- Email: [email protected]
Knockdown of RCAS1 expression by RNA interference recovers T cell growth and proliferation
Available online at www.sciencedirect.com
Cancer Letters 257 (2007) 182–190 www.elsevier.com/locate/canlet
Knockdown of RCAS1 expression by RNA interference recovers T cell growth and proliferation q Yuan Han a, Wenxin Qin b, Gang Huang
a,*
a
b
Department of Nuclear Medicine, Renji Hospital, Shanghai Jiao Tong University School of Medicine, No. 145 Middle Shandong Road, Shanghai 200001, People’s Republic of China National Laboratory for Oncogenes and Related Genes, WHO Collaborating Center for Research on Cancer, Shanghai Cancer Institute, Shanghai Jiao Tong University School of Medicine, Shanghai 200032, People’s Republic of China Received 18 March 2007; received in revised form 28 May 2007; accepted 16 July 2007
Abstract Receptor binding cancer antigen expressed on SiSo cells (RCAS1), a tumor-associated antigen, was expressed in various malignant tissues. It is involved in the tumor immune escape. Here, we reported the evidence that knockdown of RCAS1 expression by RNA interference can recovers T cell growth and proliferation. We designed a small hairpin RNA to knockdown RCAS1 expression in MCF-7 cells effectively. Adding RCAS1 protein resulted in a reduced T cell growth rate, an increased T cell apoptosis ratio, the higher activity of Caspase-3 proteases, and decreased IFN-c secretion. The suppression of RCAS1 expression effectively recover T cell proliferation, reduce apoptosis and partially reverse the T cell function of IFN-c secretion. 2007 Elsevier Ireland Ltd. All rights reserved. Keywords: RCAS1; RNA interference; T lymphocyte; Recover
1. Introduction The last 15 years have seen a re-emergence of interest in cancer immunosurveillance. Recent work has shown that the immune system may also promote the emergence of primary tumors with reduced immunogenicity that are capable of escaping immune recognition and destruction [22]. Adaptive and innate immune cells play critical roles in cancer immunosurveillance. q
Grant support: The Nation Natural Science Foundation of China Grant 30470497. * Corresponding author. Tel.: +86 21 53882166. E-mail address: [email protected] (G. Huang).
A tumor-associated antigen, recognized by monoclonal antibody 22-1-1, was cloned and designated as receptor binding cancer antigen expressed on SiSo cells (RCAS1) [1]. RCAS1 was also isolated from MCF-7 cells derived from a human breast cancer as a novel estrogen-responsive gene, ER-binding fragment-associated antigen 9 (EBAG9) [2]. RCAS1/EBAG9 is a type-II membranous protein and also exists in soluble form [1]. In previous immunohistochemical studies, RCAS1 was expressed in various malignant tissues [3–8], including lung cancer, breast cancer, uterine carcinoma, bile duct carcinoma, liver cancer, gastric carcinoma and so on. Soluble RCAS1 has been detected by enzyme-linked immunosorbent assay (ELISA) in a
0304-3835/$ - see front matter 2007 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2007.07.016
Y. Han et al. / Cancer Letters 257 (2007) 182–190
culture supernatant derived from a human bile duct carcinoma cell line [9]. It has been described that RCAS1 acts as a ligand for a putative receptor present on normal cells, such as peripheral blood lymphocytes, inhibits the growth of receptorexpressing cells in vitro and induces apoptotic cell death [1]. Therefore, it has been generally recognized that RCAS1 is involved in the tumor immune escape. Owing to its importance in tumor immunosurveillance, RCAS1 might be a suitable target for gene therapy approaches. RNA interference, a new technique developed in the late 2000s, has gained much attention for its powerful ability to suppress gene expression. It is an evolutionarily conserved phenomenon and a multistep process that involves generation of active small interfering RNA (siRNA) in vivo through the action of an RNase III endonuclease, Dicer. The resulting 21- to 23-nt siRNA mediates degradation of the complementary homologous RNA [10]. Recently, a DNA vector-based small hairpin RNA (shRNA) technology that allows the synthesis of shRNA from DNA template has been developed to efficiently inhibit endogenous gene expression in mammalian cells [11,12]. In this report, we described that a DNA vectormediated shRNA technology was utilized to knock down RCAS1 expression in MCF-7 cells, in order to observe the changes in growth and function of T cell. 2. Materials and methods 2.1. Cell line and cell culture MCF-7 cells were cultured in DMEM with 10% fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 lg/mL of streptomycin at 37 C in 5% CO2. 2.2. Reagents The RCAS1 ELISA kit was purchased from MBL Co., Ltd., Japan. Annexin V-FITC apoptosis detection kit and Cycle TESTTM PLUS DNA Reagent kit were purchased from BD Biosciences Pharmingen, USA. Human IL-2, IL-4, IFN-c ELISA kits, and mouse anti-human CD8 FITC/CD4 PE/CD3 PE-Cy5 were purchased from Jingmei Biotech Co., Ltd., China. Caspase-3 antibody and cleaved Caspase-3 antibody were purchased from Cell Signaling Technology, Inc. The Taqman-MGB probe and primer of RCAS1 was designed by Applied Biosystem, USA. (The sequence was not published by ABI.)
183
2.3. Construction of small hairpin RNA plasmid vector and HA-tag RCAS1 overexpression vector The shRNA expressing vector PSG was reconstructed according to vector pSURER (Oligoengine Co., USA). To ensure the 19-nucleotide sequences of the RCAS1-specific shRNAs (Rl, R2, R3, R4, R5) and scrambled control shRNA (SC) had no significant homology with other known human genes (Table 1), we used the sequences of these two types of RNA to perform a BLAST search against the human genome database. The six pairs of complementary oligonucleotides (Table 1) were synthesized (BioAsia, Co., Shanghai), then annealed to generate double-stranded DNAs and ligated into the linearized empty vector PSG Plasmids were verified by sequence analysis (United Gene Holdings, Ltd., Shanghai). The full length of RCAS1 sequence was connected with the empty pCMV-HA2 (Clontech Laboratories, Inc., USA) digested with Xho I and Xba I and catalyzed by T4 DNA ligase. The product was transformed into TOP10, then transferred onto LB (Luria-Bentani) plate containing ampicillin and incubated at 37 C overnight. The single colony was picked up to enlarge the culture. The correct insert in positive colonies was identified by sequence analysis (completed by United Gene Holdings, Ltd., Shanghai, China). We successfully constructed HA-tag overexpression vector plasmid pCMV-HA2RCAS1. 2.4. Transfection Transfection of plasmid DNAs into MCF-7 cells was done using LipofectAMINE2000 (Invitrogen, Carlsbad, CA). Briefly 1 · 105 well-lived MCF-7 cells were seeded per well into 6-well plate (Corning, Inc., Corning, NY), and cultured overnight to the density of 70% confluence. RNA interfering vector plasmid and HA-tag RCAS1 overexpression vector plasmid 2 lg (PSG-R/pCMVHA2-RCAS1 = 9:1) were added to 250 lL serum-free DMEM. Plasmid pCMV-HA2-RCAS1 0.2 lg was added to 250 lL serum-free DMEM as a positive control. LipofectAMINE2000 10 lL was added to 250 lL serum-free DMEM. These solutions were mixed and incubated for 20 min at room temperature. The cells were washed twice with serum-free DMEM. The mixture of plasmid and lipofectAMINE2000 was added up to 2 mL and transferred to 6-well plate. After 6 h, the medium was changed in each well to DMEM medium containing 10% FCS. 1 · 105 well-lived MCF-7 cells were seeded per well into 6-well plate, and cultured overnight to the density of 70% confluence. RNA interfering vector plasmid (PSG-R2, PSG-SC) 2 lg and LipofectAMINE2000 10 lL were added to 250 lL serum-free DMEM, respectively. The two solutions were mixed and incubated for 20 min at room temperature. The cells were washed twice
184
Y. Han et al. / Cancer Letters 257 (2007) 182–190
Table 1 Hairpin siRNA insert sequence Sequence
Target nucleotide sequence on RCAS1 cDNA
R1
GATCCCCGGACGGAAATTAAGTGGAGTTCAA GAGACTCCACTTAATTTCCGTCCTTTTTGGAAA
94–112
R2
GATCCCCGGAGGGAATGGGAATGTGGTTCAA GAGACCACATTCCCATTCCCTCCTTTTTGGAAA
223–241
R3
GATCCCCGGAAGAAAATGGAAAAGGATTCA AGAGATCCTTTTCCATTTTCTTCCTTTTTGGAAA
486–504
R4
GATCCCCATAACTTTGCCAACTACAGTTCAA GAGACTGTAGTTGGCAAAGTTATTTTTTGGAAA
118–136
R5
GATCCCCTTAGGTGACTTAGATACCTTTCAAG AGAAGGTATCTAAGTCACCTAATTTTTGGAAA
436–454
SC
GATCCCCATAGGGCGTACGATTATCATTCAAG AGATGATAATCGTACGCCCTATTTTTTGGAAA
Bases underlined can form shRNA targeting RCAS1 cDNA.
with serum-free DMEM. The mixture of plasmid and LipofectAMINE2000 was added up to 2 mL and transferred to 6-well plate. After 6 h, the medium was changed in each well to DMEM medium containing 10% FCS. After being incubated for 48 h, the cells were cultured and screened in the medium containing 10% serum and 1 mg/mL G418 (Invitrogen). When nontransfected cells were completely killed, the medium was changed to 0.4 mg/mL G418 medium to sustain the culture, until the individual colonies were cloned large enough to be transferred one by one into 96-well plate to propagate the culture (MCF-7-R2, MCF-7-SC). When MCF-7, stable transfected MCF-7-R2 and MCF-7-SC in 3.5-cm dish reached to 90% abundance, l mL RPMI1640 was added into each dish and incubated for 24 h at 37 C in humidified incubator with an atmosphere of 5% CO2. Then the supernatant of the cells was collected. 2.5. T cell culture The freshly isolated human PBLs were transferred into 24-well plate coated with anti-CD3 (1.0 lg/mL) and antiCD28 (0.5 lg/mL) antibody, 2 · 106 cells/well. These cells were cultured in the RPMI1640 (Gibco BRL) medium containing 10% FCS 0.1 mmol/L, nonessential amino acid (Gibco BRL), sodium pyruvate 1 mmol/L, L-glutamine 2 mmol/L, 2-mercaptoethanol 0.05 mmol/L (Sigma), penicillin 100 U/mL and streptomycin 100 lg/mL, and incubated at 37 C in humidified incubator with an atmosphere of 5% CO2. 2.6. Real-time PCR Total RNAs were extracted with Trizol. After the amount of total RNA were determined using ultraviolet (UV) spectrophotometry, the RNA was reverse transcribed
into cDNA using a cDNA 1st Strand Synthesis Kit (Invitrogen) (according to the manufacturer’s instructions). Reverse transcription of total RNA (5.0 lg) was performed with the mixture with dNTP and Oligo(dT) for 5 min at 65 C, followed by 1 min on ice, the addition of reaction solution for 2 min at 42 C, the addition of Super Script II RT for 50 min at 42 C followed by 15 min at 70 C, and the addition of RNase H for 20 min at 37 C. Real-time PCR reaction system contains 2.5 lL 10 · Taqman buffer A, 3.5 lL 25 mM MgCl2, 0.5 lL each of dATP (10 mM), dCTP (10 mM), dGTP (10 mM) and dUTP (20 mM), 1.25 lL Taqman-MGB expression probe and primer mixture (20·), 0.25 lL AmpErase UNG, 0.125 lL AmpliTaq polymerase (5.0 U/ lL), 2 lL cDNA, and sterile ddH2O in a total volume of 25 lL. The tubes were incubated at 50 C for 2 min and 95 C for 10 min to activate AmpliTaq polymerase; 40 cycles of PCR amplification were performed as follows: denature 95 C for 15 s, anneal/extend 60 C for 60 s. The PCR reaction was proceeded on AB17300 instrument and real-time detected by the fluorescence value of each extend stage. Data analysis was automatically accomplished by ABI 7300 system software SDS, which generates an amplification curve related to PCR cycle and DRn to determine the Ct value (the threshold cycle number). The amount of sample cDNA was estimated by the ratio of Ct value of cDNA and that of housekeeperb-actin gene.
2.7. ELISA The sample was performed according to manufacturer’s instructions. One hundred microliter sample was added into monoclonal antigen coated 96-well plate and incubated for 60 min at 37 C. The fluid in the wells was discarded and the wells were washed 4 times. One hundred microliter of horseradish peroxidase (HRP) conjugated biotin was added and incubated for 60 min at 37 C. The
Y. Han et al. / Cancer Letters 257 (2007) 182–190
fluid in the wells was discarded and the wells were washed another 4 times. One hundred microliter of substrate was added to the wells and incubated for 10 min at 37 C, followed by the addition of 100 lL stopping solution. The OD value of each well was measured at 450 nm by Muti-detection Microplate Reader SpectraMax M5 (MD Company). Each sample was repeated in 5 wells and the experiment was repeated 5 times. 2.8. Western blot The cells were collected and lyzed with T-PER tissue protein extract. The protein concentration of whole cell lysates were measured using the BCA protein assay kit. The proteins were separated by 12% SDS–PAGE and transferred onto NC membranes. The membranes were rinsed with TBST and incubated in blocking buffer for 1 h, followed by incubation with primary antibodies overnight at 4 C. After being washed with TBST, the membranes were incubated with secondary antibodies for 1 h. Signal was detected by autoradiography. 2.9. Determination of cell growth curve PBLs were treated with CD3/CD28 for 48 h, and inoculated into 96-well plate. One hundred microliter supernatant of MCF-7, MCF-7-R2, MCF-7-SC was added into the wells respectively, and 100 lL RPMI1640 was added as a control. IL-2 was also added to a final concentration of 60 IU/mL. The cell growth curve was measured by MTS according to manufacturer’s instructions. After the supernatant being discarded, 100 lL MTS was added into each well and incubated for 4 h at 37 C in the dark with an atmosphere of 5% CO2. The OD value of each well was measured at 490 nm. Each group was repeated in 5 wells and measured in successive 5 days. The experiment was repeated 3 times.
185
fer. Five microliter of Annexin V-PE and 5 lL 7-AAD were added into each sample and incubated for 15 min at room temperature in the dark. The samples were analyzed by Flow Cytometer. Repeat the experiment 5 times. 2.12. CD4/CD8 classification analysis T cells were collected and washed twice with PBS. After the cells being suspended in 100 lL PBS, 30 lL rat-anti-human CD3 PE-Cy5/CD4 FITC/CD8 PE labeled antibodies were added into each sample and incubated for 20 min at room temperature in the dark. The cells collected by centrifugation at 1000 rpm/min for 5 min. After the supernatant being discarded, the cells were washed twice with PBS and resuspended. The percentage of CD4+ and CD8+ T cells were detected by Flow Cytometer. Repeat the experiment 5 times. 2.13. Statistical analysis All statistical analyses between experimental group and negative control group were performed using Student’s paired t tests. 3. Results 3.1. Identification of effective shRNA sequence Five shRNA vectors (PSG-R1–PSG-R5) and one scrambled control vector (PSG-SC) were cotranstected with HA-tag RCAS1 overexpression vector (pCMVHA2-RCAS1) into MCF-7 cells. After 48 h, proteins were extracted and the tagged protein HA was detected by Western blot. The results show that the expression of RCAS1 can be obviously inhibited by shRNA sequence Rl, R2 and R3, among which R2 is the most efficient one, but it cannot be reduced by sequence R4, R5 and scrambled SC (Fig. 1).
2.10. Cell cycle analysis T cells were performed according to manufacturer’s instructions as follows: after cells being washed 3 times, 250 lL solution A was added into each sample and stood for 10 min at room temperature, followed by the addition of 200 lL solution B into each sample and standing for another 10 min at room temperature. Two hundred microliter solution C was finally added into each sample and stood for 10 min on ice in the dark. The samples were analyzed by Flow Cytometer. The experiment was repeated 5 times. 2.11. Cell apoptosis analysis Cells were collected and performed according to manufacturer’s instructions as follows: these cells were washed twice by ice-cold PBS and resuspended in 1 · binding buf-
3.2. Suppression of RCAS1 expression in MCF-7 cell by shRNA The shRNA vector containing coding sequence R2 and the negative control vector containing coding scrambled sequence SC were transfected to MCF-7 cells, respectively. The stable transfected cell lines MCF-7-R2 and MCF-7-SC were obtained through the selection of G418. To test the silencing, we examined the mRNA and protein expression level in MCF-7, MCF-7-R2 and MCF-7-SC cell lines. 3.2.1. Real-time PCR The integrity of cDNA was verified by the Ct value fluctuating between 17 and 20 in each cell line. The Ct (RCAS1)/Ct (b-actin) implies that the mRNA level of RCAS1 in MCF-7-R2 cells is significantly lower than that
186
Y. Han et al. / Cancer Letters 257 (2007) 182–190
3.3.1. T cell growth curve T cell growth was inhibited when the supernatant of MCF-7 and MCF-7-SC cell cultures was added, respectively, and incubated for 72 h, but T cells maintained their normal proliferation when the supernatant of MCF-R2 was added (Fig. 3a). Fig. 1. The expression of tagged protein HA was measured by Western blotting. Expression of RCAS1 can be obviously inhibited by shRNA sequence R1, R2 and R3, among which R2 is the most efficient one, but it cannot be reduced by sequence R4, R5 and scrambled SC. b-Actin was used as an internal control. (1–5) 5 shRNA vectors (PSG-R1–R5) were cotransfected with HA-tag RCAS1 overexpression vector (pCMV-HA2RCAS1) into MCF-7 cells respectively. (6) One negative control vector (PSG-SC) was cotransfected with pCMV-HA2-RCAS1 into MCF-7 cells. (7) pCMV-HA2-RCAS1 was transfected into MCF-7 cells alone.
in MCF-7 cells (P < 0.01), but there are no significant statistical differences between MCF-7-SC and MCF-7 cells (P > 0.05) (Fig. 2a). 3.2.2. ELISA When each kind of cells reached to 90% abundance in 3.5 cm dishes, 1 mL DMEM was added and incubated for 24 h. The supernatant was collected and detected for the amount of protein RCAS1 by ELISA. The results of protein detection in MCF-7, MCF-7-R2 and MCF-7-SC show that the protein RCAS1 expression in MCF-7-R2 cells is significantly lower (75% reduction) than that in MCF-7 cells (P < 0.01), but there are no significant statistical differences between MCF-7-SC and MCF-7 cells (P > 0.05), consistent with the previous finding obtained from mRNA detection (Fig. 2b). 3.3. Effects of RCAS1-specific shRNA on proliferation and the development of T cell T cell proliferation and development was reversed by shRNA mediated inhibition of RCAS1 expression.
3.3.2. T cell cycle The supernatant of MCF-7, MCF-7-R2 and MCF-7SC cell cultures and RPMI1640 were added to T cells, respectively. After 72 h cultures, T cells were collected. The measurement of T cell cycle shows that the T cells of S phase in the supernatant of group MCF-7 and MCF-7-SC are far more than that in RPMI1640 (P < 0.001), whereas there are no significant statistical differences between T cells of all phases in the supernatant of group MCF-7-R2 and that in RPMI1640 (P > 0.05) (Fig. 3b). 3.4. Effects of RCAS1-specific shRNA on apoptosis of T cell shRNA mediated inhibition of RCAS1 expression reduced T cell apoptosis. The above four groups of T cells were analyzed after 3 days cultures. 3.4.1. T cell apoptosis analysis After the addition of the supernatant of group MCF-7, MCF-7-SC followed by 3 days culture, the apoptosis ratios of T cells in these two groups are significantly higher than that of group MCF-R2 and negative control group RPMI1640 (P < 0.001) (Fig. 4a). 3.4.2. Assessment of T cell Caspase-3 activity by Western blot After the addition of the supernatant of group MCF-7 and MCF-7-SC, the activity of Caspase-3 proteases in group MCF-7 and MCF-7-SC is significantly higher than that in group RPMI1640, whereas there are no significant statistical differences between group MCF-7-R2 and RPMI1640 (Fig. 4b).
Fig. 2. RCAS1 expression in MCF-7 is suppressed by shRNA. (a) Real-time PCR; (b) ELISA. (1) MCF-7-R2; (2) MCF-7-SC; (3) MCF-7; (*P < 0.01).
Y. Han et al. / Cancer Letters 257 (2007) 182–190
187
Fig. 3. T cell proliferation was recovered by RCAS1-specific shRNA. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture respectively. (a) T cell growth curve, (b) T cell cycle analysis.
3.4.3. CD4/CD8 classification analysis Compared with the negative control group RPMI1640, the CD4+ T cells in group MCF-7 and MCF-7-SC appear to decline, but there are no statistical significant differences (P > 0.05). There are no significant statistical differences among the ratios of CD8+ T cells in each group (Fig. 4c).
MCF-7-R2 was added, the secretion of IFN-c was markedly reduced compared with RPMI1640 group (P < .001), especially in group MCF-7 and MCF-7-SC. In addition, the amount of IFN-c in group MCF-7 and MCF-7-SC is also much lower than that of group MCF-7-R2 (P < 0.001) (Fig. 5).
3.5. Effects of RCAS1-specific shRNA on cytokines secretion of T cell
4. Discussion
After the above 4 groups of T cells were cultured for 3 days, the supernatant of each group was collected and detected for the concentration of IL-2, IL-4 and IFN-c by ELISA. There are no significant differences on IL-2 and IL-4 concentration among groups (P > 0.05). After the supernatant of group MCF-7, MCF-7-SC and
Tumor is considered as a systematic disease, the cause not only of mere over-proliferation of cells, but also of the interaction between each system and surrounding microenvironment, in which the immune system plays an important role. The immunological surveillance (immunological cells, such as
188
Y. Han et al. / Cancer Letters 257 (2007) 182–190
Fig. 4. T cell apoptosis was decreased by RCAS1-specific shRNA. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture respectively. (a) T cell apoptosis rate; (b) assessment of T cell Caspase-3 activity by Western blot; (c) CD4/CD8 classification analysis.
cytotoxic lymphocytes, CTL, NK cells), as a system expected to protect organism itself and maintain homeostasis, can recognize and lyze tumor cells in some tumor antigen expressed tumor cells, but is evaded in the other tumor cells, even though the tumor associated antigens are increasingly expressed.
Fig. 5. Effect of RCAS1 -specific shRNA on cytokines secretion of T cell. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture, respectively. The concentration of IL-2, IL-4 and IFN-c was detected by ELISA.
RCAS1 is a recently discovered tumor-associated antigen. In our previous study, RCAS1 is highly expressed in human breast cancer cell line MCF-7. Clinicopathologic study shows that it is highly expressed in all tumor tissues. Despite of RCAS1 positive rate ranging from 45% to 85% in focal tumor tissues, it reaches to almost 100% in metastatic tissues, such as lymphoid nodes. Moreover, the extent of RCAS1 expression is correlated with differentiation, metastasis, recurrence and survival time. Its expression is usually elevated in low differentiation and high malignant tumor cell surface [3– 8,13,14]. RCAS1 can promote apoptosis of RCAS1 receptor expressed cells, such as CD3+T cells and NK cells [1]. Therefore, it is speculated that tumor cells may escape from immunological surveillance by expressing RCAS1. RNA interference is a newly developed method in recent years, specific for gene inhibition. It is also successfully applied in mammal cells. Due to its convenience for operating and high efficacy for target-
Y. Han et al. / Cancer Letters 257 (2007) 182–190
ing gene inhibition, it is becoming a powerful tool for gene study. This experiment adopted DNA vector-dependent shRNA (small hairpin RNA) expression system to successfully inhibit endogenous RCAS1 expression in tumor cells. DNA vector mediated shRNA expression system formed shRNAs, which were quickly processed into 21–23 nucleotides in length to exert repression. Having overcome the weakness of temporal repression of chemosynthesis in transient transfection, this system is becoming a promising tool for genetic therapy. This study adopted DNA vector mediated shRNA expression system, transfected highly expressed RCAS1 MCF-7 cell line, screened out three effective targeting interfering sites which were 94bp–112bp, 223bp–241bp and 486bp–504bp, among which 223bp–241bp is the most efficient one, inhibiting secreted RCAS1 up to 75%. There are evidence [1,3,7,16,17] showed that RCAS1 can induce and promote apoptosis of CD3+ T cells and NK cells; tumor tissue sections illuminate that Tumor-infiltrating lymphocytes (TILs) are remarkably reduced on the vicinity of highly expressed RCAS1 tumor cells. Our results are consistent with these findings. When the supernatant, rich in RCAS1, obtained from MCF-7 and MCF-7-SC cell cultures were added respectively, the lyzed Caspase-3 proteins of CD3/CD28 antigens activated T cells were increased and the T cell apoptosis ratio was elevated accordingly. Caspase-3, as an important protein in apoptosis associated pathway, can lead to cleavage of many critical proteins, such as poly (ADP-ribose) polymerase (PARP), and result in apoptosis when lyzed to 17 kDa activated Caspase-3 [18]. The number of cells is determined by two factors, cell proliferation and apoptosis. The cell proliferation study demonstrates that RCAS1 induces T cell arrest in S phase, markedly inhibition of T cell growth. However, when RCAS1 expression is shRNA inhibited, the changes are effectively reversed. The apoptosis ratio of T cells is obviously decreased and cell cycle and growth are restored to normal state. CD3+ T cells classification analysis suggests that RCAS1 proteins have no significant influence on CD8+ T cell proportion and have the tendency to attenuate CD4+ T cells. Ikeguchi et al. [19] has reported that RCAS1 protein may not regulate the density of CD8+ TILs in hepatic cellular cancer tissue. In the whole network of immunological surveillance, besides T cells playing the important role, the cytokines, especially IFN-c, also take part in
189
[20]. It is reported that by injecting IFN-c monoclonal antibodies to inhibit IFN-c function, the growth of transplanted fibrosarcoma is obviously speed up. Our study discloses that RCAS1 proteins not only induce T cell apoptosis and repress T cell growth, but also inhibit the function of IFN-c that T cells secreted, which seriously damages the immunological surveillance network and helps tumor cells escape from clearance of immunological surveillance, resulting in tumor cells growth and progress. After shRNA suppression of RCAS1 expression, the function of IFN-c that T cells secreted were partially reversed. In addition to RCAS1, Fas ligand (FasL) and atumor necrosis factor (TNF-a) may induce lymphocytes apoptosis. Matsushima et al. [15] has reported that even blocking Fas by Fas antibodies, RCAS1 can still induce T cells apoptosis. Uterine cervix cancer patients’ sections display [21] that RCAS1 expression is remarkably higher in metastatic lymphoid nodes than primary lesions. What is more, the lymphocyte apoptosis ratio has positive correlation with RCAS1 expression, but has no correlation with FasL and TNF-a. The evidences suggest that the pathway by which RCAS1 induces T cell apoptosis is different from Fas/FasL system and TNF-a. Our study shows that only one RCAS1 gene interfered results in apoptosis ratio decreasing to a great extent from 33.67% to 10.03%, but normal proliferation is generally recovered. It is thus inferred that as for T cell growth, the function of RCAS1 proteins is not Fas/FasL system or TNF-a dependent, but playing the substantial role independently. Perhaps it is the existence of multiple apoptotic factors that leads to incompletely recovered function that T cell secreted IFN-c. On the whole, 19-nt sequence targeting RCAS1 cDNA at nucleotide 223–241 is the most effective interfering site. The inhibition of RCAS1 expression can effectively recover T cell proliferation, reduce apoptosis and partially reverse the T cell function of IFN-c secretion. The RNA interference that inhibits RCAS1 expression, recovers T cell functions, prevents from immune evasion, and positively clears tumor cells by autoimmune system, may be a novel and potential tumor treatment. The mechanism of RCAS1 inhibition of T cell growth needs to be explored still further. Acknowledgements We thank Li Xie, Genfu Yao, and Haiyan You for their skillful technical supports.
190
Y. Han et al. / Cancer Letters 257 (2007) 182–190
References [1] M. Nakashima, K. Sonoda, T. Watanabe, Inhibition of cell growth and induction of apoptotic cell death by the human tumor-associated antigen RCAS1, Nature Med. 5 (1999) 938–942. [2] T. Watanabe, S. Inoue, H. Hiroi, A. Orimo, H. Kawashima, M. Muramatsu, Isolation of estrogen-responsive genes with a CpG island library, Mol. Cell. Biol. 18 (1998) 442–449. [3] M. Izumi, Y. Nakanishi, I. Yoshino, M. Nakashima, T. Watanabe, N. Hara, Expression of tumor-associated antigen RCAS1 correlates significantly with poor prognosis in nonsmall cell lung carcinoma, Cancer 92 (2001) 446–451. [4] T. Suzuki, S. Inoue, W. Kawabata, J. Akahira, T. Moriya, F. Tsuchiya, S. Ogawa, M. Muramatsu, H. Sasana, EBAG9/ RCAS1 in human breast carcinoma: a possible factor in endocrine-immune interactions, Br. J. Cancer 85 (2001) 1731–1737. [5] K. Sonada, S. Miyamoto, T. Hirakawa, T. Kaku, M. Nakashima, T. Watanabe, K. Akazawa, T. Fujita, H. Nakano, Association between RCAS1 expression and clinical outcome in uterine endometrial cancer, Br. J. Cancer 89 (2003) 546–551. [6] T. Oshikiri, Y. Hida, M. Miyamoto, H. Hashida, K. Katoh, M. Suzuoki, Y. Nakakubo, K. Hiraoka, T. Shinohara, T. Itoh, S. Konda, H. Katoh, RCAS1 as a tumour progression marker: an independent negative prognostic factor in gallbladder cancer, Br. J. Cancer 85 (2001) 1922–1927. [7] K. Noguchi, M. Enjoji, M. Nakamuta, M. Nakashima, H. Nishi, I. Choi, K. Taguchi, K. Kotoh, M. Shimada, K. Sugimachi, M. Tsuneyoshi, H. Nawata, T. Watanabe, Expression of a tumor-associated antigen RCAS1 in hepatocellular carcinoma, Cancer Lett. 168 (2001) 197–202. [8] M. Kubokawa, M. Nakashima, T. Yao, K.I. Ito, N. Harda, H. Nawata, T. Watanabe, Aberrant intracellular localization of RCAS1 is associated with tumor progression of gastric cancer, Int. J. Oncol. 19 (2001) 695–700. [9] M. Enjoji, M. Nakashima, H. Nishi, I. Choi, H. Oimomi, R. Sugimoto, K. Kotoh, K. Taguchi, M. Nakamuta, H. Nawata, T. Watanabe, The tumor-associated antigen, RCAS1, can be expressed in immune-mediated diseases as well as in carcinomas of biliary tract, J. Hepatol. 36 (2002) 786–792. [10] S.M. Elbashir, J. Harborth, W. Lendechel, et al., Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411 (2001) 494–498. [11] G. Sui, C. Soohoo, B. Affarel, et al., A DNA vector based RNAi technology to suppress gene expression in mammalian cells, Proc. Natl. Acad. Sci. USA 99 (2002) 5515–5520.
[12] P.J. Paddison, A.A. Caudy, G.J. Hannon, Stable suppression of gene expression by RNAi in mammalian cell, Proc. Natl. Acad. Sci. USA 99 (2002) 1443–1448. [13] A. Naito, M. Narikiyo, Y. Yamada, M. Ueno, K. Kamada, T. Hachisuka, R. Yoriki, T. Mizuno, Y. Nakajima, A clinical and immunohistochemical study on gastrointestinal mesenchymal tumor (GIMT): RCAS1 as a predictor for recurrence of GMT, Oncol. Rep. 14 (2005) 1127–1132. [14] H. Kato, M. Nakajima, N. Masuda, A. Faried, M. Sohda, Y. Fukai, T. Miyazaki, M. Fukuchi, K. Tsukada, H. Kuwano, Expression of RCAS1 in esophageal squamous cell carcinoma is associated with a poor prognosis, J. Surg. Oncol. 90 (2005) 89–94. [15] T. Matsushima, M. Nakashima, K. Oshima, Y. Abe, J. Nishimura, H. Nawata, T. Watanabe, K. Muta, Receptor binding cancer antigen expressed on SiSo cells, a novel regulator of apoptosis of erythroid progenitor cells, Blood 98 (2001) 313–321. [16] S.H. Chiou, B.C. Sheu, W.C. Chang, S.C. Huang, H. HongNerng, Current concepts of tumor-infiltrating lymphocytes in human malignancies, J. Reprod. Immunol. 67 (2005) 35– 50. [17] M. Fukuda, A. Tanaka, A. Hamao, S. Suzuki, K. Kusama, H. Sakashita, Expression of RCAS1 and its function in human squamous cell carcinoma of the oral cavity, Oncol. Rep. 12 (2004) 259–267. [18] M. Tewari, L.T. Quan, K. O’Rourke, S. Desnoyers, Z. Zeng, D.R. Beidler, G.G. Poirier, G.S. Salvesen, V.M. Dixit, Yama/CPP32 beta, a mammalian homolog of CED3, is a CrmA-inhibitable protease that cleaves the death substrate poly (ADP-ribose) polymerase, Cell 81 (1995) 801–809. [19] M. Ikeguchi, K. Oi, Y. Hirooka, N. Kaibara, CD8+ lymphocyte infiltration and apoptosis in hepatocellular carcinoma, Eur. J. Surg. Oncol. 30 (2004) 53–57. [20] P.D. Gavin, J.O. Lloyd, D.S. Robert, The immunobiology of cancer immunosurveillance and immunoediting, Immunity 21 (2004) 137–148. [21] K. Sonoda, S. Miyamoto, T. Hirakawa, H. Yagi, F. Yotsumoto, M. Nakashima, T. Watanabe, H. Nakano, Association between RCAS1 expression and microenvironmental immune cell death in uterine cervical cancer, Gynecol. Oncol. 97 (2005) 772–779. [22] V. Shankaran, H. Ikeda, A.T. Bruce, J.M. White, P.E. Swanson, L.J. Old, R.D. Schreiber, IFNc and lymphocytes prevent primary tumour development and shape tumour immunogenicity, Nature 410 (2001) 1107–1111.
Cancer Letters 257 (2007) 182–190 www.elsevier.com/locate/canlet
Knockdown of RCAS1 expression by RNA interference recovers T cell growth and proliferation q Yuan Han a, Wenxin Qin b, Gang Huang
a,*
a
b
Department of Nuclear Medicine, Renji Hospital, Shanghai Jiao Tong University School of Medicine, No. 145 Middle Shandong Road, Shanghai 200001, People’s Republic of China National Laboratory for Oncogenes and Related Genes, WHO Collaborating Center for Research on Cancer, Shanghai Cancer Institute, Shanghai Jiao Tong University School of Medicine, Shanghai 200032, People’s Republic of China Received 18 March 2007; received in revised form 28 May 2007; accepted 16 July 2007
Abstract Receptor binding cancer antigen expressed on SiSo cells (RCAS1), a tumor-associated antigen, was expressed in various malignant tissues. It is involved in the tumor immune escape. Here, we reported the evidence that knockdown of RCAS1 expression by RNA interference can recovers T cell growth and proliferation. We designed a small hairpin RNA to knockdown RCAS1 expression in MCF-7 cells effectively. Adding RCAS1 protein resulted in a reduced T cell growth rate, an increased T cell apoptosis ratio, the higher activity of Caspase-3 proteases, and decreased IFN-c secretion. The suppression of RCAS1 expression effectively recover T cell proliferation, reduce apoptosis and partially reverse the T cell function of IFN-c secretion. 2007 Elsevier Ireland Ltd. All rights reserved. Keywords: RCAS1; RNA interference; T lymphocyte; Recover
1. Introduction The last 15 years have seen a re-emergence of interest in cancer immunosurveillance. Recent work has shown that the immune system may also promote the emergence of primary tumors with reduced immunogenicity that are capable of escaping immune recognition and destruction [22]. Adaptive and innate immune cells play critical roles in cancer immunosurveillance. q
Grant support: The Nation Natural Science Foundation of China Grant 30470497. * Corresponding author. Tel.: +86 21 53882166. E-mail address: [email protected] (G. Huang).
A tumor-associated antigen, recognized by monoclonal antibody 22-1-1, was cloned and designated as receptor binding cancer antigen expressed on SiSo cells (RCAS1) [1]. RCAS1 was also isolated from MCF-7 cells derived from a human breast cancer as a novel estrogen-responsive gene, ER-binding fragment-associated antigen 9 (EBAG9) [2]. RCAS1/EBAG9 is a type-II membranous protein and also exists in soluble form [1]. In previous immunohistochemical studies, RCAS1 was expressed in various malignant tissues [3–8], including lung cancer, breast cancer, uterine carcinoma, bile duct carcinoma, liver cancer, gastric carcinoma and so on. Soluble RCAS1 has been detected by enzyme-linked immunosorbent assay (ELISA) in a
0304-3835/$ - see front matter 2007 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2007.07.016
Y. Han et al. / Cancer Letters 257 (2007) 182–190
culture supernatant derived from a human bile duct carcinoma cell line [9]. It has been described that RCAS1 acts as a ligand for a putative receptor present on normal cells, such as peripheral blood lymphocytes, inhibits the growth of receptorexpressing cells in vitro and induces apoptotic cell death [1]. Therefore, it has been generally recognized that RCAS1 is involved in the tumor immune escape. Owing to its importance in tumor immunosurveillance, RCAS1 might be a suitable target for gene therapy approaches. RNA interference, a new technique developed in the late 2000s, has gained much attention for its powerful ability to suppress gene expression. It is an evolutionarily conserved phenomenon and a multistep process that involves generation of active small interfering RNA (siRNA) in vivo through the action of an RNase III endonuclease, Dicer. The resulting 21- to 23-nt siRNA mediates degradation of the complementary homologous RNA [10]. Recently, a DNA vector-based small hairpin RNA (shRNA) technology that allows the synthesis of shRNA from DNA template has been developed to efficiently inhibit endogenous gene expression in mammalian cells [11,12]. In this report, we described that a DNA vectormediated shRNA technology was utilized to knock down RCAS1 expression in MCF-7 cells, in order to observe the changes in growth and function of T cell. 2. Materials and methods 2.1. Cell line and cell culture MCF-7 cells were cultured in DMEM with 10% fetal bovine serum (FBS), 100 U/mL of penicillin, and 100 lg/mL of streptomycin at 37 C in 5% CO2. 2.2. Reagents The RCAS1 ELISA kit was purchased from MBL Co., Ltd., Japan. Annexin V-FITC apoptosis detection kit and Cycle TESTTM PLUS DNA Reagent kit were purchased from BD Biosciences Pharmingen, USA. Human IL-2, IL-4, IFN-c ELISA kits, and mouse anti-human CD8 FITC/CD4 PE/CD3 PE-Cy5 were purchased from Jingmei Biotech Co., Ltd., China. Caspase-3 antibody and cleaved Caspase-3 antibody were purchased from Cell Signaling Technology, Inc. The Taqman-MGB probe and primer of RCAS1 was designed by Applied Biosystem, USA. (The sequence was not published by ABI.)
183
2.3. Construction of small hairpin RNA plasmid vector and HA-tag RCAS1 overexpression vector The shRNA expressing vector PSG was reconstructed according to vector pSURER (Oligoengine Co., USA). To ensure the 19-nucleotide sequences of the RCAS1-specific shRNAs (Rl, R2, R3, R4, R5) and scrambled control shRNA (SC) had no significant homology with other known human genes (Table 1), we used the sequences of these two types of RNA to perform a BLAST search against the human genome database. The six pairs of complementary oligonucleotides (Table 1) were synthesized (BioAsia, Co., Shanghai), then annealed to generate double-stranded DNAs and ligated into the linearized empty vector PSG Plasmids were verified by sequence analysis (United Gene Holdings, Ltd., Shanghai). The full length of RCAS1 sequence was connected with the empty pCMV-HA2 (Clontech Laboratories, Inc., USA) digested with Xho I and Xba I and catalyzed by T4 DNA ligase. The product was transformed into TOP10, then transferred onto LB (Luria-Bentani) plate containing ampicillin and incubated at 37 C overnight. The single colony was picked up to enlarge the culture. The correct insert in positive colonies was identified by sequence analysis (completed by United Gene Holdings, Ltd., Shanghai, China). We successfully constructed HA-tag overexpression vector plasmid pCMV-HA2RCAS1. 2.4. Transfection Transfection of plasmid DNAs into MCF-7 cells was done using LipofectAMINE2000 (Invitrogen, Carlsbad, CA). Briefly 1 · 105 well-lived MCF-7 cells were seeded per well into 6-well plate (Corning, Inc., Corning, NY), and cultured overnight to the density of 70% confluence. RNA interfering vector plasmid and HA-tag RCAS1 overexpression vector plasmid 2 lg (PSG-R/pCMVHA2-RCAS1 = 9:1) were added to 250 lL serum-free DMEM. Plasmid pCMV-HA2-RCAS1 0.2 lg was added to 250 lL serum-free DMEM as a positive control. LipofectAMINE2000 10 lL was added to 250 lL serum-free DMEM. These solutions were mixed and incubated for 20 min at room temperature. The cells were washed twice with serum-free DMEM. The mixture of plasmid and lipofectAMINE2000 was added up to 2 mL and transferred to 6-well plate. After 6 h, the medium was changed in each well to DMEM medium containing 10% FCS. 1 · 105 well-lived MCF-7 cells were seeded per well into 6-well plate, and cultured overnight to the density of 70% confluence. RNA interfering vector plasmid (PSG-R2, PSG-SC) 2 lg and LipofectAMINE2000 10 lL were added to 250 lL serum-free DMEM, respectively. The two solutions were mixed and incubated for 20 min at room temperature. The cells were washed twice
184
Y. Han et al. / Cancer Letters 257 (2007) 182–190
Table 1 Hairpin siRNA insert sequence Sequence
Target nucleotide sequence on RCAS1 cDNA
R1
GATCCCCGGACGGAAATTAAGTGGAGTTCAA GAGACTCCACTTAATTTCCGTCCTTTTTGGAAA
94–112
R2
GATCCCCGGAGGGAATGGGAATGTGGTTCAA GAGACCACATTCCCATTCCCTCCTTTTTGGAAA
223–241
R3
GATCCCCGGAAGAAAATGGAAAAGGATTCA AGAGATCCTTTTCCATTTTCTTCCTTTTTGGAAA
486–504
R4
GATCCCCATAACTTTGCCAACTACAGTTCAA GAGACTGTAGTTGGCAAAGTTATTTTTTGGAAA
118–136
R5
GATCCCCTTAGGTGACTTAGATACCTTTCAAG AGAAGGTATCTAAGTCACCTAATTTTTGGAAA
436–454
SC
GATCCCCATAGGGCGTACGATTATCATTCAAG AGATGATAATCGTACGCCCTATTTTTTGGAAA
Bases underlined can form shRNA targeting RCAS1 cDNA.
with serum-free DMEM. The mixture of plasmid and LipofectAMINE2000 was added up to 2 mL and transferred to 6-well plate. After 6 h, the medium was changed in each well to DMEM medium containing 10% FCS. After being incubated for 48 h, the cells were cultured and screened in the medium containing 10% serum and 1 mg/mL G418 (Invitrogen). When nontransfected cells were completely killed, the medium was changed to 0.4 mg/mL G418 medium to sustain the culture, until the individual colonies were cloned large enough to be transferred one by one into 96-well plate to propagate the culture (MCF-7-R2, MCF-7-SC). When MCF-7, stable transfected MCF-7-R2 and MCF-7-SC in 3.5-cm dish reached to 90% abundance, l mL RPMI1640 was added into each dish and incubated for 24 h at 37 C in humidified incubator with an atmosphere of 5% CO2. Then the supernatant of the cells was collected. 2.5. T cell culture The freshly isolated human PBLs were transferred into 24-well plate coated with anti-CD3 (1.0 lg/mL) and antiCD28 (0.5 lg/mL) antibody, 2 · 106 cells/well. These cells were cultured in the RPMI1640 (Gibco BRL) medium containing 10% FCS 0.1 mmol/L, nonessential amino acid (Gibco BRL), sodium pyruvate 1 mmol/L, L-glutamine 2 mmol/L, 2-mercaptoethanol 0.05 mmol/L (Sigma), penicillin 100 U/mL and streptomycin 100 lg/mL, and incubated at 37 C in humidified incubator with an atmosphere of 5% CO2. 2.6. Real-time PCR Total RNAs were extracted with Trizol. After the amount of total RNA were determined using ultraviolet (UV) spectrophotometry, the RNA was reverse transcribed
into cDNA using a cDNA 1st Strand Synthesis Kit (Invitrogen) (according to the manufacturer’s instructions). Reverse transcription of total RNA (5.0 lg) was performed with the mixture with dNTP and Oligo(dT) for 5 min at 65 C, followed by 1 min on ice, the addition of reaction solution for 2 min at 42 C, the addition of Super Script II RT for 50 min at 42 C followed by 15 min at 70 C, and the addition of RNase H for 20 min at 37 C. Real-time PCR reaction system contains 2.5 lL 10 · Taqman buffer A, 3.5 lL 25 mM MgCl2, 0.5 lL each of dATP (10 mM), dCTP (10 mM), dGTP (10 mM) and dUTP (20 mM), 1.25 lL Taqman-MGB expression probe and primer mixture (20·), 0.25 lL AmpErase UNG, 0.125 lL AmpliTaq polymerase (5.0 U/ lL), 2 lL cDNA, and sterile ddH2O in a total volume of 25 lL. The tubes were incubated at 50 C for 2 min and 95 C for 10 min to activate AmpliTaq polymerase; 40 cycles of PCR amplification were performed as follows: denature 95 C for 15 s, anneal/extend 60 C for 60 s. The PCR reaction was proceeded on AB17300 instrument and real-time detected by the fluorescence value of each extend stage. Data analysis was automatically accomplished by ABI 7300 system software SDS, which generates an amplification curve related to PCR cycle and DRn to determine the Ct value (the threshold cycle number). The amount of sample cDNA was estimated by the ratio of Ct value of cDNA and that of housekeeperb-actin gene.
2.7. ELISA The sample was performed according to manufacturer’s instructions. One hundred microliter sample was added into monoclonal antigen coated 96-well plate and incubated for 60 min at 37 C. The fluid in the wells was discarded and the wells were washed 4 times. One hundred microliter of horseradish peroxidase (HRP) conjugated biotin was added and incubated for 60 min at 37 C. The
Y. Han et al. / Cancer Letters 257 (2007) 182–190
fluid in the wells was discarded and the wells were washed another 4 times. One hundred microliter of substrate was added to the wells and incubated for 10 min at 37 C, followed by the addition of 100 lL stopping solution. The OD value of each well was measured at 450 nm by Muti-detection Microplate Reader SpectraMax M5 (MD Company). Each sample was repeated in 5 wells and the experiment was repeated 5 times. 2.8. Western blot The cells were collected and lyzed with T-PER tissue protein extract. The protein concentration of whole cell lysates were measured using the BCA protein assay kit. The proteins were separated by 12% SDS–PAGE and transferred onto NC membranes. The membranes were rinsed with TBST and incubated in blocking buffer for 1 h, followed by incubation with primary antibodies overnight at 4 C. After being washed with TBST, the membranes were incubated with secondary antibodies for 1 h. Signal was detected by autoradiography. 2.9. Determination of cell growth curve PBLs were treated with CD3/CD28 for 48 h, and inoculated into 96-well plate. One hundred microliter supernatant of MCF-7, MCF-7-R2, MCF-7-SC was added into the wells respectively, and 100 lL RPMI1640 was added as a control. IL-2 was also added to a final concentration of 60 IU/mL. The cell growth curve was measured by MTS according to manufacturer’s instructions. After the supernatant being discarded, 100 lL MTS was added into each well and incubated for 4 h at 37 C in the dark with an atmosphere of 5% CO2. The OD value of each well was measured at 490 nm. Each group was repeated in 5 wells and measured in successive 5 days. The experiment was repeated 3 times.
185
fer. Five microliter of Annexin V-PE and 5 lL 7-AAD were added into each sample and incubated for 15 min at room temperature in the dark. The samples were analyzed by Flow Cytometer. Repeat the experiment 5 times. 2.12. CD4/CD8 classification analysis T cells were collected and washed twice with PBS. After the cells being suspended in 100 lL PBS, 30 lL rat-anti-human CD3 PE-Cy5/CD4 FITC/CD8 PE labeled antibodies were added into each sample and incubated for 20 min at room temperature in the dark. The cells collected by centrifugation at 1000 rpm/min for 5 min. After the supernatant being discarded, the cells were washed twice with PBS and resuspended. The percentage of CD4+ and CD8+ T cells were detected by Flow Cytometer. Repeat the experiment 5 times. 2.13. Statistical analysis All statistical analyses between experimental group and negative control group were performed using Student’s paired t tests. 3. Results 3.1. Identification of effective shRNA sequence Five shRNA vectors (PSG-R1–PSG-R5) and one scrambled control vector (PSG-SC) were cotranstected with HA-tag RCAS1 overexpression vector (pCMVHA2-RCAS1) into MCF-7 cells. After 48 h, proteins were extracted and the tagged protein HA was detected by Western blot. The results show that the expression of RCAS1 can be obviously inhibited by shRNA sequence Rl, R2 and R3, among which R2 is the most efficient one, but it cannot be reduced by sequence R4, R5 and scrambled SC (Fig. 1).
2.10. Cell cycle analysis T cells were performed according to manufacturer’s instructions as follows: after cells being washed 3 times, 250 lL solution A was added into each sample and stood for 10 min at room temperature, followed by the addition of 200 lL solution B into each sample and standing for another 10 min at room temperature. Two hundred microliter solution C was finally added into each sample and stood for 10 min on ice in the dark. The samples were analyzed by Flow Cytometer. The experiment was repeated 5 times. 2.11. Cell apoptosis analysis Cells were collected and performed according to manufacturer’s instructions as follows: these cells were washed twice by ice-cold PBS and resuspended in 1 · binding buf-
3.2. Suppression of RCAS1 expression in MCF-7 cell by shRNA The shRNA vector containing coding sequence R2 and the negative control vector containing coding scrambled sequence SC were transfected to MCF-7 cells, respectively. The stable transfected cell lines MCF-7-R2 and MCF-7-SC were obtained through the selection of G418. To test the silencing, we examined the mRNA and protein expression level in MCF-7, MCF-7-R2 and MCF-7-SC cell lines. 3.2.1. Real-time PCR The integrity of cDNA was verified by the Ct value fluctuating between 17 and 20 in each cell line. The Ct (RCAS1)/Ct (b-actin) implies that the mRNA level of RCAS1 in MCF-7-R2 cells is significantly lower than that
186
Y. Han et al. / Cancer Letters 257 (2007) 182–190
3.3.1. T cell growth curve T cell growth was inhibited when the supernatant of MCF-7 and MCF-7-SC cell cultures was added, respectively, and incubated for 72 h, but T cells maintained their normal proliferation when the supernatant of MCF-R2 was added (Fig. 3a). Fig. 1. The expression of tagged protein HA was measured by Western blotting. Expression of RCAS1 can be obviously inhibited by shRNA sequence R1, R2 and R3, among which R2 is the most efficient one, but it cannot be reduced by sequence R4, R5 and scrambled SC. b-Actin was used as an internal control. (1–5) 5 shRNA vectors (PSG-R1–R5) were cotransfected with HA-tag RCAS1 overexpression vector (pCMV-HA2RCAS1) into MCF-7 cells respectively. (6) One negative control vector (PSG-SC) was cotransfected with pCMV-HA2-RCAS1 into MCF-7 cells. (7) pCMV-HA2-RCAS1 was transfected into MCF-7 cells alone.
in MCF-7 cells (P < 0.01), but there are no significant statistical differences between MCF-7-SC and MCF-7 cells (P > 0.05) (Fig. 2a). 3.2.2. ELISA When each kind of cells reached to 90% abundance in 3.5 cm dishes, 1 mL DMEM was added and incubated for 24 h. The supernatant was collected and detected for the amount of protein RCAS1 by ELISA. The results of protein detection in MCF-7, MCF-7-R2 and MCF-7-SC show that the protein RCAS1 expression in MCF-7-R2 cells is significantly lower (75% reduction) than that in MCF-7 cells (P < 0.01), but there are no significant statistical differences between MCF-7-SC and MCF-7 cells (P > 0.05), consistent with the previous finding obtained from mRNA detection (Fig. 2b). 3.3. Effects of RCAS1-specific shRNA on proliferation and the development of T cell T cell proliferation and development was reversed by shRNA mediated inhibition of RCAS1 expression.
3.3.2. T cell cycle The supernatant of MCF-7, MCF-7-R2 and MCF-7SC cell cultures and RPMI1640 were added to T cells, respectively. After 72 h cultures, T cells were collected. The measurement of T cell cycle shows that the T cells of S phase in the supernatant of group MCF-7 and MCF-7-SC are far more than that in RPMI1640 (P < 0.001), whereas there are no significant statistical differences between T cells of all phases in the supernatant of group MCF-7-R2 and that in RPMI1640 (P > 0.05) (Fig. 3b). 3.4. Effects of RCAS1-specific shRNA on apoptosis of T cell shRNA mediated inhibition of RCAS1 expression reduced T cell apoptosis. The above four groups of T cells were analyzed after 3 days cultures. 3.4.1. T cell apoptosis analysis After the addition of the supernatant of group MCF-7, MCF-7-SC followed by 3 days culture, the apoptosis ratios of T cells in these two groups are significantly higher than that of group MCF-R2 and negative control group RPMI1640 (P < 0.001) (Fig. 4a). 3.4.2. Assessment of T cell Caspase-3 activity by Western blot After the addition of the supernatant of group MCF-7 and MCF-7-SC, the activity of Caspase-3 proteases in group MCF-7 and MCF-7-SC is significantly higher than that in group RPMI1640, whereas there are no significant statistical differences between group MCF-7-R2 and RPMI1640 (Fig. 4b).
Fig. 2. RCAS1 expression in MCF-7 is suppressed by shRNA. (a) Real-time PCR; (b) ELISA. (1) MCF-7-R2; (2) MCF-7-SC; (3) MCF-7; (*P < 0.01).
Y. Han et al. / Cancer Letters 257 (2007) 182–190
187
Fig. 3. T cell proliferation was recovered by RCAS1-specific shRNA. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture respectively. (a) T cell growth curve, (b) T cell cycle analysis.
3.4.3. CD4/CD8 classification analysis Compared with the negative control group RPMI1640, the CD4+ T cells in group MCF-7 and MCF-7-SC appear to decline, but there are no statistical significant differences (P > 0.05). There are no significant statistical differences among the ratios of CD8+ T cells in each group (Fig. 4c).
MCF-7-R2 was added, the secretion of IFN-c was markedly reduced compared with RPMI1640 group (P < .001), especially in group MCF-7 and MCF-7-SC. In addition, the amount of IFN-c in group MCF-7 and MCF-7-SC is also much lower than that of group MCF-7-R2 (P < 0.001) (Fig. 5).
3.5. Effects of RCAS1-specific shRNA on cytokines secretion of T cell
4. Discussion
After the above 4 groups of T cells were cultured for 3 days, the supernatant of each group was collected and detected for the concentration of IL-2, IL-4 and IFN-c by ELISA. There are no significant differences on IL-2 and IL-4 concentration among groups (P > 0.05). After the supernatant of group MCF-7, MCF-7-SC and
Tumor is considered as a systematic disease, the cause not only of mere over-proliferation of cells, but also of the interaction between each system and surrounding microenvironment, in which the immune system plays an important role. The immunological surveillance (immunological cells, such as
188
Y. Han et al. / Cancer Letters 257 (2007) 182–190
Fig. 4. T cell apoptosis was decreased by RCAS1-specific shRNA. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture respectively. (a) T cell apoptosis rate; (b) assessment of T cell Caspase-3 activity by Western blot; (c) CD4/CD8 classification analysis.
cytotoxic lymphocytes, CTL, NK cells), as a system expected to protect organism itself and maintain homeostasis, can recognize and lyze tumor cells in some tumor antigen expressed tumor cells, but is evaded in the other tumor cells, even though the tumor associated antigens are increasingly expressed.
Fig. 5. Effect of RCAS1 -specific shRNA on cytokines secretion of T cell. RPMI1640 (1), supernatant of MCF-7-R2, MCF-7-SC, and MCF-7 cell culture (2–4) was added in T cell culture, respectively. The concentration of IL-2, IL-4 and IFN-c was detected by ELISA.
RCAS1 is a recently discovered tumor-associated antigen. In our previous study, RCAS1 is highly expressed in human breast cancer cell line MCF-7. Clinicopathologic study shows that it is highly expressed in all tumor tissues. Despite of RCAS1 positive rate ranging from 45% to 85% in focal tumor tissues, it reaches to almost 100% in metastatic tissues, such as lymphoid nodes. Moreover, the extent of RCAS1 expression is correlated with differentiation, metastasis, recurrence and survival time. Its expression is usually elevated in low differentiation and high malignant tumor cell surface [3– 8,13,14]. RCAS1 can promote apoptosis of RCAS1 receptor expressed cells, such as CD3+T cells and NK cells [1]. Therefore, it is speculated that tumor cells may escape from immunological surveillance by expressing RCAS1. RNA interference is a newly developed method in recent years, specific for gene inhibition. It is also successfully applied in mammal cells. Due to its convenience for operating and high efficacy for target-
Y. Han et al. / Cancer Letters 257 (2007) 182–190
ing gene inhibition, it is becoming a powerful tool for gene study. This experiment adopted DNA vector-dependent shRNA (small hairpin RNA) expression system to successfully inhibit endogenous RCAS1 expression in tumor cells. DNA vector mediated shRNA expression system formed shRNAs, which were quickly processed into 21–23 nucleotides in length to exert repression. Having overcome the weakness of temporal repression of chemosynthesis in transient transfection, this system is becoming a promising tool for genetic therapy. This study adopted DNA vector mediated shRNA expression system, transfected highly expressed RCAS1 MCF-7 cell line, screened out three effective targeting interfering sites which were 94bp–112bp, 223bp–241bp and 486bp–504bp, among which 223bp–241bp is the most efficient one, inhibiting secreted RCAS1 up to 75%. There are evidence [1,3,7,16,17] showed that RCAS1 can induce and promote apoptosis of CD3+ T cells and NK cells; tumor tissue sections illuminate that Tumor-infiltrating lymphocytes (TILs) are remarkably reduced on the vicinity of highly expressed RCAS1 tumor cells. Our results are consistent with these findings. When the supernatant, rich in RCAS1, obtained from MCF-7 and MCF-7-SC cell cultures were added respectively, the lyzed Caspase-3 proteins of CD3/CD28 antigens activated T cells were increased and the T cell apoptosis ratio was elevated accordingly. Caspase-3, as an important protein in apoptosis associated pathway, can lead to cleavage of many critical proteins, such as poly (ADP-ribose) polymerase (PARP), and result in apoptosis when lyzed to 17 kDa activated Caspase-3 [18]. The number of cells is determined by two factors, cell proliferation and apoptosis. The cell proliferation study demonstrates that RCAS1 induces T cell arrest in S phase, markedly inhibition of T cell growth. However, when RCAS1 expression is shRNA inhibited, the changes are effectively reversed. The apoptosis ratio of T cells is obviously decreased and cell cycle and growth are restored to normal state. CD3+ T cells classification analysis suggests that RCAS1 proteins have no significant influence on CD8+ T cell proportion and have the tendency to attenuate CD4+ T cells. Ikeguchi et al. [19] has reported that RCAS1 protein may not regulate the density of CD8+ TILs in hepatic cellular cancer tissue. In the whole network of immunological surveillance, besides T cells playing the important role, the cytokines, especially IFN-c, also take part in
189
[20]. It is reported that by injecting IFN-c monoclonal antibodies to inhibit IFN-c function, the growth of transplanted fibrosarcoma is obviously speed up. Our study discloses that RCAS1 proteins not only induce T cell apoptosis and repress T cell growth, but also inhibit the function of IFN-c that T cells secreted, which seriously damages the immunological surveillance network and helps tumor cells escape from clearance of immunological surveillance, resulting in tumor cells growth and progress. After shRNA suppression of RCAS1 expression, the function of IFN-c that T cells secreted were partially reversed. In addition to RCAS1, Fas ligand (FasL) and atumor necrosis factor (TNF-a) may induce lymphocytes apoptosis. Matsushima et al. [15] has reported that even blocking Fas by Fas antibodies, RCAS1 can still induce T cells apoptosis. Uterine cervix cancer patients’ sections display [21] that RCAS1 expression is remarkably higher in metastatic lymphoid nodes than primary lesions. What is more, the lymphocyte apoptosis ratio has positive correlation with RCAS1 expression, but has no correlation with FasL and TNF-a. The evidences suggest that the pathway by which RCAS1 induces T cell apoptosis is different from Fas/FasL system and TNF-a. Our study shows that only one RCAS1 gene interfered results in apoptosis ratio decreasing to a great extent from 33.67% to 10.03%, but normal proliferation is generally recovered. It is thus inferred that as for T cell growth, the function of RCAS1 proteins is not Fas/FasL system or TNF-a dependent, but playing the substantial role independently. Perhaps it is the existence of multiple apoptotic factors that leads to incompletely recovered function that T cell secreted IFN-c. On the whole, 19-nt sequence targeting RCAS1 cDNA at nucleotide 223–241 is the most effective interfering site. The inhibition of RCAS1 expression can effectively recover T cell proliferation, reduce apoptosis and partially reverse the T cell function of IFN-c secretion. The RNA interference that inhibits RCAS1 expression, recovers T cell functions, prevents from immune evasion, and positively clears tumor cells by autoimmune system, may be a novel and potential tumor treatment. The mechanism of RCAS1 inhibition of T cell growth needs to be explored still further. Acknowledgements We thank Li Xie, Genfu Yao, and Haiyan You for their skillful technical supports.
190
Y. Han et al. / Cancer Letters 257 (2007) 182–190
References [1] M. Nakashima, K. Sonoda, T. Watanabe, Inhibition of cell growth and induction of apoptotic cell death by the human tumor-associated antigen RCAS1, Nature Med. 5 (1999) 938–942. [2] T. Watanabe, S. Inoue, H. Hiroi, A. Orimo, H. Kawashima, M. Muramatsu, Isolation of estrogen-responsive genes with a CpG island library, Mol. Cell. Biol. 18 (1998) 442–449. [3] M. Izumi, Y. Nakanishi, I. Yoshino, M. Nakashima, T. Watanabe, N. Hara, Expression of tumor-associated antigen RCAS1 correlates significantly with poor prognosis in nonsmall cell lung carcinoma, Cancer 92 (2001) 446–451. [4] T. Suzuki, S. Inoue, W. Kawabata, J. Akahira, T. Moriya, F. Tsuchiya, S. Ogawa, M. Muramatsu, H. Sasana, EBAG9/ RCAS1 in human breast carcinoma: a possible factor in endocrine-immune interactions, Br. J. Cancer 85 (2001) 1731–1737. [5] K. Sonada, S. Miyamoto, T. Hirakawa, T. Kaku, M. Nakashima, T. Watanabe, K. Akazawa, T. Fujita, H. Nakano, Association between RCAS1 expression and clinical outcome in uterine endometrial cancer, Br. J. Cancer 89 (2003) 546–551. [6] T. Oshikiri, Y. Hida, M. Miyamoto, H. Hashida, K. Katoh, M. Suzuoki, Y. Nakakubo, K. Hiraoka, T. Shinohara, T. Itoh, S. Konda, H. Katoh, RCAS1 as a tumour progression marker: an independent negative prognostic factor in gallbladder cancer, Br. J. Cancer 85 (2001) 1922–1927. [7] K. Noguchi, M. Enjoji, M. Nakamuta, M. Nakashima, H. Nishi, I. Choi, K. Taguchi, K. Kotoh, M. Shimada, K. Sugimachi, M. Tsuneyoshi, H. Nawata, T. Watanabe, Expression of a tumor-associated antigen RCAS1 in hepatocellular carcinoma, Cancer Lett. 168 (2001) 197–202. [8] M. Kubokawa, M. Nakashima, T. Yao, K.I. Ito, N. Harda, H. Nawata, T. Watanabe, Aberrant intracellular localization of RCAS1 is associated with tumor progression of gastric cancer, Int. J. Oncol. 19 (2001) 695–700. [9] M. Enjoji, M. Nakashima, H. Nishi, I. Choi, H. Oimomi, R. Sugimoto, K. Kotoh, K. Taguchi, M. Nakamuta, H. Nawata, T. Watanabe, The tumor-associated antigen, RCAS1, can be expressed in immune-mediated diseases as well as in carcinomas of biliary tract, J. Hepatol. 36 (2002) 786–792. [10] S.M. Elbashir, J. Harborth, W. Lendechel, et al., Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411 (2001) 494–498. [11] G. Sui, C. Soohoo, B. Affarel, et al., A DNA vector based RNAi technology to suppress gene expression in mammalian cells, Proc. Natl. Acad. Sci. USA 99 (2002) 5515–5520.
[12] P.J. Paddison, A.A. Caudy, G.J. Hannon, Stable suppression of gene expression by RNAi in mammalian cell, Proc. Natl. Acad. Sci. USA 99 (2002) 1443–1448. [13] A. Naito, M. Narikiyo, Y. Yamada, M. Ueno, K. Kamada, T. Hachisuka, R. Yoriki, T. Mizuno, Y. Nakajima, A clinical and immunohistochemical study on gastrointestinal mesenchymal tumor (GIMT): RCAS1 as a predictor for recurrence of GMT, Oncol. Rep. 14 (2005) 1127–1132. [14] H. Kato, M. Nakajima, N. Masuda, A. Faried, M. Sohda, Y. Fukai, T. Miyazaki, M. Fukuchi, K. Tsukada, H. Kuwano, Expression of RCAS1 in esophageal squamous cell carcinoma is associated with a poor prognosis, J. Surg. Oncol. 90 (2005) 89–94. [15] T. Matsushima, M. Nakashima, K. Oshima, Y. Abe, J. Nishimura, H. Nawata, T. Watanabe, K. Muta, Receptor binding cancer antigen expressed on SiSo cells, a novel regulator of apoptosis of erythroid progenitor cells, Blood 98 (2001) 313–321. [16] S.H. Chiou, B.C. Sheu, W.C. Chang, S.C. Huang, H. HongNerng, Current concepts of tumor-infiltrating lymphocytes in human malignancies, J. Reprod. Immunol. 67 (2005) 35– 50. [17] M. Fukuda, A. Tanaka, A. Hamao, S. Suzuki, K. Kusama, H. Sakashita, Expression of RCAS1 and its function in human squamous cell carcinoma of the oral cavity, Oncol. Rep. 12 (2004) 259–267. [18] M. Tewari, L.T. Quan, K. O’Rourke, S. Desnoyers, Z. Zeng, D.R. Beidler, G.G. Poirier, G.S. Salvesen, V.M. Dixit, Yama/CPP32 beta, a mammalian homolog of CED3, is a CrmA-inhibitable protease that cleaves the death substrate poly (ADP-ribose) polymerase, Cell 81 (1995) 801–809. [19] M. Ikeguchi, K. Oi, Y. Hirooka, N. Kaibara, CD8+ lymphocyte infiltration and apoptosis in hepatocellular carcinoma, Eur. J. Surg. Oncol. 30 (2004) 53–57. [20] P.D. Gavin, J.O. Lloyd, D.S. Robert, The immunobiology of cancer immunosurveillance and immunoediting, Immunity 21 (2004) 137–148. [21] K. Sonoda, S. Miyamoto, T. Hirakawa, H. Yagi, F. Yotsumoto, M. Nakashima, T. Watanabe, H. Nakano, Association between RCAS1 expression and microenvironmental immune cell death in uterine cervical cancer, Gynecol. Oncol. 97 (2005) 772–779. [22] V. Shankaran, H. Ikeda, A.T. Bruce, J.M. White, P.E. Swanson, L.J. Old, R.D. Schreiber, IFNc and lymphocytes prevent primary tumour development and shape tumour immunogenicity, Nature 410 (2001) 1107–1111.