 mg/kg/day) for 3 days and measured the 733
original article
H Zhang et al.: Klotho gene is a PPAR-c target
a
HEK293 DMSO
GW
b
GW+TRO TRO
IMCD
MCT
MDCK
DMSO TRO GW+TRO DMSO TRO GW+TRO DMSO TRO GW+TRO
Klotho
5.2 kb
Klotho
β-Actin
1.8 kb
β-Actin 7
**
HEK293
6
**
6 Relative klotho mRNA
Relative klotho mRNA
7
**
5 4 3 2
*
5 4
**
3
**
0 Troglitazone
–
–
–
+
+
+
DMSO TRO TRO+GW
GW9662
–
+
–
–
+
–
IMCD
BADGE
–
–
+
–
–
+
0
9
100 90 80 70 60 50 40 30 20 10 0
** GFP-siRNA
PPAR-γ-siRNA
DMSO TRO TRO+GW DMSO TRO TRO+GW
MCT
**
8
HEK293 Relative klotho mRNA
Relative PPAR-γ mRNA
**
2 1
1
c
**
MDCK
HEK293
7 6 5 4 3 2 1
0 TRO
–
+
GFP-siRNA
–
+
PPAR-γ-siRNA
Figure 2 | TZD-induced klotho expression is dependent on PPAR-c activation. (a) HEK293 or renal cell lines were treated with or without GW9662 (20 mM) or BADGE (20 mM) for 1 h and exposed to DMSO or troglitazone (50 mM) for 24 h. Total RNA was extracted and subjected to northern blotting (the upper panel) and qRT-PCR (the lower panel). (b) Northern analysis of klotho gene expression in IMCD, MCT, or MDCK cell lines. The bar graph represents the results of scanned densities of three northern blotting experiments using the NIH Image J after normalization with b-actin. (c) HEK293 cells were transfected with siRNA specific for PPAR-g or GFP (40 nM) for 48 h before the exposure to troglitazone or DMSO. Relative mRNA levels of PPAR-g and klotho were determined by using qRT-PCR. *Po0.05; **Po0.01.
klotho expression at both mRNA and protein levels. The qRT-PCR and northern blotting (Figure 4a) showed that the klotho mRNA level was significantly increased in the kidney of troglitazone-treated mice compared with the control group. Similarly, the protein level of klotho was also increased by troglitazone (Figure 4b). To examine whether different PPAR-g agonist elicited the same effect in vivo, mice were also treated with rosiglitazone. The results showed that rosiglitazone at a lower dose (20 mg/kg/day) elicited a similar induction of klotho gene expression in the kidneys. Importantly, treatment with BADGE, a PPAR-g antagonist, significantly reduced the TZD-induced expression, suggesting that PPAR-g activation is required for the klotho induction by TZD in vivo (Figure 4c).
shown by qRT-PCR and western blotting, Ad-PPAR-g but not Ad-GFP infection achieved the overexpression of PPAR-g in mouse kidneys, which subsequently resulted in a marked increase in klotho at mRNA and protein levels. The immunohistochemical studies also demonstrated that intrarenal infection of Ad-PPRA-g induced overexpresion of PPAR-g, which was stained positive in the nuclei for the HA antibody. Klotho expression was clearly induced and predominantly shown as membrane-associated staining (Figure 5c). The sections were stained negative when the primary antibody was omitted (figure not shown). Therefore, the results suggest that PPAR-g activation is sufficient to induce the klotho expression in situ. DISCUSSION
Adenovirus-mediated overexpression of PPAR-c activated the expression of klotho gene in vivo
To further investigate whether PPAR-g activation is sufficient to induce the klotho expression in vivo, a constitutively active PPAR-g was adenovirally infected into the mouse kidney. As 734
In the present study, we have established a novel transcriptional mechanism that controls the expression of klotho, an important anti-aging hormone, by showing that klotho is a target gene of PPAR-g in the cultured kidney cells as well as in mouse kidneys in vivo. This conclusion is supported by both Kidney International (2008) 74, 732–739
original article
b PPRE-1
PPRE-2
Klotho
–2760/–2747
+1
KL
a
TRO – –3698/3686
Input
α-PPAR-γ
AO X KL KL +c KL old +c K L KL old +I N KL gG S +a nt i-P PA R -γ
H Zhang et al.: Klotho gene is a PPAR-c target
+
+
+
+
+
+
IgG
PPRE-1 PPRE-2
***
2 × KL-PPRE-luc activity
c
**
10 9 8 7 6 5 4 3 2 1 0 Control
RO
GW+RO
0
Figure 3 | PPAR-c bound to the PPRE within the 5 -flanking region of klotho gene. (a) The diagram depicts the putative PPRE motifs located in the 50 -flanking region of the human klotho gene. HEK293 cells were coinfected with Ad-PPAR-g and Ad-tTA for 24 h. ChIP assays were performed with the antibodies against PPAR-g or IgG as control. The immunoprecipitates and the positive input control were amplified with the use of specific primer sets spanning the DNA segments containing the putative PPRE-1 and PPRE-2. (b) EMSA was performed by incubating the nuclear extracts from the control or troglitazone-treated cells with the 32P-ATP-labeled probe corresponding to the consensus PPRE (AOX) or the klotho PPRE-1 motif (KL). Cold competition assays were done by adding the unlabeled specific (cold KL) or nonspecific (NS) probe to the binding reactions. Supershift assays were done by adding the control IgG or the PPAR-g antibody. Data shown are representative of at least three independent experiments. Arrow indicates the shifted DNA–protein complex. (c) HEK293 cells transfected with the KL-PPRE-Luc and the b-gal plasmids were treated with DMSO (control) or rosiglitazone (RO, 20 mM) with or without GW9662 (GW, 20 mM). Luciferease activity was normalized to b-gal activity and expressed as fold induction compared with control. Data are mean±s.e.m. of three independent experiments. **Po0.01; ***Po0.01.
the loss-of-function and the gain-of-function approaches: TZD induction of klotho was attenuated in the presence of specific antagonists GW9662 and BADGE both in vitro and in vivo or the knockdown of endogenous PPAR-g by using the specific siRNA; conversely, the pharmacological TZD agonists and the ligand-independent constitutive activation resulted in the induction of klotho. Moreover, we have identified a functional noncanonical PPRE motif within the 50 -flanking region of the klotho gene that is recognized by PPAR-g and may mediate the inductive effect of PPAR-g. A previous study described that administration of troglitazone for 10 weeks significantly reduced systolic blood pressure, plasma glucose, and triglyceride levels, while augmenting endothelium-dependent aortic relaxation and renal klotho mRNA expression in OLETF rats.14 However, it remained unclear whether the augmented expression of klotho mRNA was due to a direct effect of PPAR-g activation or an indirect effect secondary to the improved metabolism. A recent report showed that in 3T3-L1 preadipocytes a TZD agonist, pioglitazone, temporarily increased the klotho mRNA expression and that recombinant klotho protein accelerated adipocyte differentiation, suggesting a link between klotho and adipogenesis.10 Here, our study has Kidney International (2008) 74, 732–739
provided the first evidence for a specific and direct role of PPAR-g in the transcriptional control of klotho gene expression. PPAR-g is a key transcription factor controlling adipogenesis and insulin sensitivity. PPAR-g dimerizes with retinoid X receptor and activates the gene expression by binding to the cognate PPRE within the regulatory region of the target genes. Although there has been no apparent consensus PPRE found within the regulatory region of the klotho gene, noncanonical motifs for PPAR-g have been identified in many PPAR-g target genes.15,16 They are often located at a distal region upstream of the transcription initiative site.17 By using ChIP, gel shift, and supershift assays, we have identified a novel PPRE motif that can be recognized by PPAR-g. Moreover, the reporter assay showed that the noncanonical PPRE is functionally activated by rosiglitazone and the activation is abolished by the PPAR-g antagonist GW0742. These results, taken together, support the concept that klotho is a target gene of PPAR-g. However, the lack of larger segments of the 50 -flanking region upstream of the human and mouse klotho genes limits understanding of the interactive role of this motif with other regulatory elements. 735
original article
H Zhang et al.: Klotho gene is a PPAR-c target
a
b
Troglitazone
Control
Control
Klotho
Klotho
β-Actin
α-Tubulin
Troglitazone
**
10
2.0 Klotho protein level
Klotho mRNA level
12
8 6 4 2
**
1.5 1.0 0.5 0.0
0 Control
Klotho mRNA level
c
Troglitazone
Control
**
10 9 8 7 6 5 4 3 2 1 0
Control
Troglitazone
*
RO
BADGE
BADGE+RO
20
** 15 10 5 0
b
Ad-GFP Klotho
HA-PPAR-γ
α-Tubulin
**
15
c
10
5 0
Ad-GFP
Ad-PPAR-γ
Ad-GFP 12.5
Ad-PPAR-γ Klotho protein level
Relative PPAR-γ mRNA
a
Relative klotho mRNA
Figure 4 | Troglitazone increases the expression of klotho in mouse kidneys. (a) Total RNA was extracted from the kidneys from the control C57bl mice or those treated with troglitazone for 3 days. Expression of klotho mRNA was detected with northern blotting and quantified with qRT-PCR. (b) Protein samples were isolated from the kidney tissues and subjected to western blotting using antibodies against klotho or a-tubulin. The results of immunoblots were scanned, quantified using the NIH image J, and expressed as fold increase compared with the control. Data represent means±s.e.m. of three independent experiments. (c) qRT-PCR was performed with the use of total RNA samples from the control mice and those given rosiglitazone, BADGE, or both for 3 days. There were three animals in each group. *Po0.05, **Po0.01 vs control.
Ad-PPAR-γ
α-HA-PPAR-γ
**
10.0 7.5 5.0 2.5 0.0 Ad-GFP
Ad-PPAR-γ
α-Klotho
Figure 5 | Adenovirus-mediated overexpression of PPAR-c increased the expression of klotho in mouse kidneys. Mice were intra-renally injected with Ad-GFP or Ad-PPAR-g, together with Ad-tTA. Total RNA and protein were extracted 48 h later and subjected to qRT-PCR for the detection of PPAR-g and klotho mRNA (a), or western blotting for klotho, a-tubulin, or the HA tagged to the adenovirally expressed PPAR-g (b). **Po0.01 vs control. (c) Immunohistochemical staining shows that intra-renal overexpression of PPAR-g, as shown by the HA-antibody staining, resulted in an increased expression of klotho protein in situ. Bar ¼ 50 mM. 736
Kidney International (2008) 74, 732–739
original article
H Zhang et al.: Klotho gene is a PPAR-c target
The klotho gene encodes a single-pass transmembrane protein that is detectable in a limited number of tissues including kidney and brain. In kidney, klotho is expressed at a high level in convoluted tubules as well as in other tubular epithelia such as inner medullary collecting duct cells.1,18 Besides using HEK293, we also examined the regulation of klotho by PPAR-g in several other renal cell lines including MDCK, MCT, and IMCD. These cell lines are known to exhibit many features for distal tubules, proximal tubules, and inner medullary collecting ducts, respectively.10–13 In this study, we found that TZDs induce klotho expression both in HEK293 cells and, more importantly, several differentiated renal tissues across a number of species, implying that the PPAR-g induction of renal klotho represents an evolutionarily conserved mechanism and may have an important physiological significance. It has been reported that gene expression of klotho was reduced in patients with chronic renal failure.2 The downregulation of the klotho gene in the kidney could exacerbate ischemic renal failure and of the renal damage induced by angiotensin II.19,20 Moreover, a recent study demonstrated that klotho may serve as a potential renoprotective humoral factor by reducing mitochondrial oxidative stress.21 Up to one-third diabetic patients suffer end-stage renal failure due to diabetic nephropathies. Clinical studies have demonstrated that TZDs ameliorate diabetic nephropathy and many of the favorable effects of TZDs occur through both PPAR-g-dependent and -independent mechanisms.22–24 Given our results that klotho is a renal target of PPAR-g, it is suggested that the upregulation of klotho expression by PPAR-g may contribute to the protective effects of TZDs in renal complications of the type II diabetes. These findings may have important pathophysiological significance. Intriguingly, an interaction between klotho and insulin resistance has been recently uncovered. Koro-o and colleagues found that klotho functions as a humoral factor that signals suppression of intracellular insulin/IGF1 signaling, which may contribute to its anti-aging properties.25,26 Since PPAR-g is an important therapeutic target for the treatment of insulin resistance and type II diabetes, the functional role of klotho regulation by PPAR-g warrants further investigation. In conclusion, our study demonstrates a novel transcriptional mechanism by which the TZD insulin sensitizers regulate the klotho expression. These results suggest an important link between PPAR-g and klotho, the renalderived hormone. MATERIALS AND METHODS Cells and reagents Human embryonic kidney 293, mouse proximal tubular cells (MCT), Madin–Darby canine renal distal tubular cells (MDCK), and inner medullary collecting ducts cells (IMCD) (ATCC, Rockville, MD, USA) were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS). Troglitazone (Parke-Davis Pharmaceuticals, Detroit, MI, USA), ciglitazone, rosiglitazone, Kidney International (2008) 74, 732–739
BADGE, and GW9662 (Cayman Chemical, Ann Arbor, MI, USA) were dissolved in dimethyl sulfoxide (DMSO). RNA analyses Total RNA was isolated from HEK293 cells or mouse kidneys using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For qRT-PCR, cDNA was generated from 2 mg RNA by using Superscript II reverse transcriptase and oligo-dT primer (Invitrogen). PCR reactions were performed with the use of specific primers (Table 1) on Opticon continuous fluorescence detection system (MJ Research Inc., Waltham, MA, USA) with SYBR green fluorescence (Molecular Probes, Eugene, OR, USA). Gene expression was quantified by using the comparative CT method, normalized to b-actin and expressed as fold induction of control. For northern blotting, 20 mg of RNA for each sample was separated on a 1.2% agarose-formaldehyde gel, transferred to nitrocellulose, and hybridized with a-32P-dCTP-labeled cDNA probes for klotho or b-actin.27 Western blotting Protein samples were extracted from mouse kidneys as previously described, with modifications.28 Briefly, mice were killed and the kidneys were homogenized in the homogenizing buffer (0.25 M sucrose, 2 mM EDTA (ethylenediaminetetraacetic acid), 10 mM EGTA (ethyleneglycol tetraacetate), 10 mM 2-mercaptoethanol, and 20 mM Tris-HCl, pH7.5). The homogenates were centrifuged at 12,000 r.p.m. for 10 min at 41C, and the supernatant was centrifuged at 100,000 r.p.m. for 3 h at 41C. The pellets were resuspended in the homogenizing buffer, supplemental with 1% Triton X-100 and 4% CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate). Protein samples were separated on 10% SDS-PAGE
Table 1 | Sequences for primers and probes used Gene
Accession no.
Sequences
Primers for PCR Human klotho
NM_004795
Mouse klotho
NM_013823
Human PPAR-g
NM_138712
b-Actin
EF607093
50 -gcccacatactggatggtatcaa-30 50 -actgcactcagtacacacggtga-30 50 -acaaagaagtggccgagaga-30 50 -cctgactgggagagttgagc-30 50 -tcatggcaattgaatgtcgt-30 50 -ccaacagcttctccttctcg-30 50 -atctggcaccacaccttc-30 50 -agccaggtccagacgca-30
Primers for ChIP assay Klotho PPRE-1 Klotho PPRE-2
50 -gccaccatgttggtgaattt-30 50 -tcacacctgtaatcccagca-30 50 -agtgcatctcctgctccatt-30 50 -cttgctgtgctttgaacagg-30
Probes for EMSAa Consensus PPRE (Aco oxidase) Klotho PPRE-1 Klotho PPRE-2
50 -ggggaccaggacaaaggtcacgttc gggagct-30 50 -ctcgaactcctgaccttag-30 50 -ggcactggatgaaggaatg-30
siRNAa GFP-siRNA PPAR-g-siRNA
50 -ggcuacguccaggagcgcacc-30 50 -gagugggaguggucuuccauu-30
ChIP, chromatin immunoprecipitation, EMSA, electrophoretic mobility shift assay; GFP, green fluorescence protein; PPAR-g, peroxisome proliferator-activated receptor-g; PPRE, PPAR-responsive element; siRNA, small interfering RNA. a Complementary sequences are omitted.
737
original article
(sodium dodecil sulfate-polyacrylamide gel electrophoresis), transferred to nitrocellulose and probed by using a rat monoclonal antibody against klotho (1:1000) or rabbit antibody against a-tubulin, followed by detection with horseradish peroxidaselabeled secondary antibodies and the ECL chemiluminescence kit (Amersham, Piscataway, NJ, USA).29 RNA interference Short interfering RNA specific for GFP, human PPAR-g, or human klotho30 were synthesized (see Table 1 for the sequences), annealed, and transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen) as previously described.31 Chromatin immunoprecipitation and electrophoretic mobility shift assays Cells were coinfected with Ad-PPAR-g, which expresses a mouse PPAR-g1 fused to a minimal VP16 transactivation domain and tagged with an HA-epitope, and Ad-tTA that encodes a tetracyclineresponsive transactivator in the presence or absence of tetracycline (0.1 mg/ml) for 24 h, as previously described.27 For ChIP assays, cells were crosslinked with formaldehyde, and sonicated and immunoprecipitated with the antibody against PPAR-g or control IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The eluted DNA and the input control were detected by PCR amplification (30 cycles) using the specific primer sets spanning the putative PPRE within the 50 -flanking region of the human klotho gene (0ENSG00000133116, see Table 1 for sequences).32 For EMSA, 5 mg of the nuclear extracts were incubated with the [g-32P]ATP-labeled double-strand oligonucleotides and poly (dI-dC) for 30 min on ice, and then resolved on a 4% polyacrylamide gel. The unlabeled probe was included 100 M in excess in cold competition assays.33
H Zhang et al.: Klotho gene is a PPAR-c target
Immunohistochemistry Cryostat sections (6 mm) of frozen kidneys were fixed in 4% paraformaldehyde. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide. Sections were reacted with the primary antibodies against klotho (rat anti-mouse klotho monoclonal antibody; R&D, Minneapolis, MN, USA) or HA (mouse antiHA monoclonal antibody; Sigma-Aldrich, St Louis, MO, USA). After washing, the sections were incubated with secondary antibodies (biotinylated rabbit anti-rat or anti-mouse IgG), and then with avidin–biotin–peroxidase complex (Vector Laboratories, Burlingame, CA, USA). Sections were visualized with diaminobenzidine substrate and counterstained with hematoxylin.34 Statistical analysis Statistical analyses were performed by one-way ANOVA (analysis of variance) or Student t-test. Data are expressed as mean±s.e.m. The P-values less than 0.05 were considered statistically significant. DISCLOSURE
All authors of this paper have nothing to disclose. ACKNOWLEDGMENTS
This study was supported, in part, by the Ministry of Education (PCSIRT) and grants from National Science Foundation of China no. 30470810, 30670848, and 30600231), the Ministry of Science and Technology (2006CB503900 and 2006CB943503). REFERENCES 1. 2.
3.
Promoter–reporter assay To construct the KL-PPRE-luciferase reporter plasmid, we synthesized complementary oligonucleotides containing two repeats of the putative klotho PPRE (the motifs are in italic) (50 -ATAGGTACCG TCTCGAACTCCTGACCTTAGGTGGTCTCGAGTCTCGAACTCTGA CCTTAGGTGGTCTAAGCTTGG-30 ) and flanking sites for KpnI and HindIII. The double strands were annealed and subcloned to pGL3Enhancer (Promega, Madison, WI, USA). The KL-PPRE-Luc plasmid (1 mg/well) was transfected together with the b-galactosidase expression plasmid into subconfluent 293 cells with the use of Lipofectamine 2000 (Invitrogen). Twenty-four hours later, the cells were treated with DMSO, rosiglitazone, or GW9662. Cell lysates were harvested 24 h later to measure luciferase and b-galactosidase activities. Animal experiments Animal protocols were approved by the Peking University Health Science Center, complying with the Guideline for Care and Use of Laboratory Animals. C57BL/6 mice weighting 25–30 g were given troglitazone (200 mg/kg/day), rosiglitazone (20 mg/kg/day), or BADGE (10 mg/kg/day) by oral gavage. Alternatively, intra-renal adenoviral infection was performed under pentobarbital anesthetization. Ad-PPAR-g or Ad-GFP, together with Ad-tTA was injected into kidney at 1 109 PFU. Three days after the troglitazone treatment or the adenoviral infection, the mice were killed and the kidneys were immediately excised to extract the RNA and protein, or frozenembedded in optimum cutting temperature compound for immunohistochemical study. 738
4. 5. 6.
7. 8.
9.
10. 11.
12. 13. 14.
15.
16.
Kuro-o M, Matsumura Y, Aizawa H et al. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997; 390: 45–51. Koh N, Fujimori T, Nishiguchi S et al. Severely reduced production of Klotho in human chronic renal failure kidney. Biochem Biophys Res Com 2001; 280: 1015–1020. Forman BM, Chen J, Evans RM. The peroxisome proliferator-activated receptors: ligands and activators. Ann NY Acad Sci 1996; 804: 266–275. Desvergne B, Wahli W. Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev 1999; 20: 649–688. Guan Y, Zhang Y, Breyer MD. The role of PPARs in the transcriptional control of cellular processes. Drug News Perspect 2002; 15: 147–154. Guan Y, Hao C, Cha DR et al. Thiazolidinediones expand body fluid volume through PPARgamma stimulation of ENaC-mediated renal salt absorption. Nat Med 2005; 11: 861–866. Farmer SR. Regulation of PPARgamma activity during adipogenesis. Int J Obes (Lond) 2005; 29(Suppl 1): S13–S16. Nehlin JO, Mogensen JP, Petterson I et al. Selective PPAR agonists for the treatment of type 2 diabetes. Ann NY Acad Sci 2006; 1067: 448–453. Yamagishi T, Saito Y, Nakamura T et al. Troglitazone improves endothelial function and augments renal klotho mRNA expression in Otsuka Long-Evans Tokushima Fatty (OLETF) rats with multiple atherogenic risk factors. Hypertension Res 2001; 24: 705–709. Chihara Y, Rakugi H, Ishikawa K et al. Klotho protein promotes adipocyte differentiation. Endocrinology 2006; 147: 3835–3842. Haverty TP, Kelly CJ, Hines WH et al. Characterization of a renal tubular epithelial cell line which secretes the autologous target antigen of autoimmune experimental interstitial nephritis. J Cell Biol 1988; 107: 1359–1368. Ng KH, Lim BG, Wong KP. Sulfate conjugating and transport functions of MDCK distal tubular cells. Kidney Int 2003; 63: 976–986. Gaush CR, Hard WL, Smith TF. Characterization of an established line of canine kidney cells (MDCK). Proc Soc Exp Biol Med 1966; 122: 931–935. Yamagishi T, Saito Y, Nakamura T et al. Troglitazone improves endothelial function and augments renal klotho mRNA expression in otsuka long-evans tokushima fatty (OLETF) rats with multiple atherogenic risk factors. Hyperten Res 2001; 24: 705–709. Lemay DG, Hwang DH. Genome-wide identification of peroxisome proliferator response elements using integrated computational genomics. J Lipid Res 2006; 47: 1583–1587. Hevener AL, Olefsky JM, Reichart D et al. Macrophage PPARgamma is required for normal skeletal muscle and hepatic insulin sensitivity and Kidney International (2008) 74, 732–739
original article
H Zhang et al.: Klotho gene is a PPAR-c target
17.
18.
19.
20.
21.
22.
23. 24.
25.
full antidiabetic effects of thiazolidinediones. J Clin Invest 2007; 117: 1658–1669. Degenhardt T, Matilainen M, Herzig KH et al. The insulin-like growth factor-binding protein 1 gene is a primary target of peroxisome proliferator-activated receptors. J Biol Chem 2006; 281: 39607–39619. Mitobe M, Yoshida T, Sugiura H et al. Oxidative stress decreases klotho expression in a mouse kidney cell line. Nephron Exp Nephrol 2005; 101: e67–e74. Sugiura H, Yoshida T, Tsuchiya K et al. Klotho reduces apoptosis in experimental ischaemic acute renal failure. Nephrol Dialysis Transplant 2005; 20: 2636–2645. Negri AL. The klotho gene: a gene predominantly expressed in the kidney is a fundamental regulator of aging and calcium/phosphorus metabolism. J Nephrol 2005; 18: 654–658. Haruna Y, Kashihara N, Satoh M et al. Amelioration of progressive renal injury by genetic manipulation of Klotho gene. Proc Natl Acad Sci USA 2007; 104: 2331–2336. Panchapakesan U, Chen XM, Pollock CA. Drug insight: thiazolidinediones and diabetic nephropathy—relevance to renoprotection. Nat Clin Pract Nephrol 2005; 1: 33–43. Zhang Y, Guan Y. PPAR-gamma agonists and diabetic nephropathy. Curr Diab Rep 2005; 5: 470–475. Guan Y. Peroxisome proliferator-activated receptor family and its relationship to renal complications of the metabolic syndrome. J Am Soc Nephrol 2004; 15: 2801–2815. Kurosu H, Yamamoto M, Clark JD et al. Suppression of aging in mice by the hormone Klotho. Science 2005; 309: 1829–1833.
Kidney International (2008) 74, 732–739
26. 27.
28.
29. 30.
31.
32.
33.
34.
Bartke A. Long-lived Klotho mice: new insights into the roles of IGF-1 and insulin-in aging. Trends Endocrinol Metab 2006; 17: 33–35. Wang N, Verna L, Chen NG et al. Constitutive activation of peroxisome proliferator-activated receptor-gamma suppresses pro-inflammatory adhesion molecules in human vascular endothelial cells. J Biol Chem 2002; 277: 34176–34181. Li SA, Watanabe M, Yamada H et al. Immunohistochemical localization of Klotho protein in brain, kidney, and reproductive organs of mice. Cell Struct Funct 2004; 29: 91–99. Wang N, Verna L, Hardy S et al. c-Jun triggers apoptosis in human vascular endothelial cells. Circ Res 1999; 85: 387–393. de Oliveira RM. Klotho RNAi induces premature senescence of human cells via a p53/p21 dependent pathway. FEBS Lett 2006; 580: 5753–5758. Toyofuku T, Yoshida J, Sugimoto T et al. FARP2 triggers signals for Sema3A-mediated axonal repulsion. Nat Neurosci 2005; 8: 1712–1719. Zhang H, Sun L, Liang J et al. The catalytic subunit of the proteasome is engaged in the entire process of estrogen receptor-regulated transcription. EMBO J 2006; 25: 4223–4233. Wang N, Verna L, Hardy S et al. Adenovirus-mediated overexpression of c-Jun and c-Fos induces intercellular adhesion molecule-1 and monocyte chemoattractant protein-1 in human endothelial cells. Arterioscler Thromb Vasc Biol 1999; 19: 2078–2084. Qin X, Tian J, Zhang P et al. Laminar shear stress up-regulates the expression of stearoyl-CoA desaturase-1 in vascular endothelial cells. Cardiovasc Res 2007; 74: 506–514.
739
http://www.kidney-international.org & 2008 International Society of Nephrology
see commentary on page 702
Klotho is a target gene of PPAR-c Hong Zhang1,2, Yuanyuan Li1, Yanbo Fan1, Jing Wu3, Beilei Zhao1, Youfei Guan2,3, Shu Chien4 and Nanping Wang1,2 1
Institute of Cardiovascular Sciences, Peking University Health Science Center, Beijing, China; 2Diabetes Center, Peking University Health Science Center, Beijing, China; 3Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, China and 4Department of Bioengineering, University of California San Diego, La Jolla, California, USA
Klotho is an anti-aging gene whose expression is regulated by many stimuli. Here we examined the transcriptional regulation of the klotho gene by peroxisome proliferator-activated receptor-c (PPAR-c). The PPAR-c agonists thiazolidinediones increased both klotho mRNA and protein expression in HEK293 cells and several renal epithelial cell lines. The induction was blocked by PPAR-c antagonists or small-interfering RNA-mediated gene silencing of PPAR-c, suggesting a PPAR-c-dependent mechanism. Chromatin immuno-precipitation and gel shift assays found a noncanonical PPAR-responsive element within the 50 -flanking region of the human klotho gene with promoter–reporter assays further confirming transcriptional functionality. Moreover, thiazolidinediones or adenovirus-mediated overexpression of PPAR-c increased klotho expression in mouse kidneys while renal klotho expression was attenuated in mice treated with PPAR-c antagonists. These results demonstrate that klotho is a target gene of PPAR-c. Kidney International (2008) 74, 732–739; doi:10.1038/ki.2008.244; published online 11 June 2008 KEYWORDS: gene expression; transcription factor; diabetic nephropathy
The klotho gene encodes a type I transmembrane protein that shares homology with b-glucosidase. Klotho deficiency in mice results in a phenotype resembling human aging, including arteriosclerosis, neural degeneration, defective hearing, skin and gonadal atrophy, ectopic calcification in various soft tissue, pulmonary emphysema, and greatly shortened lifespan.1 The klotho gene is predominantly expressed in the kidney and, to a lesser extent, in the brain and reproductive and endocrine organs. The expression of the klotho gene is regulated in response to various physiological and pathological conditions such as thyroid hormone, oxidative stress, long-term hypertension, chronic renal failure,2 and so on. To date, little has been known about the transcriptional mechanisms underlying the regulated expression of the klotho gene. Peroxisome proliferator-activated receptors (PPARs) are a family of ligand-activated nuclear hormone receptor and transcription factors.3,4 Among the three isoforms a, b/d, and g, PPAR-g is predominantly expressed in adipose tissues and, to a lesser extent, in other tissues including kidneys.5,6 PPAR-g is activated by various natural and synthetic ligands and plays important roles in adipogenesis 7 and insulin sensitivity.8 An earlier study showed that troglitazone, an insulin sensitizer and agonist for PPAR-g, augmented the renal klotho mRNA expression in OLETF (Otsuka LongEvans Tokushima Fatty) rats, which exhibit pathophysiological changes that resemble metabolic syndrome in human, including hypertension, obesity, severe hyperglycemia, and hypertriglyceridemia.9 It has also been recently described that klotho promotes adipocyte differentiation in cultured preadipocytes10 and that, in transgenic mice, overexpression of klotho slows the aging process through induction of insulin resistance. However, the role of PPAR-g in the regulation of the klotho gene expression remains unknown. Therefore, this study was performed to characterize the specific role of PPAR-g in the induction of the klotho gene both in vitro and in vivo.
Correspondence: Nanping Wang, Institute of Cardiovascular Sciences, Peking University Health Science Center, Beijing 100083, China. E-mail: [email protected] or [email protected]
RESULTS Thiazolidinediones increased expression of klotho mRNA in dose- and time-dependent manners
Received 21 July 2007; revised 24 March 2008; accepted 1 April 2008; published online 11 June 2008
To determine the effect of PPAR-g on the expression of klotho gene, we treated 293 cells with PPAR-g agonists
732
Kidney International (2008) 74, 732–739
original article
a
6
Relative klotho mRNA
H Zhang et al.: Klotho gene is a PPAR-c target
5
**
4
**
**
3
**
2 1 0 Control DMSO 10
b
7
Relative klotho mRNA
0
6
50
50 Troglitazone (µM)
10
12
24
**
**
5
h
Characterization of the PPRE within the 50 -flanking region of human klotho gene
**
4 3
*
2 1 0
Control DMSO 10 0
25 12
10
25 24
Ciglitazone (µM) h
Figure 1 | TZDs increased klotho expression in a dose- and time-dependent manner. HEK293 cells were treated with control medium, the solvent DMSO, and the TZDs troglitazone (a) or ciglitazone (b) for the indicated time periods. Relative mRNA level of klotho gene was determined by using qRT-PCR and, after normalization with b-actin, expressed as the fold induction in relation to the control. Data represent means±s.e.m. of three independent experiments. *Po0.05, **Po0.01 vs control.
troglitazone and ciglitazone, both being thiazolidinediones (TZDs), at various concentrations for different time periods. Klotho mRNA level was measured by quantitative reversetranscriptase-PCR (qRT-PCR). As shown in Figure 1, both troglitazone and ciglitazone significantly increased the mRNA expression of klotho gene in 293 cells in a timeand dose-dependent manner. To ascertain whether TZDs also induce klotho gene expression in differentiated renal tubular epithelial cells, we further examined the effect of troglitazone in IMCD (inner medullary collecting ducts cells), MCT (proximal tubular epithelial cells),11 and MDCK (distal tubule cells)12,13 cell lines. Northern analysis confirmed that klotho gene was expressed to different extent in all the three cell lines tested, and the expression was similarly induced by troglitazone (Figure 2b). Thiazolidinedione induction of klotho expression was dependent on PPAR-c activation
To examine whether the TZD-induced expression of klotho was mediated by PPAR-g activation, cells were pretreated with a selective PPAR-g antagonist GW9662 (20 mM for 1 h) prior to the incubation with troglitazone. Both qRT-PCR and northern blotting demonstrated that GW9662 blocked the troglitazone-induced increase of klotho mRNA (Figure 2a and b). Similarly, bisphenol-A diglycidyl ether (BADGE), another PPAR-g antagonist, also reduced the induction of Kidney International (2008) 74, 732–739
klotho expression by troglitazone (Figure 2a, lower panel). To further confirm the role of endogenous PPAR-g on the expression of klotho mRNA, the cells were transfected with PPAR-g-specific short interfering RNA (siRNA) or green fluorescence protein (GFP)-siRNA as a control. As shown in Figure 2c, the expression level of the endogenous PPAR-g was reduced by approximately 90% compared with the control siRNA-transfected cells. Knockdown of PPAR-g abrogated the trogilatazone-induced expression of klotho. Taken together, these results suggested that TZD-induced klotho expression was dependent on the activation of endogenous PPAR-g.
Sequence analysis of the 50 -flanking region of human klotho gene revealed no typical binding site for PPARs. However, two noncanonical PPAR-responsive element (PPRE) motifs were found, one at –3698 bp (GAACTCCTGACCT) and the other at 2760 bp (ACTGGATGAAGGA) upstream of the ATG start codon. The binding activities of these regions to PPAR-g were examined by chromatin immunoprecipitation (ChIP) assay, which showed that the region harboring the distal PPRE could be immunoprecipitated by PPAR-g antibody but not the control IgG (Figure 3a), indicating that PPAR-g was able to bind to this region of the klotho gene in 293 cells. To further examine whether the noncanonical PPRE (–3698) motif binds PPAR-g and whether the binding was affected by the PPAR-g ligand, we performed EMSA (electrophoretic mobility shift assay) with the oligonucleotide probe. The results showed that the probe containing the region between 3698 and 3686 bp was shifted by the nuclear proteins. The DNA binding was increased by the troglitazone treatment and abolished by the unlabeled probes (Figure 3b). However, the oligonucleotide probe containing the PPRE-2 (–2760/2746 bp) was not shifted by the nuclear extract (data no showed). In addition, the PPAR-g antibody resulted in a super-shifted band (Figure 3b). Thus, these results indicated that PPAR-g may directly bind to the noncanonical PPRE to activate the klotho gene. To further validate the transcriptional functionality of this noncanonical PPRE, we transfected the luciferase reporterdriven by 2 KL-PPRE into human embryonic kidney (HEK) 293 (HEK293 cells; 293 cell line was used because it has a better transfection efficiency). As shown in Figure 3c, rosiglitazone increased the transcriptional activity of the reporter and the induced activity was abolished in the presence of GW9662. These results indicated that PPAR-g activated klotho expression through a functional cis-element within the klotho gene. Effects of TZDs and PPAR-c antagonist on the expression of klotho gene in vivo
To determine whether klotho is a target gene of PPAR-g in vivo, we have treated C57BL/6 mice with or without troglitazone (200 mg/kg/day) for 3 days and measured the 733
original article
H Zhang et al.: Klotho gene is a PPAR-c target
a
HEK293 DMSO
GW
b
GW+TRO TRO
IMCD
MCT
MDCK
DMSO TRO GW+TRO DMSO TRO GW+TRO DMSO TRO GW+TRO
Klotho
5.2 kb
Klotho
β-Actin
1.8 kb
β-Actin 7
**
HEK293
6
**
6 Relative klotho mRNA
Relative klotho mRNA
7
**
5 4 3 2
*
5 4
**
3
**
0 Troglitazone
–
–
–
+
+
+
DMSO TRO TRO+GW
GW9662
–
+
–
–
+
–
IMCD
BADGE
–
–
+
–
–
+
0
9
100 90 80 70 60 50 40 30 20 10 0
** GFP-siRNA
PPAR-γ-siRNA
DMSO TRO TRO+GW DMSO TRO TRO+GW
MCT
**
8
HEK293 Relative klotho mRNA
Relative PPAR-γ mRNA
**
2 1
1
c
**
MDCK
HEK293
7 6 5 4 3 2 1
0 TRO
–
+
GFP-siRNA
–
+
PPAR-γ-siRNA
Figure 2 | TZD-induced klotho expression is dependent on PPAR-c activation. (a) HEK293 or renal cell lines were treated with or without GW9662 (20 mM) or BADGE (20 mM) for 1 h and exposed to DMSO or troglitazone (50 mM) for 24 h. Total RNA was extracted and subjected to northern blotting (the upper panel) and qRT-PCR (the lower panel). (b) Northern analysis of klotho gene expression in IMCD, MCT, or MDCK cell lines. The bar graph represents the results of scanned densities of three northern blotting experiments using the NIH Image J after normalization with b-actin. (c) HEK293 cells were transfected with siRNA specific for PPAR-g or GFP (40 nM) for 48 h before the exposure to troglitazone or DMSO. Relative mRNA levels of PPAR-g and klotho were determined by using qRT-PCR. *Po0.05; **Po0.01.
klotho expression at both mRNA and protein levels. The qRT-PCR and northern blotting (Figure 4a) showed that the klotho mRNA level was significantly increased in the kidney of troglitazone-treated mice compared with the control group. Similarly, the protein level of klotho was also increased by troglitazone (Figure 4b). To examine whether different PPAR-g agonist elicited the same effect in vivo, mice were also treated with rosiglitazone. The results showed that rosiglitazone at a lower dose (20 mg/kg/day) elicited a similar induction of klotho gene expression in the kidneys. Importantly, treatment with BADGE, a PPAR-g antagonist, significantly reduced the TZD-induced expression, suggesting that PPAR-g activation is required for the klotho induction by TZD in vivo (Figure 4c).
shown by qRT-PCR and western blotting, Ad-PPAR-g but not Ad-GFP infection achieved the overexpression of PPAR-g in mouse kidneys, which subsequently resulted in a marked increase in klotho at mRNA and protein levels. The immunohistochemical studies also demonstrated that intrarenal infection of Ad-PPRA-g induced overexpresion of PPAR-g, which was stained positive in the nuclei for the HA antibody. Klotho expression was clearly induced and predominantly shown as membrane-associated staining (Figure 5c). The sections were stained negative when the primary antibody was omitted (figure not shown). Therefore, the results suggest that PPAR-g activation is sufficient to induce the klotho expression in situ. DISCUSSION
Adenovirus-mediated overexpression of PPAR-c activated the expression of klotho gene in vivo
To further investigate whether PPAR-g activation is sufficient to induce the klotho expression in vivo, a constitutively active PPAR-g was adenovirally infected into the mouse kidney. As 734
In the present study, we have established a novel transcriptional mechanism that controls the expression of klotho, an important anti-aging hormone, by showing that klotho is a target gene of PPAR-g in the cultured kidney cells as well as in mouse kidneys in vivo. This conclusion is supported by both Kidney International (2008) 74, 732–739
original article
b PPRE-1
PPRE-2
Klotho
–2760/–2747
+1
KL
a
TRO – –3698/3686
Input
α-PPAR-γ
AO X KL KL +c KL old +c K L KL old +I N KL gG S +a nt i-P PA R -γ
H Zhang et al.: Klotho gene is a PPAR-c target
+
+
+
+
+
+
IgG
PPRE-1 PPRE-2
***
2 × KL-PPRE-luc activity
c
**
10 9 8 7 6 5 4 3 2 1 0 Control
RO
GW+RO
0
Figure 3 | PPAR-c bound to the PPRE within the 5 -flanking region of klotho gene. (a) The diagram depicts the putative PPRE motifs located in the 50 -flanking region of the human klotho gene. HEK293 cells were coinfected with Ad-PPAR-g and Ad-tTA for 24 h. ChIP assays were performed with the antibodies against PPAR-g or IgG as control. The immunoprecipitates and the positive input control were amplified with the use of specific primer sets spanning the DNA segments containing the putative PPRE-1 and PPRE-2. (b) EMSA was performed by incubating the nuclear extracts from the control or troglitazone-treated cells with the 32P-ATP-labeled probe corresponding to the consensus PPRE (AOX) or the klotho PPRE-1 motif (KL). Cold competition assays were done by adding the unlabeled specific (cold KL) or nonspecific (NS) probe to the binding reactions. Supershift assays were done by adding the control IgG or the PPAR-g antibody. Data shown are representative of at least three independent experiments. Arrow indicates the shifted DNA–protein complex. (c) HEK293 cells transfected with the KL-PPRE-Luc and the b-gal plasmids were treated with DMSO (control) or rosiglitazone (RO, 20 mM) with or without GW9662 (GW, 20 mM). Luciferease activity was normalized to b-gal activity and expressed as fold induction compared with control. Data are mean±s.e.m. of three independent experiments. **Po0.01; ***Po0.01.
the loss-of-function and the gain-of-function approaches: TZD induction of klotho was attenuated in the presence of specific antagonists GW9662 and BADGE both in vitro and in vivo or the knockdown of endogenous PPAR-g by using the specific siRNA; conversely, the pharmacological TZD agonists and the ligand-independent constitutive activation resulted in the induction of klotho. Moreover, we have identified a functional noncanonical PPRE motif within the 50 -flanking region of the klotho gene that is recognized by PPAR-g and may mediate the inductive effect of PPAR-g. A previous study described that administration of troglitazone for 10 weeks significantly reduced systolic blood pressure, plasma glucose, and triglyceride levels, while augmenting endothelium-dependent aortic relaxation and renal klotho mRNA expression in OLETF rats.14 However, it remained unclear whether the augmented expression of klotho mRNA was due to a direct effect of PPAR-g activation or an indirect effect secondary to the improved metabolism. A recent report showed that in 3T3-L1 preadipocytes a TZD agonist, pioglitazone, temporarily increased the klotho mRNA expression and that recombinant klotho protein accelerated adipocyte differentiation, suggesting a link between klotho and adipogenesis.10 Here, our study has Kidney International (2008) 74, 732–739
provided the first evidence for a specific and direct role of PPAR-g in the transcriptional control of klotho gene expression. PPAR-g is a key transcription factor controlling adipogenesis and insulin sensitivity. PPAR-g dimerizes with retinoid X receptor and activates the gene expression by binding to the cognate PPRE within the regulatory region of the target genes. Although there has been no apparent consensus PPRE found within the regulatory region of the klotho gene, noncanonical motifs for PPAR-g have been identified in many PPAR-g target genes.15,16 They are often located at a distal region upstream of the transcription initiative site.17 By using ChIP, gel shift, and supershift assays, we have identified a novel PPRE motif that can be recognized by PPAR-g. Moreover, the reporter assay showed that the noncanonical PPRE is functionally activated by rosiglitazone and the activation is abolished by the PPAR-g antagonist GW0742. These results, taken together, support the concept that klotho is a target gene of PPAR-g. However, the lack of larger segments of the 50 -flanking region upstream of the human and mouse klotho genes limits understanding of the interactive role of this motif with other regulatory elements. 735
original article
H Zhang et al.: Klotho gene is a PPAR-c target
a
b
Troglitazone
Control
Control
Klotho
Klotho
β-Actin
α-Tubulin
Troglitazone
**
10
2.0 Klotho protein level
Klotho mRNA level
12
8 6 4 2
**
1.5 1.0 0.5 0.0
0 Control
Klotho mRNA level
c
Troglitazone
Control
**
10 9 8 7 6 5 4 3 2 1 0
Control
Troglitazone
*
RO
BADGE
BADGE+RO
20
** 15 10 5 0
b
Ad-GFP Klotho
HA-PPAR-γ
α-Tubulin
**
15
c
10
5 0
Ad-GFP
Ad-PPAR-γ
Ad-GFP 12.5
Ad-PPAR-γ Klotho protein level
Relative PPAR-γ mRNA
a
Relative klotho mRNA
Figure 4 | Troglitazone increases the expression of klotho in mouse kidneys. (a) Total RNA was extracted from the kidneys from the control C57bl mice or those treated with troglitazone for 3 days. Expression of klotho mRNA was detected with northern blotting and quantified with qRT-PCR. (b) Protein samples were isolated from the kidney tissues and subjected to western blotting using antibodies against klotho or a-tubulin. The results of immunoblots were scanned, quantified using the NIH image J, and expressed as fold increase compared with the control. Data represent means±s.e.m. of three independent experiments. (c) qRT-PCR was performed with the use of total RNA samples from the control mice and those given rosiglitazone, BADGE, or both for 3 days. There were three animals in each group. *Po0.05, **Po0.01 vs control.
Ad-PPAR-γ
α-HA-PPAR-γ
**
10.0 7.5 5.0 2.5 0.0 Ad-GFP
Ad-PPAR-γ
α-Klotho
Figure 5 | Adenovirus-mediated overexpression of PPAR-c increased the expression of klotho in mouse kidneys. Mice were intra-renally injected with Ad-GFP or Ad-PPAR-g, together with Ad-tTA. Total RNA and protein were extracted 48 h later and subjected to qRT-PCR for the detection of PPAR-g and klotho mRNA (a), or western blotting for klotho, a-tubulin, or the HA tagged to the adenovirally expressed PPAR-g (b). **Po0.01 vs control. (c) Immunohistochemical staining shows that intra-renal overexpression of PPAR-g, as shown by the HA-antibody staining, resulted in an increased expression of klotho protein in situ. Bar ¼ 50 mM. 736
Kidney International (2008) 74, 732–739
original article
H Zhang et al.: Klotho gene is a PPAR-c target
The klotho gene encodes a single-pass transmembrane protein that is detectable in a limited number of tissues including kidney and brain. In kidney, klotho is expressed at a high level in convoluted tubules as well as in other tubular epithelia such as inner medullary collecting duct cells.1,18 Besides using HEK293, we also examined the regulation of klotho by PPAR-g in several other renal cell lines including MDCK, MCT, and IMCD. These cell lines are known to exhibit many features for distal tubules, proximal tubules, and inner medullary collecting ducts, respectively.10–13 In this study, we found that TZDs induce klotho expression both in HEK293 cells and, more importantly, several differentiated renal tissues across a number of species, implying that the PPAR-g induction of renal klotho represents an evolutionarily conserved mechanism and may have an important physiological significance. It has been reported that gene expression of klotho was reduced in patients with chronic renal failure.2 The downregulation of the klotho gene in the kidney could exacerbate ischemic renal failure and of the renal damage induced by angiotensin II.19,20 Moreover, a recent study demonstrated that klotho may serve as a potential renoprotective humoral factor by reducing mitochondrial oxidative stress.21 Up to one-third diabetic patients suffer end-stage renal failure due to diabetic nephropathies. Clinical studies have demonstrated that TZDs ameliorate diabetic nephropathy and many of the favorable effects of TZDs occur through both PPAR-g-dependent and -independent mechanisms.22–24 Given our results that klotho is a renal target of PPAR-g, it is suggested that the upregulation of klotho expression by PPAR-g may contribute to the protective effects of TZDs in renal complications of the type II diabetes. These findings may have important pathophysiological significance. Intriguingly, an interaction between klotho and insulin resistance has been recently uncovered. Koro-o and colleagues found that klotho functions as a humoral factor that signals suppression of intracellular insulin/IGF1 signaling, which may contribute to its anti-aging properties.25,26 Since PPAR-g is an important therapeutic target for the treatment of insulin resistance and type II diabetes, the functional role of klotho regulation by PPAR-g warrants further investigation. In conclusion, our study demonstrates a novel transcriptional mechanism by which the TZD insulin sensitizers regulate the klotho expression. These results suggest an important link between PPAR-g and klotho, the renalderived hormone. MATERIALS AND METHODS Cells and reagents Human embryonic kidney 293, mouse proximal tubular cells (MCT), Madin–Darby canine renal distal tubular cells (MDCK), and inner medullary collecting ducts cells (IMCD) (ATCC, Rockville, MD, USA) were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS). Troglitazone (Parke-Davis Pharmaceuticals, Detroit, MI, USA), ciglitazone, rosiglitazone, Kidney International (2008) 74, 732–739
BADGE, and GW9662 (Cayman Chemical, Ann Arbor, MI, USA) were dissolved in dimethyl sulfoxide (DMSO). RNA analyses Total RNA was isolated from HEK293 cells or mouse kidneys using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For qRT-PCR, cDNA was generated from 2 mg RNA by using Superscript II reverse transcriptase and oligo-dT primer (Invitrogen). PCR reactions were performed with the use of specific primers (Table 1) on Opticon continuous fluorescence detection system (MJ Research Inc., Waltham, MA, USA) with SYBR green fluorescence (Molecular Probes, Eugene, OR, USA). Gene expression was quantified by using the comparative CT method, normalized to b-actin and expressed as fold induction of control. For northern blotting, 20 mg of RNA for each sample was separated on a 1.2% agarose-formaldehyde gel, transferred to nitrocellulose, and hybridized with a-32P-dCTP-labeled cDNA probes for klotho or b-actin.27 Western blotting Protein samples were extracted from mouse kidneys as previously described, with modifications.28 Briefly, mice were killed and the kidneys were homogenized in the homogenizing buffer (0.25 M sucrose, 2 mM EDTA (ethylenediaminetetraacetic acid), 10 mM EGTA (ethyleneglycol tetraacetate), 10 mM 2-mercaptoethanol, and 20 mM Tris-HCl, pH7.5). The homogenates were centrifuged at 12,000 r.p.m. for 10 min at 41C, and the supernatant was centrifuged at 100,000 r.p.m. for 3 h at 41C. The pellets were resuspended in the homogenizing buffer, supplemental with 1% Triton X-100 and 4% CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate). Protein samples were separated on 10% SDS-PAGE
Table 1 | Sequences for primers and probes used Gene
Accession no.
Sequences
Primers for PCR Human klotho
NM_004795
Mouse klotho
NM_013823
Human PPAR-g
NM_138712
b-Actin
EF607093
50 -gcccacatactggatggtatcaa-30 50 -actgcactcagtacacacggtga-30 50 -acaaagaagtggccgagaga-30 50 -cctgactgggagagttgagc-30 50 -tcatggcaattgaatgtcgt-30 50 -ccaacagcttctccttctcg-30 50 -atctggcaccacaccttc-30 50 -agccaggtccagacgca-30
Primers for ChIP assay Klotho PPRE-1 Klotho PPRE-2
50 -gccaccatgttggtgaattt-30 50 -tcacacctgtaatcccagca-30 50 -agtgcatctcctgctccatt-30 50 -cttgctgtgctttgaacagg-30
Probes for EMSAa Consensus PPRE (Aco oxidase) Klotho PPRE-1 Klotho PPRE-2
50 -ggggaccaggacaaaggtcacgttc gggagct-30 50 -ctcgaactcctgaccttag-30 50 -ggcactggatgaaggaatg-30
siRNAa GFP-siRNA PPAR-g-siRNA
50 -ggcuacguccaggagcgcacc-30 50 -gagugggaguggucuuccauu-30
ChIP, chromatin immunoprecipitation, EMSA, electrophoretic mobility shift assay; GFP, green fluorescence protein; PPAR-g, peroxisome proliferator-activated receptor-g; PPRE, PPAR-responsive element; siRNA, small interfering RNA. a Complementary sequences are omitted.
737
original article
(sodium dodecil sulfate-polyacrylamide gel electrophoresis), transferred to nitrocellulose and probed by using a rat monoclonal antibody against klotho (1:1000) or rabbit antibody against a-tubulin, followed by detection with horseradish peroxidaselabeled secondary antibodies and the ECL chemiluminescence kit (Amersham, Piscataway, NJ, USA).29 RNA interference Short interfering RNA specific for GFP, human PPAR-g, or human klotho30 were synthesized (see Table 1 for the sequences), annealed, and transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen) as previously described.31 Chromatin immunoprecipitation and electrophoretic mobility shift assays Cells were coinfected with Ad-PPAR-g, which expresses a mouse PPAR-g1 fused to a minimal VP16 transactivation domain and tagged with an HA-epitope, and Ad-tTA that encodes a tetracyclineresponsive transactivator in the presence or absence of tetracycline (0.1 mg/ml) for 24 h, as previously described.27 For ChIP assays, cells were crosslinked with formaldehyde, and sonicated and immunoprecipitated with the antibody against PPAR-g or control IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The eluted DNA and the input control were detected by PCR amplification (30 cycles) using the specific primer sets spanning the putative PPRE within the 50 -flanking region of the human klotho gene (0ENSG00000133116, see Table 1 for sequences).32 For EMSA, 5 mg of the nuclear extracts were incubated with the [g-32P]ATP-labeled double-strand oligonucleotides and poly (dI-dC) for 30 min on ice, and then resolved on a 4% polyacrylamide gel. The unlabeled probe was included 100 M in excess in cold competition assays.33
H Zhang et al.: Klotho gene is a PPAR-c target
Immunohistochemistry Cryostat sections (6 mm) of frozen kidneys were fixed in 4% paraformaldehyde. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide. Sections were reacted with the primary antibodies against klotho (rat anti-mouse klotho monoclonal antibody; R&D, Minneapolis, MN, USA) or HA (mouse antiHA monoclonal antibody; Sigma-Aldrich, St Louis, MO, USA). After washing, the sections were incubated with secondary antibodies (biotinylated rabbit anti-rat or anti-mouse IgG), and then with avidin–biotin–peroxidase complex (Vector Laboratories, Burlingame, CA, USA). Sections were visualized with diaminobenzidine substrate and counterstained with hematoxylin.34 Statistical analysis Statistical analyses were performed by one-way ANOVA (analysis of variance) or Student t-test. Data are expressed as mean±s.e.m. The P-values less than 0.05 were considered statistically significant. DISCLOSURE
All authors of this paper have nothing to disclose. ACKNOWLEDGMENTS
This study was supported, in part, by the Ministry of Education (PCSIRT) and grants from National Science Foundation of China no. 30470810, 30670848, and 30600231), the Ministry of Science and Technology (2006CB503900 and 2006CB943503). REFERENCES 1. 2.
3.
Promoter–reporter assay To construct the KL-PPRE-luciferase reporter plasmid, we synthesized complementary oligonucleotides containing two repeats of the putative klotho PPRE (the motifs are in italic) (50 -ATAGGTACCG TCTCGAACTCCTGACCTTAGGTGGTCTCGAGTCTCGAACTCTGA CCTTAGGTGGTCTAAGCTTGG-30 ) and flanking sites for KpnI and HindIII. The double strands were annealed and subcloned to pGL3Enhancer (Promega, Madison, WI, USA). The KL-PPRE-Luc plasmid (1 mg/well) was transfected together with the b-galactosidase expression plasmid into subconfluent 293 cells with the use of Lipofectamine 2000 (Invitrogen). Twenty-four hours later, the cells were treated with DMSO, rosiglitazone, or GW9662. Cell lysates were harvested 24 h later to measure luciferase and b-galactosidase activities. Animal experiments Animal protocols were approved by the Peking University Health Science Center, complying with the Guideline for Care and Use of Laboratory Animals. C57BL/6 mice weighting 25–30 g were given troglitazone (200 mg/kg/day), rosiglitazone (20 mg/kg/day), or BADGE (10 mg/kg/day) by oral gavage. Alternatively, intra-renal adenoviral infection was performed under pentobarbital anesthetization. Ad-PPAR-g or Ad-GFP, together with Ad-tTA was injected into kidney at 1 109 PFU. Three days after the troglitazone treatment or the adenoviral infection, the mice were killed and the kidneys were immediately excised to extract the RNA and protein, or frozenembedded in optimum cutting temperature compound for immunohistochemical study. 738
4. 5. 6.
7. 8.
9.
10. 11.
12. 13. 14.
15.
16.
Kuro-o M, Matsumura Y, Aizawa H et al. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997; 390: 45–51. Koh N, Fujimori T, Nishiguchi S et al. Severely reduced production of Klotho in human chronic renal failure kidney. Biochem Biophys Res Com 2001; 280: 1015–1020. Forman BM, Chen J, Evans RM. The peroxisome proliferator-activated receptors: ligands and activators. Ann NY Acad Sci 1996; 804: 266–275. Desvergne B, Wahli W. Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev 1999; 20: 649–688. Guan Y, Zhang Y, Breyer MD. The role of PPARs in the transcriptional control of cellular processes. Drug News Perspect 2002; 15: 147–154. Guan Y, Hao C, Cha DR et al. Thiazolidinediones expand body fluid volume through PPARgamma stimulation of ENaC-mediated renal salt absorption. Nat Med 2005; 11: 861–866. Farmer SR. Regulation of PPARgamma activity during adipogenesis. Int J Obes (Lond) 2005; 29(Suppl 1): S13–S16. Nehlin JO, Mogensen JP, Petterson I et al. Selective PPAR agonists for the treatment of type 2 diabetes. Ann NY Acad Sci 2006; 1067: 448–453. Yamagishi T, Saito Y, Nakamura T et al. Troglitazone improves endothelial function and augments renal klotho mRNA expression in Otsuka Long-Evans Tokushima Fatty (OLETF) rats with multiple atherogenic risk factors. Hypertension Res 2001; 24: 705–709. Chihara Y, Rakugi H, Ishikawa K et al. Klotho protein promotes adipocyte differentiation. Endocrinology 2006; 147: 3835–3842. Haverty TP, Kelly CJ, Hines WH et al. Characterization of a renal tubular epithelial cell line which secretes the autologous target antigen of autoimmune experimental interstitial nephritis. J Cell Biol 1988; 107: 1359–1368. Ng KH, Lim BG, Wong KP. Sulfate conjugating and transport functions of MDCK distal tubular cells. Kidney Int 2003; 63: 976–986. Gaush CR, Hard WL, Smith TF. Characterization of an established line of canine kidney cells (MDCK). Proc Soc Exp Biol Med 1966; 122: 931–935. Yamagishi T, Saito Y, Nakamura T et al. Troglitazone improves endothelial function and augments renal klotho mRNA expression in otsuka long-evans tokushima fatty (OLETF) rats with multiple atherogenic risk factors. Hyperten Res 2001; 24: 705–709. Lemay DG, Hwang DH. Genome-wide identification of peroxisome proliferator response elements using integrated computational genomics. J Lipid Res 2006; 47: 1583–1587. Hevener AL, Olefsky JM, Reichart D et al. Macrophage PPARgamma is required for normal skeletal muscle and hepatic insulin sensitivity and Kidney International (2008) 74, 732–739
original article
H Zhang et al.: Klotho gene is a PPAR-c target
17.
18.
19.
20.
21.
22.
23. 24.
25.
full antidiabetic effects of thiazolidinediones. J Clin Invest 2007; 117: 1658–1669. Degenhardt T, Matilainen M, Herzig KH et al. The insulin-like growth factor-binding protein 1 gene is a primary target of peroxisome proliferator-activated receptors. J Biol Chem 2006; 281: 39607–39619. Mitobe M, Yoshida T, Sugiura H et al. Oxidative stress decreases klotho expression in a mouse kidney cell line. Nephron Exp Nephrol 2005; 101: e67–e74. Sugiura H, Yoshida T, Tsuchiya K et al. Klotho reduces apoptosis in experimental ischaemic acute renal failure. Nephrol Dialysis Transplant 2005; 20: 2636–2645. Negri AL. The klotho gene: a gene predominantly expressed in the kidney is a fundamental regulator of aging and calcium/phosphorus metabolism. J Nephrol 2005; 18: 654–658. Haruna Y, Kashihara N, Satoh M et al. Amelioration of progressive renal injury by genetic manipulation of Klotho gene. Proc Natl Acad Sci USA 2007; 104: 2331–2336. Panchapakesan U, Chen XM, Pollock CA. Drug insight: thiazolidinediones and diabetic nephropathy—relevance to renoprotection. Nat Clin Pract Nephrol 2005; 1: 33–43. Zhang Y, Guan Y. PPAR-gamma agonists and diabetic nephropathy. Curr Diab Rep 2005; 5: 470–475. Guan Y. Peroxisome proliferator-activated receptor family and its relationship to renal complications of the metabolic syndrome. J Am Soc Nephrol 2004; 15: 2801–2815. Kurosu H, Yamamoto M, Clark JD et al. Suppression of aging in mice by the hormone Klotho. Science 2005; 309: 1829–1833.
Kidney International (2008) 74, 732–739
26. 27.
28.
29. 30.
31.
32.
33.
34.
Bartke A. Long-lived Klotho mice: new insights into the roles of IGF-1 and insulin-in aging. Trends Endocrinol Metab 2006; 17: 33–35. Wang N, Verna L, Chen NG et al. Constitutive activation of peroxisome proliferator-activated receptor-gamma suppresses pro-inflammatory adhesion molecules in human vascular endothelial cells. J Biol Chem 2002; 277: 34176–34181. Li SA, Watanabe M, Yamada H et al. Immunohistochemical localization of Klotho protein in brain, kidney, and reproductive organs of mice. Cell Struct Funct 2004; 29: 91–99. Wang N, Verna L, Hardy S et al. c-Jun triggers apoptosis in human vascular endothelial cells. Circ Res 1999; 85: 387–393. de Oliveira RM. Klotho RNAi induces premature senescence of human cells via a p53/p21 dependent pathway. FEBS Lett 2006; 580: 5753–5758. Toyofuku T, Yoshida J, Sugimoto T et al. FARP2 triggers signals for Sema3A-mediated axonal repulsion. Nat Neurosci 2005; 8: 1712–1719. Zhang H, Sun L, Liang J et al. The catalytic subunit of the proteasome is engaged in the entire process of estrogen receptor-regulated transcription. EMBO J 2006; 25: 4223–4233. Wang N, Verna L, Hardy S et al. Adenovirus-mediated overexpression of c-Jun and c-Fos induces intercellular adhesion molecule-1 and monocyte chemoattractant protein-1 in human endothelial cells. Arterioscler Thromb Vasc Biol 1999; 19: 2078–2084. Qin X, Tian J, Zhang P et al. Laminar shear stress up-regulates the expression of stearoyl-CoA desaturase-1 in vascular endothelial cells. Cardiovasc Res 2007; 74: 506–514.
739