- Email: [email protected]
Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-κB signaling pathway
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway Xiao Liang 1, Baoshan Li, Qian Huang, Dan Liu, Houxun Ma* a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 October 2018 Accepted 6 November 2018 Available online xxx
Dexamethasone (DEX) is a commonly used anti-inflammatory drug and an immunosuppressive drug used in clinical practice to treat a variety of diseases. Glucocorticoid-induced osteoporosis (GIOP) is a consequence of high dose, or a long-term low dose use of glucocorticoids (GCs). These treatment regimens can cause a variety of bone-related adverse effects, leading to increased osteoblast and bone cell apoptosis. Evidence suggests that klotho (KL) can inhibit GIOP. It is unknown whether KL attenuates DEXinduced apoptosis in MC3T3-E1 cells or the underlying mechanisms involved. In the present study, we found that MC3T3-E1 cells pretreated with DEX led to the up-regulation of cleaved-caspase-3, and down-regulation of caspase-3, which were inhibited by KL transfection. Furthermore, flow cytometry and western blot analysis revealed that the NFkB inhibitor pyrrolidine dithiocarbamate (PDTC) could restore the DEX-induced caspase-3 decrease and inhibit the DEX-induced cleaved caspase-3 increase. We observed that DEX stimulated the degradation of IkBa(NFkB inhibitor a) and the translocation of NFkB, which were suppressed by KL transfection. These findings therefore, indicate a protective role for KL against osteoblastic cell apoptosis induced by DEX, via the NF-kB signaling pathway. © 2018 Elsevier Inc. All rights reserved.
Keywords: Klotho Dexamethasone Osteoblast NF-kB Caspase-3
1. Introduction Glucocorticoids (GCs) such as dexamethasone are commonly used to treat various diseases such as tumors, inflammation, and autoimmune diseases because of their anti-infective, and immunosuppressive effects. However, high-dose, or long-term low-dose GC treatment may cause bone loss and even reduced bone formation, resulting in osteoporosis and osteonecrosis in a dose and timedependent manner [1e3]. Studies have shown that increased apoptosis of osteoblasts and bone cells in mice and humans after receiving GC therapy, may be associated with the occurrence of osteonecrosis [4]. Pretreatment with DEX can inhibit the proliferation of MC3T3-E1 cells and induce apoptosis [5,6]. However, the specific mechanism of GC-induced osteoblast apoptosis is not yet clear. Klotho (KL) was discovered by Kuro-o et al., which was originally defined as an anti-aging protein because mice deficient in the KL gene underwent premature aging [7,8]. Klotho is widely
* Corresponding author. Department of Geriatrics, First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China. E-mail addresses: [email protected] (X. Liang), [email protected] (B. Li), [email protected] (H. Ma). 1 The author contributed mostly to this work.
expressed in various tissues, and abnormal expression of the KL gene is closely related to the occurrence and development of osteoporosis [9,10]. Results from the human KL gene study demonstrated that in the elderly population, patients with a lower plasma KL concentration are more likely to lose bone mass, which is closely related to a decrease in bone mineral density, and therefore an increased fracture risk [11]. Our previous work has confirmed that in osteoporotic rats, adenoviral transfection with the KL gene, can alleviate the osteoporotic effects and bone microstructure destruction [12]. Although the KL gene has been shown to play an important role in the regulation of osteoporosis, its underlying mechanism of action has not yet been elucidated. The aim of this study was to further investigate the inhibitory effect of KL on DEX-induced apoptosis in MC3T3-E1 osteoblasts, and to elucidate its intrinsic mechanism.
2. Materials and methods The reagents and chemicals used in this study are given below. DEX (Taiji Group Southwest Pharmaceutical, Chongqing,China); aminimal essential medium (a-MEM, HyClone, Logan, UT, USA); fetal bovine serum (FBS, PAN-Biotech GmbH, Germany); pyrrolidine dithiocarbamate (PDTC), Penicillin-Streptomycin Solution, 0.25% trypsin-EDTA (1 X), RIPA lysis buffer, phenylmethylsulfonyl fluoride
https://doi.org/10.1016/j.bbrc.2018.11.040 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
2
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.1. Cell culture and adenovirus transfection
Table 1 Primers used for qRT-PCR analysis. Gene name Caspase-3 GAPDH
Forward primer
Reverse primer
TGTGAGGCGGTTGTAGAAGTT GTGCTGAGTATGTCGTGGAGTCT
GCTGCATCGACATCTGTACC AGTCTTCTGGGTGGCAGTGA
(PMSF), pre-stained protein marker, sodium dodecyl sulfatepolyacrylamide gel (SDS-PAGE) sample loading buffer and diethyl pyrocarbonate, nuclear protein and plasma protein extraction kit (Beyotime Biotechnology Co. Ltd. Shanghai, China); sodium pyruvate (Boster Biological Technology co. Ltd, Wuhan, China); CCK- 8 (Dojindo Molecular Technologies, Inc. Japan); goat anti-rabbit red fluorescent secondary antibody, DAPI, KL, total NF-kB, p65 (Abcam, Abcam, Cambridge, MA, USA); phospho-NF-kB p65, and IkBa (Cell Signaling Technology, Danvers, MA); caspase-3, cleaved caspase-3, b-actin, and PCNA (Wanlei Biotechnology Co. Ltd. Shenyang, China); goat anti-mouse red fluorescent secondary antibody (Zhongshan Golden Bridge Biotechnology Co. Ltd. Beijing, China); TRIzol reagent, SYBR®-green, PrimeScript™ RT reagent kit (Takara, Dalian, China); recombinant adenovirus (AD-KL) and negative control virus (AD-GFP) (Genechem Co. Ltd. Shanghai, China).
The murine osteoblastic cell line MC3T3-E1 was obtained from OBIO Technology Corp. Ltd. (Shanghai, China). MC3T3-E1 osteoblasts were cultured in a-MEM complete medium (containing 10% FBS, 1% sodium pyruvate, 1% penicillin and streptomycin) at 37 C with 5% CO2 and 95% air. Cells in 96-well plates were cultured at a density of 5 103 cells per well and then treated with Ad-KL and Ad-GFP at multiplicity of infection (MOI) values of 60, 80, 100, and 120. Four replicates were used per group. After 24 h, the media containing the virus solution was replaced with conventional media for a further 24 h, and the morphological characteristics of the cells at 24, and 48 h post-transfection were observed under a fluorescent microscope. The number of cells expressing green fluorescence was observed under the 200-fold objective, and the transfection efficiency was calculated and averaged.
2.2. Sample treatments MC3T3-E1 cells were treated with PDTC as previously reported [13]. The first major experimental component were five groups: control group (normal cells), PDTC group (add PDTC to a final
Fig. 1. Transfection of MC3T3-E1 cells with Ad-KL and Ad-GFP, and KL protein expression levels post-transfection. (A) Cells transfected with Ad-GFP and Ad-KL for 24 h and 48 h were observed using Immunofluorescence microscopy (All figures, are magnified 200). (B) The relative expression level of KL protein to b-actin was detected by western blotting and was found to be significantly elevated in the KL transfection group. Data are expressed as mean ± SEM of three independent experiments. **P < 0.01 vs other groups.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 2. Effect of KL on DEX-induced apoptosis in MC3T3-E1 cells. (A) Protein levels of caspase-3 and cleaved caspase-3 obtained by western blot analysis. Quantitative analysis of caspase-3 and cleaved caspase-3 protein expression are shown. (B) The level of caspase-3 mRNA detected by RT-qPCR. (C) After cell treatment, the survival of MC3T3-E1 cells was measured using the CCK8 assay. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ns P > 0.05 vs control.
concentration of 20 mM), DEX group (add DEX to a final concentration of 2 mM), PDTC þ DEX (12 h) group (12 h after DEX treatment, 20 mM of PDTC was added for a further 12 h), and PDTC þ DEX (24 h) group (PDTC and DEX were both added for 24 h). An additional set of experiments also contained five groups: control group (normal cells), GFP group (Ad-GFP added according to optimal MOI value ¼ 100), KL group (Ad-KL added according to optimal MOI value ¼ 100), DEX group (add DEX with a final concentration of 2 mM), KL þ DEX group (first add KL using an MOI value of 100 for 24 h, then add DEX for 24 h). 2.3. Cell viability measurement using the CCK-8 assay According to the experimental design requirements, cells from the control group, GFP group, KL group, DEX group, and KL þ DEX group were cultured in 96-well plates, and treated according to our experimental design. The relative cell survival rate was determined at the end of the experiment. 2.4. Analysis of apoptosis rate by flow cytometry At the end of the experiment, cells were digested, collected, and washed twice with pre-cooled PBS, and the supernatant discarded. Cells were then processed according to the instructions from the Annexin V-FITC/PI double staining kit. Apoptotic cells were confirmed by flow cytometry and the apoptotic rate was analyzed by CYTExpert software. 2.5. Quantitative real-time polymerase chain reaction (qRT-PCR) Cellular
total
mRNA
was
extracted
according
to
the
Trizolreagent instructions. RNA sample was reverse transcribed into cDNA by using PrimeScript RT reagent Kit. The relative expression levels of caspase-3 mRNA were calculated using GAPDH as an internal reference. In this experiment, all primers were synthesized by Takara Dalian China (Table 1). 2.6. Western blot analysis Cells from each experimental group were cultured as described above, and the cell were lysed with ice cold RIPA buffer (1% PMSF) and total protein extracted. The protein concentration was measured using a BCA assay kit. The protein (30e50 mg) from each group was separated by SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (PVDF, Merck-Millipore, Darmstadt, Germany). After blocked with QuickBlock™ western blocking solution (Beyotime Biotechnology Co. Ltd. Shanghai, China) for 10 min, the membranes were then incubated with corresponding primary antibodies: KL, NF-kB p65, phosphorylated NF-kB p65, IkBa, caspase-3, cleaved caspase-3, PCNA, and b-actin overnight at 4 C, followed by incubation with the appropriate secondary antibody for 1 h at 37 C. Chemiluminescent detection was performed using a hypersensitive ECL chemiluminescence kit, and intensity of the bands was analyzed using Fusion software. 2.7. Immunofluorescence microscopy Cells were seeded into 24-well plates at a density of 1.5 104 cells per well and treated. After fixing with paraformaldehyde for 15 min, the cells were washed and treated with Triton for 10 min, they were then washed again with ice PBS a further three times. Goat serum was added to each well and placed
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
4
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
at 37 C for 1 h. After the blocking solution was aspirated, 30 mL of NF-kB p65 and IkBa primary antibody (1:150 dilution) was added at 4 C overnight. The red fluorescent secondary antibody was added and incubated in the dark for 1 h, followed by DAPI treatment, and the addition of an anti-quenching agent. Cells were then observed, and pictures collected using a Laser scanning confocal microscopy (LSCM). 2.8. Statistical analysis Data were analyzed using SPSS 22.0 software and expressed as means ± SEM Sample means were compared using one-way ANOVA. P values < 0.05 were considered statistically significant. 3. Results 3.1. Transfection of MC3T3-E1 osteoblasts by Ad-KL and Ad-GFP We found only a small number of transfected cells after 24 h of transfection. However, after 48 h post-transfection, there was an elevated number of transduced cells as well as the increasing MOI value. At a MOI value of 100, the number of transfected Ad-KL and Ad-GFP cells was greater than 90%, and the cells remained in good condition (Fig. 1A). In addition, Fig. 1B shows that the level of the KL
protein was significantly up-regulated in MC3T3-E1 cells transfected with Ad-KL compared to the other groups (P < 0.01). These results demonstrate that Ad-KL was successfully transfected into MC3T3-E1 osteoblasts and that this protein can be highly expressed in these cells.
3.2. Effect of KL transfection on DEX-induced apoptosis in MC3T3E1 cells Caspase-3 and cleaved caspase-3 are considered to be a common downstream effector of diverse apoptotic pathways. Therefore, we used the western blot assay to detect DEX-induced apoptosis by measuring the protein expression of caspase-3 and cleaved caspase-3 (Fig. 2A). Caspase-3 expression decreased by 53% (P < 0.05) and cleaved caspase-3 levels increased by 2.87-fold (P < 0.05) after DEX treatment, which restored by KL transfection (Fig. 2A). Furthermore, we measured the expression of caspase-3 mRNA using RT-qPCR, and found that the level of caspase-3 mRNA in the DEX treated group was significantly higher than the control group (Fig. 2B). Pretreatment with KL decreased the expression of caspase-3 mRNA by 47.9% compared to DEX alone (P < 0.05) (Fig. 2B). However, exposure of MC3T3-E1 cells to GFP did not modify the level of caspase-3 mRNA or protein expression (P > 0.05). Additionally, we also further tested cell viability in each
Fig. 3. Involvement of the NF-kB in DEX-induced MC3T3-E1 cells apoptosis. (A) Protein levels of caspase-3 and cleaved caspase-3 were determined by western blot analysis. Quantitative analysis of caspase-3 and cleaved caspase-3 protein expression is shown. (B) The expression level of caspase-3 mRNA was detected by RT-qPCR. (C, D) After Annexin VFITC/PI double staining, the extent of apoptosis for each group was detected by flow cytometry. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ns P > 0.05 vs control.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Effect of KL on the DEX-induced degradation of IkBa and the phosphorylation and translocation of NF-kB p65 in MC3T3-E1 cells. (A, C) After each group had been exposed to the indicated treatments, IkBa and P-p65 protein expression was detected by western blot analysis. (B, D) IkBa protein expression and NF-kB p65 nuclear translocation were detected using LSCM. (E) Protein levels of cleaved caspase-3 were obtained by western blot analysis. Quantitative analysis of cleaved caspase-3 protein expression is shown. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ##P < 0.01 vs DEX. :P < 0.05 vs DEX. ns P > 0.05 vs control.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
6
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
treatment group. Fig. 2C demonstrates that the cell viability of the KL group was not significantly different from that of the control group, or GFP group. Whereas pretreatment with DEX reduced cell viability by 45% when compared to the control group (P < 0.01), and the group treated with DEX alone. The KL þ DEX group significantly increased cell viability by 30% (P < 0.05). Taken together, our data suggest that KL can attenuate DEX-induced apoptosis in MC3T3-E1 osteoblastic cells. 3.3. Involvement of the NF-kB in DEX-induced MC3T3-E1 cells apoptosis It has been documented that NF-kB plays the critical role in inflammatory reaction and apoptosis [14,15]. Therefore, to investigate whether the NF-kB signaling pathway is involved in DEXinduced osteoblast apoptosis, we pretreated MC3T3-E1 cells with the NF-kB inhibitor pyrrolidine dithiocarbamate (PDTC) (Fig. 3A). PDTC significantly restored 62.5% of the DEX-induced decrease in caspase-3 levels and inhibited 72% of the DEX-induced increase in cleaved caspase-3 (P < 0.05). At the same time, we found that pretreatment with PDTC decreased the expression of caspase-3 mRNA by 55.1% (P < 0.05) compared to DEX alone (Fig. 3B). Furthermore, we also investigated the effect of PDTC on DEXinduced apoptosis by flow cytometry. As shown in Fig. 3C and D, untreated MC3T3-E1 cells were used as controls. Here we found that DEX significantly induced cell apoptosis. However, PDTC could significantly attenuate this effect (51.95% vs. 21.83%, P < 0.05). Taken together, these results suggest that DEX-induced apoptosis is in part due to NF-kB activation in MC3T3-E1 cells. 3.4. Effect of KL on DEX-induced activation of NF-kB in MC3T3-E1 cells NF-kB exists in the cytoplasm in an inactive form, which is bound to its biological inhibitor IkB. IkBa plays a major role in the activation of the NF-kB pathway. Upon activation of NF-kB, IkBa rapidly phosphorylates and degrades to form the IkBa-NFkB complex, followed by the release of p65, as well as its phosphorylation and translocation to the nucleus [13,16,17]. To investigate a role for KL in the inhibition of DEX-induced NF-kB activation, we measured the protein levels of IkBa and P-p65 as indicators of the NF-kB pathway activity. The IkBa protein levels measured by western blot were decreased by 71.4% following DEX treatment (P < 0.01). However, KL restored this DEX-induced IkBa protein degradation by 60% (P < 0.05) (Fig. 4A). Immunofluorescence results showed that the intensity of IkBa fluorescence was significantly decreased in DEX-induced MC3T3-E1 osteoblasts, whereas the intensity of IkBa fluorescence after pre-treatment with KL was significantly increased (Fig. 4B). P-p65 protein levels increased by 1.91-fold (P < 0.05) after DEX treatment, which was inhibited by 40% with KL transfection (P < 0.01) (Fig. 4C). Consistently, DEX treatment induced a dramatic increase in the translocation of NF-kB p65 into the nucleus by immunofluorescence (Fig. 4D). In contrast, the DEXinduced translocation of this complex was markedly inhibited by KL (Fig. 4D). By western blot analysis, it was found that after PDTC pretreatment of the DEX-induced osteoblasts, the level of cleaved caspase-3 protein expression was reduced by 50.7% compared with that of the DEX treatment group alone (P < 0.05) (Fig. 4E). Meanwhile, treatment of osteoblasts induced by DEX with KL reduced the cleaved caspase-3 protein by 73.3% compared to the DEX treated cell (P < 0.05). This indicates that the inhibition of DEXinduced MC3T3-E1 apoptosis by KL is at least, partly dependent upon the NF-kB pathway.
4. Discussion Glucocorticoid-induced osteoporosis (GIOP) is the most common type of secondary osteoporosis. GCs at physiological concentrations are essential for the natural development of bone, whereas high doses can cause osteoporosis [18]. Excessive GCs can also induce apoptosis of osteoblasts and osteocytes by increasing proapoptotic factors and reactive oxygen species [19]. The present study has demonstrated that GCs such as DEX mainly promote the apoptosis of osteoblasts and osteocytes resulting in osteoporosis. This process principally causes a reduction in bone strength and quality through activation of pro-apoptotic caspase family members [20] and influencing the Wnt signal pathway [21]. Consistent with our previous work [22], this study confirmed the DEX-induced apoptosis of MC3T3-E1 osteoblasts. P65 is the most critical transcription factor among the NF-kB family members and plays an important role in inflammation and apoptosis [23]. Studies have shown that NF-kB overexpression can promote apoptosis of vascular smooth muscle cells and inhibit cell proliferation [24]. NFkB inhibition can lead to osteoblast differentiation and bone enhancement [25]. Previous study showed that activation of NF-kB by palmitate led to apoptosis of MC3T3-E1 osteoblasts [26]. We further found that the NF-kB inhibitor PDTC reduced the number of apoptotic cells and attenuated the activity of caspase-3 induced by DEX, suggesting the involvement of NF-kB in DEX-induced MC3T3E1 apoptosis. Other studies have shown that the activity of high dose GC-treated osteoclasts can be increased by the activation of NF-k B [27]. These results indicate that activation of NF-kB might participate the pathological process of DEX-induced osteoporosis by affecting both osteoblast and osteoclasts. Klotho protein is a transmembrane protein encoded by the KL gene. Besides its anti-aging properties, KL can also inhibit oxidative stress, promote angiogenesis and regulate bone mineral density [28]. It has been shown that osteoporosis occurs in mice lacking the KL gene [29]. The lack of KL gene affects the function and number of osteoblasts, therefore interfering with bone mineralization [30]. Recent study indicated that KL can inhibit the degradation of IkB and activation of nuclear NFkB [31]. In this current study, PDTC simultaneously inhibited caspase-3 activation and DEX-induced MC3T3-E1 apoptosis. Similarly, we found that besides the inhibition of NF-kB activation, KL also reduced DEX-induced caspase-3 expression, in consistent with previous studies. This experimental study also found that KL was capable of inhibiting DEX-induced MC3T3-E1 apoptosis and reduced caspase-3 expression simultaneously by inhibiting the DEX-induced degradation of IkB, nuclear translocation of NF-kB p65, and phosphorylation of p65. These results indicate that the anti-apoptotic effect of KL and pro-apoptotic effect of DEX might be mediated by NF-kB activation. Therefore, KL can inhibit DEX-induced MC3T3-E1 apoptosis as well as the expression of caspase-3 through the NF-kB pathway. In conclusion, we have demonstrated that KL can inhibit the apoptosis of MC3T3-E1 osteoblasts induced by DEX via partially inhibiting the NF-kB pathway. However, whether the other signaling components involve in the protective action of KL requires further research. Taken together, these findings suggest that KL might serve as a novel candidate for the prevention, and treatment of GIOP.
Acknowledgements We thank the Laboratory Research Center of the First Affiliated Hospital of Chongqing Medical University for technical support.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.11.040. Conflicts of interest The authors declare that they have no competing interests. Funding This work was supported by the General Program of National Natural Science Foundation of China (Grant No. 30672212)/Medical Science Research Project of Chongqing Health and Family Planning Commission, China (NO. 2016MSXM080)/Science and Technology Planning Project of Yuzhong District of Chongqing, China (NO. 20150139). References [1] S. Li, H. Jiang, X. Gu, Echinacoside suppresses dexamethasone-induced growth inhibition and apoptosis in osteoblastic MC3T3-E1 cells, Exp. Therapeut. Med. 16 (2) (2018) 643e648. [2] D.U. Debby, I.E.M. Bultink, W.F. Lems, Advances in glucocorticoid-induced osteoporosis, Curr. Rheumatol. Rep. 13 (3) (2011) 233e240. [3] H. Lin, X. Gao, G. Chen, et al., Indole-3-carbinol as inhibitors of glucocorticoidinduced apoptosis in osteoblastic cells through blocking ROS-mediated Nrf2 pathway, Biochem. Biophys. Res. Commun. 460 (2) (2015) 422e427. [4] R.S. Weinstein, R.W. Nicholas, S.C. Manolagas, Apoptosis of osteocytes in glucocorticoid-induced osteonecrosis of the hip, J. Bone Miner. Res. Offic. J. Am. Soc. Bone Miner. Res. 15 (4) (2010) 754e762. [5] H. Li, W. Qian, X. Weng, et al., Glucocorticoid receptor and sequential P53 activation by dexamethasone mediates apoptosis and cell cycle arrest of osteoblastic MC3T3-E1 cells, U.S. Chin. Int. J. Traumat. 7 (1) (2012) 1e8. [6] C.C. Chua, B.H. Chua, Z. Chen, et al., Dexamethasone induces caspase activation in murine osteoblastic MC3T3-E1 cells, BBA - Molecular Cell Research 1642 (1e2) (2003) 79e85. [7] B. Richter, C. Faul, FGF23 actions on target tissues-with and without klotho, Front. Endocrinol. 9 (2018). [8] D.A. Zhou, H.X. Zheng, C.W. Wang, et al., Influence of glucocorticoids on the osteogenic differentiation of rat bone marrow-derived mesenchymal stem cells, BMC Muscoskel. Disord. 15 (1) (2014) 239, 15,1(2014-07-15). [9] H. Kawaguchi, Molecular backgrounds of age-related osteoporosis from mouse genetics approaches, Rev. Endocr. Metab. Disord. 7 (1e2) (2006) 17. [10] T. Yamashita, A. Nifuji, K. Furuya, et al., Elongation of the epiphyseal trabecular bone in transgenic mice carrying a klotho gene locus mutation that leads to a syndrome resembling aging, J. Endocrinol. 159 (1) (1998) 1. [11] D. Chalhoub, E. Marques, O. Meirelles, et al., Association of serum klotho with loss of bone mineral density and fracture risk in older adults, J. Am. Geriatr. Soc. 64 (12) (2016) 304e308. [12] Y.J. Wang, H.X. Ma, B.S. Li, et al., Effects of adeno-associated virus-mediated
[13]
[14]
[15]
[16] [17] [18]
[19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28] [29]
[30]
[31]
7
klotho gene delivery on the expression of Runx2 and MMP-13 gene in the bone of the ovariectomy rats, Basic Med Sci Clin 32 (5) (2012) 487e492 (in Chinese). X. Zhong, L. Xiu, G. Wei, et al., Bezafibrate prevents palmitate-induced apoptosis in osteoblastic MC3T3-E1 cells through the NF-kB signaling pathway, Int. J. Mol. Med. 28 (4) (2011) 535e542. C. Ward, E.R. Chilvers, M.F. Lawson, et al., NF-kB activation is a critical regulator of human granulocyte apoptosis in vitro, J. Biol. Chem. 274 (7) (1999) 4309e4318. M. Rashidi, E. Bandalasanchez, K.E. Lawlor, et al., CD52 inhibits Toll-like receptor activation of NF-kB and triggers apoptosis to suppress inflammation, Cell Death Differ. 25 (2) (2018) 392. S.C. Sun, Non-canonical NF-^IºB signaling pathway, Cell Res. 21 (1) (2011) 71e85. M.A.D.L. Rosa, I. Diazcm Oreno, J. Guinovart, Role of disorder in IkB-NFkB interaction, IUBMB Life 64 (6) (2012) 499e505. R. Kalak, H. Zhou, J. Street, et al., Endogenous glucocorticoid signalling in osteoblasts is necessary to maintain normal bone structure in mice, Bone 45 (1) (2009) 61e67. T. Komori, Glucocorticoid signaling and bone biology, Horm. Metab. Res. 48 (11) (2016) 755e763. Y. Liu, A. Porta, X. Peng, et al., Prevention of glucocorticoid-induced apoptosis in osteocytes and osteoblasts by calbindin-D28k, J. Bone Miner. Res. 19 (3) (2010) 479e490. S.I. Yun, H.Y. Yoon, S.Y. Jeong, et al., Glucocorticoid induces apoptosis of osteoblast cells through the activation of glycogen synthase kinase 3b, J. Bone Miner. Metabol. 27 (2) (2009) 140e148. H. Lin, B. Wei, G. Li, et al., Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway, Drug Des. Dev. Ther. 2014 (default) (2014) 973. F. Zhou, X. Huang, Y. Pan, et al., Resveratrol protects HaCaT cells from ultraviolet B-induced photoaging via upregulation of HSP27 and modulation of mitochondrial caspase-dependent apoptotic pathway, Biochem. Biophys. Res. Commun. 499 (3) (2018). L. Jiao, M. Jiang, J. Liu, et al., Nuclear factor-kappa B activation inhibits proliferation and promotes apoptosis of vascular smooth muscle cells, Vascular (3) (2018), 170853811878712. A. Rauch, S. Seitz, U. Baschant, et al., Glucocorticoids suppress bone formation by attenuating osteoblast differentiation via the monomeric glucocorticoid receptor, Cell Metabol. 11 (6) (2010) 517e531. J.W. Gu, E. Young, B. Busby, et al., Oral administration of pyrrolidine dithiocarbamate (PDTC) inhibits VEGF expression, tumor angiogenesis, and growth of breast cancer in female mice, Cancer Biol. Ther. 8 (6) (2009) 514e521. Y. Hachemi, A. Rapp, A.K. Picke, et al., Molecular mechanisms of glucocorticoids on skeleton and regeneration after fracture, J. Mol. Endocrinol. 61 (1) (2018). JME-18-0024. P. Buendía, R. Ramírez, P. Aljama, et al., Klotho prevents translocation of NFkB, Vitam. Horm.-Adv. Res. Appl. 101 (2016) 119e150. M. Kuroo, Klotho as a regulator of fibroblast growth factor signaling and phosphate/calcium metabolism, Curr. Opin. Nephrol. Hypertens. 15 (4) (2006) 437. S. Zheng, Y. Chen, Y. Zheng, et al., Correlation of serum levels of fibroblast growth factor 23 and Klotho protein levels with bone mineral density in maintenance hemodialysis patients, Eur. J. Med. Res. 23 (1) (2018) 18. P. Buendía, R. Ramírez, P. Aljama, et al., Klotho prevents translocation of NFkB, Vitam. Horm.-Adv. Res. Appl. 101 (2016) 119e150.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway Xiao Liang 1, Baoshan Li, Qian Huang, Dan Liu, Houxun Ma* a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 October 2018 Accepted 6 November 2018 Available online xxx
Dexamethasone (DEX) is a commonly used anti-inflammatory drug and an immunosuppressive drug used in clinical practice to treat a variety of diseases. Glucocorticoid-induced osteoporosis (GIOP) is a consequence of high dose, or a long-term low dose use of glucocorticoids (GCs). These treatment regimens can cause a variety of bone-related adverse effects, leading to increased osteoblast and bone cell apoptosis. Evidence suggests that klotho (KL) can inhibit GIOP. It is unknown whether KL attenuates DEXinduced apoptosis in MC3T3-E1 cells or the underlying mechanisms involved. In the present study, we found that MC3T3-E1 cells pretreated with DEX led to the up-regulation of cleaved-caspase-3, and down-regulation of caspase-3, which were inhibited by KL transfection. Furthermore, flow cytometry and western blot analysis revealed that the NFkB inhibitor pyrrolidine dithiocarbamate (PDTC) could restore the DEX-induced caspase-3 decrease and inhibit the DEX-induced cleaved caspase-3 increase. We observed that DEX stimulated the degradation of IkBa(NFkB inhibitor a) and the translocation of NFkB, which were suppressed by KL transfection. These findings therefore, indicate a protective role for KL against osteoblastic cell apoptosis induced by DEX, via the NF-kB signaling pathway. © 2018 Elsevier Inc. All rights reserved.
Keywords: Klotho Dexamethasone Osteoblast NF-kB Caspase-3
1. Introduction Glucocorticoids (GCs) such as dexamethasone are commonly used to treat various diseases such as tumors, inflammation, and autoimmune diseases because of their anti-infective, and immunosuppressive effects. However, high-dose, or long-term low-dose GC treatment may cause bone loss and even reduced bone formation, resulting in osteoporosis and osteonecrosis in a dose and timedependent manner [1e3]. Studies have shown that increased apoptosis of osteoblasts and bone cells in mice and humans after receiving GC therapy, may be associated with the occurrence of osteonecrosis [4]. Pretreatment with DEX can inhibit the proliferation of MC3T3-E1 cells and induce apoptosis [5,6]. However, the specific mechanism of GC-induced osteoblast apoptosis is not yet clear. Klotho (KL) was discovered by Kuro-o et al., which was originally defined as an anti-aging protein because mice deficient in the KL gene underwent premature aging [7,8]. Klotho is widely
* Corresponding author. Department of Geriatrics, First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China. E-mail addresses: [email protected] (X. Liang), [email protected] (B. Li), [email protected] (H. Ma). 1 The author contributed mostly to this work.
expressed in various tissues, and abnormal expression of the KL gene is closely related to the occurrence and development of osteoporosis [9,10]. Results from the human KL gene study demonstrated that in the elderly population, patients with a lower plasma KL concentration are more likely to lose bone mass, which is closely related to a decrease in bone mineral density, and therefore an increased fracture risk [11]. Our previous work has confirmed that in osteoporotic rats, adenoviral transfection with the KL gene, can alleviate the osteoporotic effects and bone microstructure destruction [12]. Although the KL gene has been shown to play an important role in the regulation of osteoporosis, its underlying mechanism of action has not yet been elucidated. The aim of this study was to further investigate the inhibitory effect of KL on DEX-induced apoptosis in MC3T3-E1 osteoblasts, and to elucidate its intrinsic mechanism.
2. Materials and methods The reagents and chemicals used in this study are given below. DEX (Taiji Group Southwest Pharmaceutical, Chongqing,China); aminimal essential medium (a-MEM, HyClone, Logan, UT, USA); fetal bovine serum (FBS, PAN-Biotech GmbH, Germany); pyrrolidine dithiocarbamate (PDTC), Penicillin-Streptomycin Solution, 0.25% trypsin-EDTA (1 X), RIPA lysis buffer, phenylmethylsulfonyl fluoride
https://doi.org/10.1016/j.bbrc.2018.11.040 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
2
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.1. Cell culture and adenovirus transfection
Table 1 Primers used for qRT-PCR analysis. Gene name Caspase-3 GAPDH
Forward primer
Reverse primer
TGTGAGGCGGTTGTAGAAGTT GTGCTGAGTATGTCGTGGAGTCT
GCTGCATCGACATCTGTACC AGTCTTCTGGGTGGCAGTGA
(PMSF), pre-stained protein marker, sodium dodecyl sulfatepolyacrylamide gel (SDS-PAGE) sample loading buffer and diethyl pyrocarbonate, nuclear protein and plasma protein extraction kit (Beyotime Biotechnology Co. Ltd. Shanghai, China); sodium pyruvate (Boster Biological Technology co. Ltd, Wuhan, China); CCK- 8 (Dojindo Molecular Technologies, Inc. Japan); goat anti-rabbit red fluorescent secondary antibody, DAPI, KL, total NF-kB, p65 (Abcam, Abcam, Cambridge, MA, USA); phospho-NF-kB p65, and IkBa (Cell Signaling Technology, Danvers, MA); caspase-3, cleaved caspase-3, b-actin, and PCNA (Wanlei Biotechnology Co. Ltd. Shenyang, China); goat anti-mouse red fluorescent secondary antibody (Zhongshan Golden Bridge Biotechnology Co. Ltd. Beijing, China); TRIzol reagent, SYBR®-green, PrimeScript™ RT reagent kit (Takara, Dalian, China); recombinant adenovirus (AD-KL) and negative control virus (AD-GFP) (Genechem Co. Ltd. Shanghai, China).
The murine osteoblastic cell line MC3T3-E1 was obtained from OBIO Technology Corp. Ltd. (Shanghai, China). MC3T3-E1 osteoblasts were cultured in a-MEM complete medium (containing 10% FBS, 1% sodium pyruvate, 1% penicillin and streptomycin) at 37 C with 5% CO2 and 95% air. Cells in 96-well plates were cultured at a density of 5 103 cells per well and then treated with Ad-KL and Ad-GFP at multiplicity of infection (MOI) values of 60, 80, 100, and 120. Four replicates were used per group. After 24 h, the media containing the virus solution was replaced with conventional media for a further 24 h, and the morphological characteristics of the cells at 24, and 48 h post-transfection were observed under a fluorescent microscope. The number of cells expressing green fluorescence was observed under the 200-fold objective, and the transfection efficiency was calculated and averaged.
2.2. Sample treatments MC3T3-E1 cells were treated with PDTC as previously reported [13]. The first major experimental component were five groups: control group (normal cells), PDTC group (add PDTC to a final
Fig. 1. Transfection of MC3T3-E1 cells with Ad-KL and Ad-GFP, and KL protein expression levels post-transfection. (A) Cells transfected with Ad-GFP and Ad-KL for 24 h and 48 h were observed using Immunofluorescence microscopy (All figures, are magnified 200). (B) The relative expression level of KL protein to b-actin was detected by western blotting and was found to be significantly elevated in the KL transfection group. Data are expressed as mean ± SEM of three independent experiments. **P < 0.01 vs other groups.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 2. Effect of KL on DEX-induced apoptosis in MC3T3-E1 cells. (A) Protein levels of caspase-3 and cleaved caspase-3 obtained by western blot analysis. Quantitative analysis of caspase-3 and cleaved caspase-3 protein expression are shown. (B) The level of caspase-3 mRNA detected by RT-qPCR. (C) After cell treatment, the survival of MC3T3-E1 cells was measured using the CCK8 assay. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ns P > 0.05 vs control.
concentration of 20 mM), DEX group (add DEX to a final concentration of 2 mM), PDTC þ DEX (12 h) group (12 h after DEX treatment, 20 mM of PDTC was added for a further 12 h), and PDTC þ DEX (24 h) group (PDTC and DEX were both added for 24 h). An additional set of experiments also contained five groups: control group (normal cells), GFP group (Ad-GFP added according to optimal MOI value ¼ 100), KL group (Ad-KL added according to optimal MOI value ¼ 100), DEX group (add DEX with a final concentration of 2 mM), KL þ DEX group (first add KL using an MOI value of 100 for 24 h, then add DEX for 24 h). 2.3. Cell viability measurement using the CCK-8 assay According to the experimental design requirements, cells from the control group, GFP group, KL group, DEX group, and KL þ DEX group were cultured in 96-well plates, and treated according to our experimental design. The relative cell survival rate was determined at the end of the experiment. 2.4. Analysis of apoptosis rate by flow cytometry At the end of the experiment, cells were digested, collected, and washed twice with pre-cooled PBS, and the supernatant discarded. Cells were then processed according to the instructions from the Annexin V-FITC/PI double staining kit. Apoptotic cells were confirmed by flow cytometry and the apoptotic rate was analyzed by CYTExpert software. 2.5. Quantitative real-time polymerase chain reaction (qRT-PCR) Cellular
total
mRNA
was
extracted
according
to
the
Trizolreagent instructions. RNA sample was reverse transcribed into cDNA by using PrimeScript RT reagent Kit. The relative expression levels of caspase-3 mRNA were calculated using GAPDH as an internal reference. In this experiment, all primers were synthesized by Takara Dalian China (Table 1). 2.6. Western blot analysis Cells from each experimental group were cultured as described above, and the cell were lysed with ice cold RIPA buffer (1% PMSF) and total protein extracted. The protein concentration was measured using a BCA assay kit. The protein (30e50 mg) from each group was separated by SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (PVDF, Merck-Millipore, Darmstadt, Germany). After blocked with QuickBlock™ western blocking solution (Beyotime Biotechnology Co. Ltd. Shanghai, China) for 10 min, the membranes were then incubated with corresponding primary antibodies: KL, NF-kB p65, phosphorylated NF-kB p65, IkBa, caspase-3, cleaved caspase-3, PCNA, and b-actin overnight at 4 C, followed by incubation with the appropriate secondary antibody for 1 h at 37 C. Chemiluminescent detection was performed using a hypersensitive ECL chemiluminescence kit, and intensity of the bands was analyzed using Fusion software. 2.7. Immunofluorescence microscopy Cells were seeded into 24-well plates at a density of 1.5 104 cells per well and treated. After fixing with paraformaldehyde for 15 min, the cells were washed and treated with Triton for 10 min, they were then washed again with ice PBS a further three times. Goat serum was added to each well and placed
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
4
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
at 37 C for 1 h. After the blocking solution was aspirated, 30 mL of NF-kB p65 and IkBa primary antibody (1:150 dilution) was added at 4 C overnight. The red fluorescent secondary antibody was added and incubated in the dark for 1 h, followed by DAPI treatment, and the addition of an anti-quenching agent. Cells were then observed, and pictures collected using a Laser scanning confocal microscopy (LSCM). 2.8. Statistical analysis Data were analyzed using SPSS 22.0 software and expressed as means ± SEM Sample means were compared using one-way ANOVA. P values < 0.05 were considered statistically significant. 3. Results 3.1. Transfection of MC3T3-E1 osteoblasts by Ad-KL and Ad-GFP We found only a small number of transfected cells after 24 h of transfection. However, after 48 h post-transfection, there was an elevated number of transduced cells as well as the increasing MOI value. At a MOI value of 100, the number of transfected Ad-KL and Ad-GFP cells was greater than 90%, and the cells remained in good condition (Fig. 1A). In addition, Fig. 1B shows that the level of the KL
protein was significantly up-regulated in MC3T3-E1 cells transfected with Ad-KL compared to the other groups (P < 0.01). These results demonstrate that Ad-KL was successfully transfected into MC3T3-E1 osteoblasts and that this protein can be highly expressed in these cells.
3.2. Effect of KL transfection on DEX-induced apoptosis in MC3T3E1 cells Caspase-3 and cleaved caspase-3 are considered to be a common downstream effector of diverse apoptotic pathways. Therefore, we used the western blot assay to detect DEX-induced apoptosis by measuring the protein expression of caspase-3 and cleaved caspase-3 (Fig. 2A). Caspase-3 expression decreased by 53% (P < 0.05) and cleaved caspase-3 levels increased by 2.87-fold (P < 0.05) after DEX treatment, which restored by KL transfection (Fig. 2A). Furthermore, we measured the expression of caspase-3 mRNA using RT-qPCR, and found that the level of caspase-3 mRNA in the DEX treated group was significantly higher than the control group (Fig. 2B). Pretreatment with KL decreased the expression of caspase-3 mRNA by 47.9% compared to DEX alone (P < 0.05) (Fig. 2B). However, exposure of MC3T3-E1 cells to GFP did not modify the level of caspase-3 mRNA or protein expression (P > 0.05). Additionally, we also further tested cell viability in each
Fig. 3. Involvement of the NF-kB in DEX-induced MC3T3-E1 cells apoptosis. (A) Protein levels of caspase-3 and cleaved caspase-3 were determined by western blot analysis. Quantitative analysis of caspase-3 and cleaved caspase-3 protein expression is shown. (B) The expression level of caspase-3 mRNA was detected by RT-qPCR. (C, D) After Annexin VFITC/PI double staining, the extent of apoptosis for each group was detected by flow cytometry. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ns P > 0.05 vs control.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Effect of KL on the DEX-induced degradation of IkBa and the phosphorylation and translocation of NF-kB p65 in MC3T3-E1 cells. (A, C) After each group had been exposed to the indicated treatments, IkBa and P-p65 protein expression was detected by western blot analysis. (B, D) IkBa protein expression and NF-kB p65 nuclear translocation were detected using LSCM. (E) Protein levels of cleaved caspase-3 were obtained by western blot analysis. Quantitative analysis of cleaved caspase-3 protein expression is shown. Data are expressed as means ± SEM of three independent experiments. *P < 0.05 vs control. **P < 0.01 vs control. #P < 0.05 vs DEX. ##P < 0.01 vs DEX. :P < 0.05 vs DEX. ns P > 0.05 vs control.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
6
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
treatment group. Fig. 2C demonstrates that the cell viability of the KL group was not significantly different from that of the control group, or GFP group. Whereas pretreatment with DEX reduced cell viability by 45% when compared to the control group (P < 0.01), and the group treated with DEX alone. The KL þ DEX group significantly increased cell viability by 30% (P < 0.05). Taken together, our data suggest that KL can attenuate DEX-induced apoptosis in MC3T3-E1 osteoblastic cells. 3.3. Involvement of the NF-kB in DEX-induced MC3T3-E1 cells apoptosis It has been documented that NF-kB plays the critical role in inflammatory reaction and apoptosis [14,15]. Therefore, to investigate whether the NF-kB signaling pathway is involved in DEXinduced osteoblast apoptosis, we pretreated MC3T3-E1 cells with the NF-kB inhibitor pyrrolidine dithiocarbamate (PDTC) (Fig. 3A). PDTC significantly restored 62.5% of the DEX-induced decrease in caspase-3 levels and inhibited 72% of the DEX-induced increase in cleaved caspase-3 (P < 0.05). At the same time, we found that pretreatment with PDTC decreased the expression of caspase-3 mRNA by 55.1% (P < 0.05) compared to DEX alone (Fig. 3B). Furthermore, we also investigated the effect of PDTC on DEXinduced apoptosis by flow cytometry. As shown in Fig. 3C and D, untreated MC3T3-E1 cells were used as controls. Here we found that DEX significantly induced cell apoptosis. However, PDTC could significantly attenuate this effect (51.95% vs. 21.83%, P < 0.05). Taken together, these results suggest that DEX-induced apoptosis is in part due to NF-kB activation in MC3T3-E1 cells. 3.4. Effect of KL on DEX-induced activation of NF-kB in MC3T3-E1 cells NF-kB exists in the cytoplasm in an inactive form, which is bound to its biological inhibitor IkB. IkBa plays a major role in the activation of the NF-kB pathway. Upon activation of NF-kB, IkBa rapidly phosphorylates and degrades to form the IkBa-NFkB complex, followed by the release of p65, as well as its phosphorylation and translocation to the nucleus [13,16,17]. To investigate a role for KL in the inhibition of DEX-induced NF-kB activation, we measured the protein levels of IkBa and P-p65 as indicators of the NF-kB pathway activity. The IkBa protein levels measured by western blot were decreased by 71.4% following DEX treatment (P < 0.01). However, KL restored this DEX-induced IkBa protein degradation by 60% (P < 0.05) (Fig. 4A). Immunofluorescence results showed that the intensity of IkBa fluorescence was significantly decreased in DEX-induced MC3T3-E1 osteoblasts, whereas the intensity of IkBa fluorescence after pre-treatment with KL was significantly increased (Fig. 4B). P-p65 protein levels increased by 1.91-fold (P < 0.05) after DEX treatment, which was inhibited by 40% with KL transfection (P < 0.01) (Fig. 4C). Consistently, DEX treatment induced a dramatic increase in the translocation of NF-kB p65 into the nucleus by immunofluorescence (Fig. 4D). In contrast, the DEXinduced translocation of this complex was markedly inhibited by KL (Fig. 4D). By western blot analysis, it was found that after PDTC pretreatment of the DEX-induced osteoblasts, the level of cleaved caspase-3 protein expression was reduced by 50.7% compared with that of the DEX treatment group alone (P < 0.05) (Fig. 4E). Meanwhile, treatment of osteoblasts induced by DEX with KL reduced the cleaved caspase-3 protein by 73.3% compared to the DEX treated cell (P < 0.05). This indicates that the inhibition of DEXinduced MC3T3-E1 apoptosis by KL is at least, partly dependent upon the NF-kB pathway.
4. Discussion Glucocorticoid-induced osteoporosis (GIOP) is the most common type of secondary osteoporosis. GCs at physiological concentrations are essential for the natural development of bone, whereas high doses can cause osteoporosis [18]. Excessive GCs can also induce apoptosis of osteoblasts and osteocytes by increasing proapoptotic factors and reactive oxygen species [19]. The present study has demonstrated that GCs such as DEX mainly promote the apoptosis of osteoblasts and osteocytes resulting in osteoporosis. This process principally causes a reduction in bone strength and quality through activation of pro-apoptotic caspase family members [20] and influencing the Wnt signal pathway [21]. Consistent with our previous work [22], this study confirmed the DEX-induced apoptosis of MC3T3-E1 osteoblasts. P65 is the most critical transcription factor among the NF-kB family members and plays an important role in inflammation and apoptosis [23]. Studies have shown that NF-kB overexpression can promote apoptosis of vascular smooth muscle cells and inhibit cell proliferation [24]. NFkB inhibition can lead to osteoblast differentiation and bone enhancement [25]. Previous study showed that activation of NF-kB by palmitate led to apoptosis of MC3T3-E1 osteoblasts [26]. We further found that the NF-kB inhibitor PDTC reduced the number of apoptotic cells and attenuated the activity of caspase-3 induced by DEX, suggesting the involvement of NF-kB in DEX-induced MC3T3E1 apoptosis. Other studies have shown that the activity of high dose GC-treated osteoclasts can be increased by the activation of NF-k B [27]. These results indicate that activation of NF-kB might participate the pathological process of DEX-induced osteoporosis by affecting both osteoblast and osteoclasts. Klotho protein is a transmembrane protein encoded by the KL gene. Besides its anti-aging properties, KL can also inhibit oxidative stress, promote angiogenesis and regulate bone mineral density [28]. It has been shown that osteoporosis occurs in mice lacking the KL gene [29]. The lack of KL gene affects the function and number of osteoblasts, therefore interfering with bone mineralization [30]. Recent study indicated that KL can inhibit the degradation of IkB and activation of nuclear NFkB [31]. In this current study, PDTC simultaneously inhibited caspase-3 activation and DEX-induced MC3T3-E1 apoptosis. Similarly, we found that besides the inhibition of NF-kB activation, KL also reduced DEX-induced caspase-3 expression, in consistent with previous studies. This experimental study also found that KL was capable of inhibiting DEX-induced MC3T3-E1 apoptosis and reduced caspase-3 expression simultaneously by inhibiting the DEX-induced degradation of IkB, nuclear translocation of NF-kB p65, and phosphorylation of p65. These results indicate that the anti-apoptotic effect of KL and pro-apoptotic effect of DEX might be mediated by NF-kB activation. Therefore, KL can inhibit DEX-induced MC3T3-E1 apoptosis as well as the expression of caspase-3 through the NF-kB pathway. In conclusion, we have demonstrated that KL can inhibit the apoptosis of MC3T3-E1 osteoblasts induced by DEX via partially inhibiting the NF-kB pathway. However, whether the other signaling components involve in the protective action of KL requires further research. Taken together, these findings suggest that KL might serve as a novel candidate for the prevention, and treatment of GIOP.
Acknowledgements We thank the Laboratory Research Center of the First Affiliated Hospital of Chongqing Medical University for technical support.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040
X. Liang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.11.040. Conflicts of interest The authors declare that they have no competing interests. Funding This work was supported by the General Program of National Natural Science Foundation of China (Grant No. 30672212)/Medical Science Research Project of Chongqing Health and Family Planning Commission, China (NO. 2016MSXM080)/Science and Technology Planning Project of Yuzhong District of Chongqing, China (NO. 20150139). References [1] S. Li, H. Jiang, X. Gu, Echinacoside suppresses dexamethasone-induced growth inhibition and apoptosis in osteoblastic MC3T3-E1 cells, Exp. Therapeut. Med. 16 (2) (2018) 643e648. [2] D.U. Debby, I.E.M. Bultink, W.F. Lems, Advances in glucocorticoid-induced osteoporosis, Curr. Rheumatol. Rep. 13 (3) (2011) 233e240. [3] H. Lin, X. Gao, G. Chen, et al., Indole-3-carbinol as inhibitors of glucocorticoidinduced apoptosis in osteoblastic cells through blocking ROS-mediated Nrf2 pathway, Biochem. Biophys. Res. Commun. 460 (2) (2015) 422e427. [4] R.S. Weinstein, R.W. Nicholas, S.C. Manolagas, Apoptosis of osteocytes in glucocorticoid-induced osteonecrosis of the hip, J. Bone Miner. Res. Offic. J. Am. Soc. Bone Miner. Res. 15 (4) (2010) 754e762. [5] H. Li, W. Qian, X. Weng, et al., Glucocorticoid receptor and sequential P53 activation by dexamethasone mediates apoptosis and cell cycle arrest of osteoblastic MC3T3-E1 cells, U.S. Chin. Int. J. Traumat. 7 (1) (2012) 1e8. [6] C.C. Chua, B.H. Chua, Z. Chen, et al., Dexamethasone induces caspase activation in murine osteoblastic MC3T3-E1 cells, BBA - Molecular Cell Research 1642 (1e2) (2003) 79e85. [7] B. Richter, C. Faul, FGF23 actions on target tissues-with and without klotho, Front. Endocrinol. 9 (2018). [8] D.A. Zhou, H.X. Zheng, C.W. Wang, et al., Influence of glucocorticoids on the osteogenic differentiation of rat bone marrow-derived mesenchymal stem cells, BMC Muscoskel. Disord. 15 (1) (2014) 239, 15,1(2014-07-15). [9] H. Kawaguchi, Molecular backgrounds of age-related osteoporosis from mouse genetics approaches, Rev. Endocr. Metab. Disord. 7 (1e2) (2006) 17. [10] T. Yamashita, A. Nifuji, K. Furuya, et al., Elongation of the epiphyseal trabecular bone in transgenic mice carrying a klotho gene locus mutation that leads to a syndrome resembling aging, J. Endocrinol. 159 (1) (1998) 1. [11] D. Chalhoub, E. Marques, O. Meirelles, et al., Association of serum klotho with loss of bone mineral density and fracture risk in older adults, J. Am. Geriatr. Soc. 64 (12) (2016) 304e308. [12] Y.J. Wang, H.X. Ma, B.S. Li, et al., Effects of adeno-associated virus-mediated
[13]
[14]
[15]
[16] [17] [18]
[19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28] [29]
[30]
[31]
7
klotho gene delivery on the expression of Runx2 and MMP-13 gene in the bone of the ovariectomy rats, Basic Med Sci Clin 32 (5) (2012) 487e492 (in Chinese). X. Zhong, L. Xiu, G. Wei, et al., Bezafibrate prevents palmitate-induced apoptosis in osteoblastic MC3T3-E1 cells through the NF-kB signaling pathway, Int. J. Mol. Med. 28 (4) (2011) 535e542. C. Ward, E.R. Chilvers, M.F. Lawson, et al., NF-kB activation is a critical regulator of human granulocyte apoptosis in vitro, J. Biol. Chem. 274 (7) (1999) 4309e4318. M. Rashidi, E. Bandalasanchez, K.E. Lawlor, et al., CD52 inhibits Toll-like receptor activation of NF-kB and triggers apoptosis to suppress inflammation, Cell Death Differ. 25 (2) (2018) 392. S.C. Sun, Non-canonical NF-^IºB signaling pathway, Cell Res. 21 (1) (2011) 71e85. M.A.D.L. Rosa, I. Diazcm Oreno, J. Guinovart, Role of disorder in IkB-NFkB interaction, IUBMB Life 64 (6) (2012) 499e505. R. Kalak, H. Zhou, J. Street, et al., Endogenous glucocorticoid signalling in osteoblasts is necessary to maintain normal bone structure in mice, Bone 45 (1) (2009) 61e67. T. Komori, Glucocorticoid signaling and bone biology, Horm. Metab. Res. 48 (11) (2016) 755e763. Y. Liu, A. Porta, X. Peng, et al., Prevention of glucocorticoid-induced apoptosis in osteocytes and osteoblasts by calbindin-D28k, J. Bone Miner. Res. 19 (3) (2010) 479e490. S.I. Yun, H.Y. Yoon, S.Y. Jeong, et al., Glucocorticoid induces apoptosis of osteoblast cells through the activation of glycogen synthase kinase 3b, J. Bone Miner. Metabol. 27 (2) (2009) 140e148. H. Lin, B. Wei, G. Li, et al., Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway, Drug Des. Dev. Ther. 2014 (default) (2014) 973. F. Zhou, X. Huang, Y. Pan, et al., Resveratrol protects HaCaT cells from ultraviolet B-induced photoaging via upregulation of HSP27 and modulation of mitochondrial caspase-dependent apoptotic pathway, Biochem. Biophys. Res. Commun. 499 (3) (2018). L. Jiao, M. Jiang, J. Liu, et al., Nuclear factor-kappa B activation inhibits proliferation and promotes apoptosis of vascular smooth muscle cells, Vascular (3) (2018), 170853811878712. A. Rauch, S. Seitz, U. Baschant, et al., Glucocorticoids suppress bone formation by attenuating osteoblast differentiation via the monomeric glucocorticoid receptor, Cell Metabol. 11 (6) (2010) 517e531. J.W. Gu, E. Young, B. Busby, et al., Oral administration of pyrrolidine dithiocarbamate (PDTC) inhibits VEGF expression, tumor angiogenesis, and growth of breast cancer in female mice, Cancer Biol. Ther. 8 (6) (2009) 514e521. Y. Hachemi, A. Rapp, A.K. Picke, et al., Molecular mechanisms of glucocorticoids on skeleton and regeneration after fracture, J. Mol. Endocrinol. 61 (1) (2018). JME-18-0024. P. Buendía, R. Ramírez, P. Aljama, et al., Klotho prevents translocation of NFkB, Vitam. Horm.-Adv. Res. Appl. 101 (2016) 119e150. M. Kuroo, Klotho as a regulator of fibroblast growth factor signaling and phosphate/calcium metabolism, Curr. Opin. Nephrol. Hypertens. 15 (4) (2006) 437. S. Zheng, Y. Chen, Y. Zheng, et al., Correlation of serum levels of fibroblast growth factor 23 and Klotho protein levels with bone mineral density in maintenance hemodialysis patients, Eur. J. Med. Res. 23 (1) (2018) 18. P. Buendía, R. Ramírez, P. Aljama, et al., Klotho prevents translocation of NFkB, Vitam. Horm.-Adv. Res. Appl. 101 (2016) 119e150.
Please cite this article as: X. Liang et al., Klotho prevents DEX-induced apoptosis in MC3T3-E1 osteoblasts through the NF-kB signaling pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.11.040