- Email: [email protected]
Akt signaling pathway
Biochemical and Biophysical Research Communications xxx (2018) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway Xiaoyan Hu a, Jincheng Luo a, Hehuan Lai a, Mengdi Li a, Xiaolin Zheng b, Tingting Nie a, Fenglan Li a, Hui Li a, * a
The Department of Biochemistry and Molecular Biology, Harbin Medical University, Baojian Road 157, Nangang District, Harbin City, Heilongjiang, 150086, China The Department of Anatomy, Harbin Medical University, Baojian Road 157, Nangang District, Harbin City, Heilongjiang, 150086, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 May 2018 Accepted 10 May 2018 Available online xxx
The tRNA selenocysteine 1 associated protein 1 (Trnau1ap, initially named SECp43) is involved in Selenocysteine (Sec) biosynthesis and incorporation into selenoproteins, which play a key role in biological processes, such as embryonic development. We previously reported that downregulation of Trnau1ap inhibited proliferation of cardiomyocyte-like H9c2 cells. However, the effects of Trnau1ap on cell proliferation and migration of embryonic development are not known, and the mechanisms remain elusive. Herein, lentiviral shRNA vectors were transfected in NIH3T3, JEG-3 and Bewo cells (embryonic, trophoblast and placental cells). We found that knockdown of Trnau1ap resulted in reduced expression levels of selenoproteins. The data of Cell Count Kit-8 (CCK-8) assay and wound scratch assay revealed the proliferation and migration rates were reduced in the Trnau1ap-shRNA groups. Furthermore, western blot analysis showed that the phosphorylation level of Akt in the phosphatidylinositol 3-kinase (PI3K)/ Akt pathway was attenuated. These results indicate that Trnau1ap plays an important role in regulation of cell proliferation and migration through the PI3K/Akt signaling pathway, as well as being essential for embryonic development by regulating the expression of selenoproteins. © 2018 Published by Elsevier Inc.
Keywords: TRNA selenocysteine 1 associated protein 1 Selenoprotein Lentiviral shRNA Proliferation Migration
1. Introduction Selenium is recognized as an essential trace element in mammals [1]. The main active form of selenium in selenoproteins is Sec, which is identified as the 21st amino acid to incorporate into selenoproteins [2,3]. The process of Sec biosynthesis requires Sec tRNA [Ser] Sec and Sec insertion sequence (SECIS) to redifine the UGA codon from a stop codon to the Sec codon [4,5]. And the process of Sec incorporation needs several cis- and trans-acting factors, such as SECIS, Translation initiation factor (eIF4A3), Trnau1ap, soluble liver antigen (SLA), SECIS binding protein 2 (SBP2), Ribosomal Protein (RPL30), Sec Elongation Factor (EFsec), Selenophosphate Synthetase 1 (SPS1) and Selenophosphate Synthetase 2 (SPS2) [6]. The SECIS element with a stem-loop structure locates at the 30 untranslated region of selenoprotein mRNAs. SBP2 binds to the SECIS element, and associates with other factors, then translocate to the ribosome [7]. RPL30 on the ribosome is recognized as the
* Corresponding author. E-mail address: [email protected] (H. Li).
second binding protein of the SECIS element [8]. SPS2 is a selenoenzyme as well as a selenium donor that can promote the biosnythesis of selenoproteins, but knockdown of SPS1 could not influence the expression of selenoprotein, it was supposed to impact the recycling of Sec [9]. Another factor is Trnau1ap, which is identified as a globular and nuclear protein with 43 kDa, regulates the biosynthesis of selenoproteins with promoting the synthesis of Um34 on tRNA [Ser] Sec and the nuclear translocation of SLA in mammals [10,11]. Trnau1ap interacts with SLA, eIF4A3, EFsec, SBP2 and SPS1 to form a multiprotein complex. Meanwhile, it associates with Sec tRNA [Ser] Sec to promote its methylation [12]. Prevently, one research reported that constitutive deletion of exons 7 þ 8 of Trnau1ap was embryonic lethal, but there was no effect of Trnau1ap mutations on selenoprotein expression [13]. At least 25 selenoproteins in human and 24 selenoproteins in rodents have been identified [14]. Among these selenoproteins such as Glutathione Peroxidases (GPxs), Thioredoxin Reductases (TrxRs) and Iodothyronine Deiodinases (DIOs), selenoprotein N (SelN) and selenoprotein K (SelK) are associated with redox
https://doi.org/10.1016/j.bbrc.2018.05.065 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
2
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
reactions [15]. GPxs are performed to reduce cellular hydroperoxides [16]. And GPx4 is essential for spermatogenesis and embryogenesis [17]. TrxRs catalyze the reduction of oxidized thioredoxin by the oxidation of NADPH [18]. TrxR1 and TrxR2 are also essential for embryogenesis [19]. DIOs are identified as regulators in the metabolism of thyroid hormones [20]. SelN is identified to protect against cellular oxidative stress and play a role in redox-related calcium homeostasis [21]. Overexpression of SelK may improve the antioxidant activity of the heart [22]. It has been well known that the PI3K/Akt signaling pathway could be involved in cell proliferation, migration and cell fusion [23e25]. When PI3K is activated, the downstream factor Akt will be phosphorylated [26]. The phosphorylation sites include Threonine 308 and Serine 473 [27]. But the pathway with knockdown of Trnau1ap in cells is unknown. And several studies have reported the structure and location of Trnau1ap [10,11]. However, studies about the effects of Trnau1ap on cell proliferation and migration are seldom. Thus we constructed the lentiviral shRNA vectors to knock down the Trnau1ap. And our purpose is to find out cellular mechanisms about the Trnau1ap in NIH3T3, JEG-3 and Bewo cells. Finally, we found that knockdown of Trnau1ap inhibited cell proliferation and migration through attenuating the PI3K/Akt signaling pathway. 2. Materials and methods 2.1. Cell culture The mouse embryonic fibroblast cell line (NIH3T3), the human trophoblast choriocarcinoma cell line (JEG-3) and the placental choriocarcinoma cell line (Bewo) were purchased from ATCC. Cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen, USA) plus 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin (Biological Industries). And cells were cultured in an incubator with 5% CO2 at 37 C. 2.2. Transfection of lentiviral Trnau1ap-shRNA vectors
BCA assay. The loading quantity of protein was 50 mg. The total protein was separated by 12% SDS/PAGE with 120 V, followed by transferred to polyvinylidene fluoride (PVDF) membrane (Millipore, Madison, WI, USA) with 200 mA for 1 h and 30 min. The membranes were incubated with primary antibodies at 4 C overnight. Primary antibodies include SelK (1:1000), GPx1 (1:1000), GPx4 (1:1000), DIO (1:1000), Trnau1ap (1:1000), TrxR1 (1:1000), SelN (1:1000) (Proteintech, Wuhan, China), Akt and p-Akt (1:1000) (Thr308, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and bactin (1:1000) (Boster), then membranes were incubated with secondary antibodies (Boster) for 2 h at room temperature. Finally the bands were detected with ECL reagents (Santa Cruz Biotechnology, Santa Cruz, CA, USA) using BioSpectrum Imaging System (UVP, LLC Upland, CA, USA) and were analyzed by image J software. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) The total RNA was extracted by TRIzol reagent (Invitrogen, USA) according to manufacturer's instructions, the concentration was measured by NanoDrop (2000) (Thermo Scientific, USA). RNA samples were transcripted to cDNA with PrimeScript™ RT reagent Kit (TAKARA, Dalian, China). Quantitative Real Time-PCR was performed to measure the expression level of Trnau1ap mRNA using 7500 ABI (Applied Biosystems, Life Technology, USA) with SYBR Green (Roche, Shanghai, China). The qRT-PCR primers for the Trnau1ap and b-actin mRNA were purchased from GENEWIZ. The primer sets are shown in Table 1. The qRT-PCR process was at 50 C for 2 min, 95 C for 10 min, 40 cycles at 95 C for 15 s, 60 C for 1 min, melting curve stage was at 95 C for 15 s, 60 C for 1 min, and at 95 C for 30 s. 2.5. Detectation of malondialdehyde assay The way to detect the cellular oxidative stress level was using Malondial-dehyde (MDA) assay (Beyotime Biotechnology, Shanghai, China). Cells were collected with 0.25% trypsin (Gibco, USA), broken by ultrasonic wave in the extracting solution, then added MDA reagent to the suspension, followed by a waterbath at 95 C for 40 min, finally measured at OD 532 nm with microplate Molecular Devices (SpectraMax M3, USA).
The lentiviral Trnau1ap-shRNA vector (Trnau1ap-shRNA group) and lentiviral negative control-shRNA vector (NC-shRNA group) were purchased from Obio Technology (Shanghai, China). The target sequence of mouse Trnau1ap shRNA was 50 -CGTGGACGATGGCATGCTGTA- 30 , and the target sequence of human Trnau1ap shRNA was 50 -CTGAGAAGTGTTTGCATAA-3’. Exponential growth cells were seeded into 24-well plates with 2 104 cells per well. And cells were transfected with lentiviral shRNA vectors. The multiplicities of infection (MOIs) were 40 in NIH3T3 cells, 30 in JEG3 and Bewo cells. Meanwhile, polybrene (6 mg/ml) was added to improve transfective efficiency [28]. After 5 days, puromycin (2 mg/ ml) was added for screenning positive cells.
The wound scratch assay was performed to detect the cell migration. The Trnau1ap-shRNA cells and NC-shRNA cells were seeded into 6-well plates, scratched by 10 ml plastic pipette tips, and continued cultured in the serum-free DMEM. Cells were imaged at 0 h, 24 h with a fluorescence microscope (Olympus, Tokyo, Japan). The wound healing rates of cells were perfomed with the ratio (width of the healed wound/width of the original wound).
2.3. Western blot analysis
2.7. Cell proliferation assay
The total protein of the Trnau1ap-shRNA group and NC-shRNA group was lysed by RIPA buffer, phosphatase inhibitor and protease inhibitor (100:1:1), and the concentration was measured by
The CCK-8 (Beyotime Biotechnology, Shanghai, China) was performed to detect cell proliferation. The exponential growing Trnau1ap-shRNA cells and NC-shRNA cells were seeded into 96-
2.6. Migration assay
Table 1 Primer sets used in quantitative Real-Time PCR. Gene name
Forward primer
Reverse primer
Mouse b-actin Mouse Trnau1ap Human b-actin Human Trnau1ap
CCGTAAAGACCTCTATGCCAACA ATGGGAGACCTGGAACCCTA GCAAAGACCTGTACGCCAAC CCAGAACACAGGCAGCTACA
CGGACTCATCGTACTCCTGCT TCAGGGCTATTGTCTGGCTG GATCTTCATTGTGCTGGGTGC GCAACCTGGCTTGTCCTTTG
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
well plates with 4000 cells (NIH3T3) per well and 2000 cells (JEG-3 and Bewo) per well, followed by adding 10 ml CCK-8 reagent with 100 ml serum-free DMEM at 24 h, 48 h, 72 h, continued incubation for 2 h, then measured at OD 450 nm with microplate Molecular Devices (SpectraMax M3, USA).
2.8. Statistical analysis The data of Trnau1ap-shRNA group and NC-shRNA group were expressed as mean ± SD. The significance of differences between groups means were analyzed with Student's t-test using GraphPad Prism, P < 0.05 was considered to have statistical significance. And each group had been repeated at least three times.
3
3. Results 3.1. The stable cell lines with reduced expression of Trnau1ap were established The NIH3T3, JEG-3 and Bewo cells were transfected with lentiviral shRNA vectors, followed by screenning positive cells with puromycin for 7 days, and then the total mRNA and protein were extracted. The expressions of Trnau1ap mRNA and protein were measured by qRT-PCR and western blot. After transfected with lentiviral Trnau1ap-shRNA vectors, the expressions of Trnau1ap mRNA were decreased in NIH3T3 cells (Fig. 1A), JEG-3 cells (Fig. 1B) and Bewo cells (Fig. 1C). Meanwhile, the expressions of Trnau1ap protein were also decreased in NIH3T3 cells (Fig. 1D), JEG-3 cells
Fig. 1. Transfection with lentiviral Trnau1ap-shRNA vectors decreased the expressions of Trnau1ap mRNA and protein in NIH3T3, JEG-3 and Bewo cells. (AeC) QRT-PCR was performed to detect the expression of Trnau1ap mRNA in NIH3T3, JEG-3 and Bewo cells. The expression of Trnau1ap mRNA was normalized to b-actin mRNA. (DeE) Western blot analysis was performed to detect the expression of Trnau1ap protein in NIH3T3, JEG-3 and Bewo cells. The expression of Trnau1ap protein was normalized to b-actin protein. The results of Trnau1ap mRNA and protein are expressed as the means ± SD. *P < 0.05, **P < 0.01, compared with the lentiviral NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
4
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. Downregulation of Trnau1ap increased the content of cellular MDA and decreased the expression level of selenoproteins. (AeC) Western blot analysis was performed to measure the expressions of selenoproteins in NIH3T3, JEG-3 and Bewo cells. The expressions of selenoproteins were normalized to the expression of b-actin protein. (DeF) The MDA reagents were used to measure the contents of MDA in NIH3T3, JEG-3 and Bewo cells. The results of MDA content and selenoproteins are showed as the means ± SD. *P < 0.05, **P < 0.01, compared with the NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
(Fig. 1E) and Bewo cells (Fig. 1F). These results indicated that cell lines with reduced expression of Trnau1ap were established. And lentiviral shRNA constructs were used in all subsequent experiments.
3.2. Knockdown of Trnau1ap reduced cellular antioxidant activities Selenoproteins, such as GPxs, TrxRs, SelK and SelN are related to oxidative reaction [16]. They all play an important role in the oxidative stress. As shown in the results, the expessions of selenoproteins (SelK, GPx1, GPx4, TrxR1, and SelN) in NIH3T3 cells (Fig. 2A), JEG-3 cells (Fig. 2B) and Bewo cells (Fig. 2C) were decreased in the Trnau1ap-shRNA groups. MDA, which is an end product of lipid peroxidation, presents one of biomarkers for oxidative stress [29,30]. The results showed that the contents of MDA in NIH3T3 cells (Fig. 2D), JEG-3 cells (Fig. 2E) and Bewo cells (Fig. 2F) were increased in the Trnau1ap-shRNA groups. These results indicated that knockdown of Trnau1ap could reduce cellular antioxidant activities.
5
3.3. Knockdown of Trnau1ap inhibited cell migration and proliferation To identify whether Trnau1ap could impact cell migration, the wound scratch assay was performed. The data showed that the speeds of wound healing in NIH3T3 cells (Fig. 3A), JEG-3 cells (Fig. 3B) and Bewo cells (Fig. 3C) were slower at 24 h in the Trnau1ap-shRNA groups. The CCK-8 assay was performed to confirm whether Trnau1ap could impact cell proliferation. The results showed that the data of OD 450 nm in NIH3T3 cells (Fig. 3D), JEG-3 cells (Fig. 3E) and Bewo cells (Fig. 3F) at 48 h and 72 h were lower in the Trnau1ap-shRNA groups. These data suggested that knockdown of Trnau1ap could inhibit cell migration and proliferation. 3.4. Knockdown of Trnau1ap gene attenuated the PI3K/Akt signaling pathway in the NIH3T3 cells, JEG-3 and Bewo cells Several recent studies showed that the PI3K/Akt signaling pathway was involved in cell proliferation, migration and cell
Fig. 3. The Trnau1ap-shRNA lentiviral vectors inhibited cell migration and proliferation. (AeC) The pictures of wound scratch assay were taken at 0 h, 24 h in NIH3T3, JEG-3 and Bewo cells. Scale bars: 100 mm. (DeF) The data of OD 450 nm were detected at 24 h, 48 h, and 72 h in NIH3T3, JEG-3 and Bewo cells. The results are expressed as the means ± SD. **P < 0.01, ***P < 0.001, compared with the NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
6
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 4. The lentiviral Trnau1ap-shRNA vectors reduced the phosphorylation level of Akt. Western blot analysis was performed to measure the expression level of total Akt and the phosphorylation level of Akt in NIH3T3, JEG-3 and Bewo cells. The ratios of p-Akt/Akt are expressed as the means ± SD. *P < 0.05, compared with the NC-shRNA groups.
fusion [23e25]. Western blot analysis showed that the phosphorylation level of Akt in NIH3T3 cells (Fig. 4A), JEG-3 cells (Fig. 4B) and Bewo cells (Fig. 4C) were reduced in the Trnau1ap-shRNA groups. Results indicated that knockdown of Trnau1ap could attenuate the PI3K/Akt signaling pathway. 4. Discussion NIH3T3 is a tool cell line used in cell transfection and gene expression, JEG-3 is the trophoblast choriocarcinoma cell line, and Bewo is the placental choriocarcinoma cell line, thus we selected NIH3T3, JEG-3 and Bewo cells to research the role of Trnau1ap in the embryonic development. In this study, we have established stable NIH3T3, JEG-3 and Bewo cell lines with reduced expressions of Trnau1ap. We found that knockdown of Trnau1ap with lentiviral shRNA vectors reduced the antioxidant activities of cells. Meanwhile, knockdown of Trnau1ap could actually inhibit cell proliferation. In addition, downregulation of Trnau1ap could also inhibit cell migration. We demonstrated that the phosphorylation level of Akt in the PI3K/Akt pathway was attenuated in the Trnau1apshRNA group. These evidence indicated that knockdown of Trnau1ap could inhibit cell proliferation and migration through the PI3K/Akt signaling pathway. Since the Trnau1ap was discovered [31], the structure and location of the Trnau1ap have been identified in the recent studies [10,11]. Trnau1ap has been characterized as a molecular chaperone to promote the Sec biosynthesis and incorporation into selenoproteins [6]. A series of selenoproteins such as GPxs, TrxRs and DIOs
are associated with redox reactions [15]. In the experiments, lentiviral shRNA vectors were transfected in NIH3T3, JEG-3 and Bewo cells. The expressions of Trnau1ap mRNA and protein were decreased in the Trnau1ap-shRNA groups. And we found that JEG3 cells were most sensitive in three cells. Western blot analysis showed that knockdown of Trnau1ap actually reduced the expressions of selenoproteins. Results indicated that cellular antioxidant activities were reduced in the Trnau1ap-shRNA groups. The MDA has been identified to be one of biomakers for oxidative stress [29,30]. And as our results shown, the contents of MDA in the Trnau1ap-shRNA groups were actually increased than that in the NC-shRNA groups. Thus results indicated that cellular antioxidant activities were reduced in the NIH3T3, JEG-3 and Bewo cells by transfecting with lentiviral Trnau1ap-shRNA vectors. During selenoproteins, GPx4 is essential for spermatogenesis and embryogenesis [17]. TrxR1 and TrxR2 are also essential for embryogenesis [19]. In the experiments, the expressions of GPx4 and TrxR1 were decreased in the Trnau1ap-shRNA groups in NIH3T3, JEG-3 and Bewo cells. Results indicated that Trnau1ap could impact embryonic development, and more influences on embryonic development should be investigated. The PI3K/Akt signaling pathway has been identified to be associated with cell proliferation, migration and cell fusion [23e25]. After knocking down Trnau1ap, expressions of selenoproteins were decreased. The proliferation rates in the Trnau1apshRNA groups were decreased at 48 h and 72 h. Meanwhile, the wound healing rates of the Trnau1ap-shRNA group were also decreased. And Western blot analysis showed that the
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
phosphorylation level of Akt was reduced. Thus we supposed that knockdown of Trnau1ap could inhibit cell proliferation and migration through attenuating the PI3K/Akt signaling pathway in the NIH3T3, JEG-3 and Bewo cells. And more cellular mechanisms and biological functions are required to be investigated.
[13]
Conflicts of interest
[14]
The authors declare that they have no conflict of interest. Acknowledgement This work was supported financially by Natural Science Foundation of China (No. 81472929).
[15]
[16] [17]
Transparency document
[18]
Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.05.065
[19]
[20]
References [1] L. Schomburg, U. Schweizer, J. Kohrle, Selenium and selenoproteins in mammals: extraordinary, essential, enigmatic, Cell. Mol. Life Sci. 61 (2004) 1988e1995. [2] T.C. Stadtman, Selenocysteine, Annu. Rev. Biochem. 65 (1996) 83e100. [3] A. Bock, K. Forchhammer, J. Heider, W. Leinfelder, G. Sawers, B. Veprek, F. Zinoni, Selenocysteine: the 21st amino acid, Mol. Microbiol. 5 (1991) 515e520. [4] D.L. Hatfield, V.N. Gladyshev, How selenium has altered our understanding of the genetic code, Mol. Cell Biol. 22 (2002) 3565e3576. [5] Y.F. Chen, H.C. Lin, K.N. Chuang, C.H. Lin, H.S. Yen, C.H. Yeang, A quantitative model for the rate-limiting process of UGA alternative assignments to stop and selenocysteine codons, PLoS Comput. Biol. 13 (2017) e1005367. [6] J.E. Squires, M.J. Berry, Eukaryotic selenoprotein synthesis: mechanistic insight incorporating new factors and new functions for old factors, IUBMB Life 60 (2008) 232e235. [7] S.C. Low, E. Grundner-Culemann, J.W. Harney, M.J. Berry, SECIS-SBP2 interactions dictate selenocysteine incorporation efficiency and selenoprotein hierarchy, EMBO J. 19 (2000) 6882e6890. [8] L. Chavatte, B.A. Brown, D.M. Driscoll, Ribosomal protein L30 is a component of the UGA-selenocysteine recoding machinery in eukaryotes, Nat. Struct. Mol. Biol. 12 (2005) 408e416. [9] X.M. Xu, B.A. Carlson, H. Mix, Y. Zhang, K. Saira, R.S. Glass, M.J. Berry, V.N. Gladyshev, D.L. Hatfield, Biosynthesis of selenocysteine on its tRNA in eukaryotes, PLoS Biol. 5 (2007) e4. [10] F. Oudouhou, B. Casu, A.S. Dopgwa Puemi, J. Sygusch, C. Baron, Analysis of novel interactions between components of the selenocysteine biosynthesis pathway, SEPHS1, SEPHS2, SEPSECS, and SECp43, Biochemistry 56 (2017) 2261e2270. [11] X.M. Xu, H. Mix, B.A. Carlson, P.J. Grabowski, V.N. Gladyshev, M.J. Berry, D.L. Hatfield, Evidence for direct roles of two additional factors, SECp43 and soluble liver antigen, in the selenoprotein synthesis machinery, J. Biol. Chem. 280 (2005) 41568e41575. [12] A. Small-Howard, N. Morozova, Z. Stoytcheva, E.P. Forry, J.B. Mansell,
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
7
J.W. Harney, B.A. Carlson, X.M. Xu, D.L. Hatfield, M.J. Berry, Supramolecular complexes mediate selenocysteine incorporation in vivo, Mol. Cell Biol. 26 (2006) 2337e2346. E.E. Schmidt, Y. Mahdi, X.-M. Xu, B.A. Carlson, N. Fradejas, P. Günter, D. Braun, E. Southon, L. Tessarollo, D.L. Hatfield, U. Schweizer, Expression of selenoproteins is maintained in mice carrying mutations in SECp43, the tRNA selenocysteine 1 associated protein (Trnau1ap), PLoS One 10 (2015) e0127349. G.V. Kryukov, S. Castellano, S.V. Novoselov, A.V. Lobanov, O. Zehtab, R. Guigo, V.N. Gladyshev, Characterization of mammalian selenoproteomes, Science 300 (2003) 1439e1443. L.V. Papp, J. Lu, A. Holmgren, K.K. Khanna, From selenium to selenoproteins: synthesis, identity, and their role in human health, Antioxidants Redox Signal. 9 (2007) 775e806. J. Lu, A. Holmgren, Selenoproteins, J. Biol. Chem. 284 (2009) 723e727. I. Ingold, M. Aichler, E. Yefremova, A. Roveri, K. Buday, S. Doll, A. Tasdemir, N. Hoffard, W. Wurst, A. Walch, F. Ursini, J.P. Friedmann Angeli, M. Conrad, Expression of a catalytically inactive mutant form of Glutathione peroxidase 4 (Gpx4) confers a dominant-negative effect in male fertility, J. Biol. Chem. 290 (2015) 14668e14678. J. Lu, A. Holmgren, The thioredoxin antioxidant system, Free Radic. Biol. Med. 66 (2014) 75e87. r, Focus on mammalian thioredoxin reductases d important seleE.S.J. Arne noproteins with versatile functions, Biochim. Biophys. Acta Gen. Subj. 1790 (2009) 495e526. J. Kohrle, R. Gartner, Selenium and thyroid, Best Pract. Res. Clin. Endocrinol. Metabol. 23 (2009) 815e827. S. Arbogast, A. Ferreiro, Selenoproteins and protection against oxidative stress: selenoprotein N as a novel player at the crossroads of redox signaling and calcium homeostasis, Antioxidants Redox Signal. 12 (2010) 893e904. C. Lu, F. Qiu, H. Zhou, Y. Peng, W. Hao, J. Xu, J. Yuan, S. Wang, B. Qiang, C. Xu, X. Peng, Identification and characterization of selenoprotein K: an antioxidant in cardiomyocytes, FEBS Lett. 580 (2006) 5189e5197. L. Shen, A. Yang, P. Yao, X. Sun, C. Chen, C. Mo, L. Shi, Y. Chen, Q. Liu, Gadolinium promoted proliferation in mouse embryo fibroblast NIH3T3 cells through Rac and PI3K/Akt signaling pathways, Biometals 27 (2014) 753e762. C. Yang, W. Lim, F.W. Bazer, G. Song, Myricetin suppresses invasion and promotes cell death in human placental choriocarcinoma cells through induction of oxidative stress, Canc. Lett. 399 (2017) 10e19. M. Vatish, L. Tesfa, D. Grammatopoulos, E. Yamada, C.C. Bastie, J.E. Pessin, Inhibition of Akt activity and calcium channel function coordinately drive cellcell fusion in the BeWO choriocarcinoma placental cell line, PLoS One 7 (2012) e29353. Y. Xiao, J. Wang, Y. Chen, K. Zhou, J. Wen, Y. Wang, Y. Zhou, W. Pan, W. Cai, Up-regulation of miR-200b in biliary atresia patients accelerates proliferation and migration of hepatic stallate cells by activating PI3K/Akt signaling, Cell. Signal. 26 (2014) 925e932. C.H. Su, C.Y. Wang, K.H. Lan, C.P. Li, Y. Chao, H.C. Lin, S.D. Lee, W.P. Lee, Akt phosphorylation at Thr308 and Ser473 is required for CHIP-mediated ubiquitination of the kinase, Cell. Signal. 23 (2011) 1824e1830. H.Q. Luo, W.T. Zhong, F.M. Liu, Z.Y. Cui, K.Y. Zhou, X.Y. Li, Construction and identification of the recombinant lentiviral expression vector targeting human BAX inhibitor-1 gene, J buon 18 (2013) 1069e1073. D. Tsikas, Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenges, Anal. Biochem. 524 (2017) 13e30. M.T. Islam, Oxidative stress and mitochondrial dysfunction-linked neurodegenerative disorders, Neurol. Res. 39 (2017) 73e82. F. Ding, P.J. Grabowski, Identification of a protein component of a mammalian tRNA(Sec) complex implicated in the decoding of UGA as selenocysteine, RNA 5 (1999) 1561e1569.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway Xiaoyan Hu a, Jincheng Luo a, Hehuan Lai a, Mengdi Li a, Xiaolin Zheng b, Tingting Nie a, Fenglan Li a, Hui Li a, * a
The Department of Biochemistry and Molecular Biology, Harbin Medical University, Baojian Road 157, Nangang District, Harbin City, Heilongjiang, 150086, China The Department of Anatomy, Harbin Medical University, Baojian Road 157, Nangang District, Harbin City, Heilongjiang, 150086, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 May 2018 Accepted 10 May 2018 Available online xxx
The tRNA selenocysteine 1 associated protein 1 (Trnau1ap, initially named SECp43) is involved in Selenocysteine (Sec) biosynthesis and incorporation into selenoproteins, which play a key role in biological processes, such as embryonic development. We previously reported that downregulation of Trnau1ap inhibited proliferation of cardiomyocyte-like H9c2 cells. However, the effects of Trnau1ap on cell proliferation and migration of embryonic development are not known, and the mechanisms remain elusive. Herein, lentiviral shRNA vectors were transfected in NIH3T3, JEG-3 and Bewo cells (embryonic, trophoblast and placental cells). We found that knockdown of Trnau1ap resulted in reduced expression levels of selenoproteins. The data of Cell Count Kit-8 (CCK-8) assay and wound scratch assay revealed the proliferation and migration rates were reduced in the Trnau1ap-shRNA groups. Furthermore, western blot analysis showed that the phosphorylation level of Akt in the phosphatidylinositol 3-kinase (PI3K)/ Akt pathway was attenuated. These results indicate that Trnau1ap plays an important role in regulation of cell proliferation and migration through the PI3K/Akt signaling pathway, as well as being essential for embryonic development by regulating the expression of selenoproteins. © 2018 Published by Elsevier Inc.
Keywords: TRNA selenocysteine 1 associated protein 1 Selenoprotein Lentiviral shRNA Proliferation Migration
1. Introduction Selenium is recognized as an essential trace element in mammals [1]. The main active form of selenium in selenoproteins is Sec, which is identified as the 21st amino acid to incorporate into selenoproteins [2,3]. The process of Sec biosynthesis requires Sec tRNA [Ser] Sec and Sec insertion sequence (SECIS) to redifine the UGA codon from a stop codon to the Sec codon [4,5]. And the process of Sec incorporation needs several cis- and trans-acting factors, such as SECIS, Translation initiation factor (eIF4A3), Trnau1ap, soluble liver antigen (SLA), SECIS binding protein 2 (SBP2), Ribosomal Protein (RPL30), Sec Elongation Factor (EFsec), Selenophosphate Synthetase 1 (SPS1) and Selenophosphate Synthetase 2 (SPS2) [6]. The SECIS element with a stem-loop structure locates at the 30 untranslated region of selenoprotein mRNAs. SBP2 binds to the SECIS element, and associates with other factors, then translocate to the ribosome [7]. RPL30 on the ribosome is recognized as the
* Corresponding author. E-mail address: [email protected] (H. Li).
second binding protein of the SECIS element [8]. SPS2 is a selenoenzyme as well as a selenium donor that can promote the biosnythesis of selenoproteins, but knockdown of SPS1 could not influence the expression of selenoprotein, it was supposed to impact the recycling of Sec [9]. Another factor is Trnau1ap, which is identified as a globular and nuclear protein with 43 kDa, regulates the biosynthesis of selenoproteins with promoting the synthesis of Um34 on tRNA [Ser] Sec and the nuclear translocation of SLA in mammals [10,11]. Trnau1ap interacts with SLA, eIF4A3, EFsec, SBP2 and SPS1 to form a multiprotein complex. Meanwhile, it associates with Sec tRNA [Ser] Sec to promote its methylation [12]. Prevently, one research reported that constitutive deletion of exons 7 þ 8 of Trnau1ap was embryonic lethal, but there was no effect of Trnau1ap mutations on selenoprotein expression [13]. At least 25 selenoproteins in human and 24 selenoproteins in rodents have been identified [14]. Among these selenoproteins such as Glutathione Peroxidases (GPxs), Thioredoxin Reductases (TrxRs) and Iodothyronine Deiodinases (DIOs), selenoprotein N (SelN) and selenoprotein K (SelK) are associated with redox
https://doi.org/10.1016/j.bbrc.2018.05.065 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
2
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
reactions [15]. GPxs are performed to reduce cellular hydroperoxides [16]. And GPx4 is essential for spermatogenesis and embryogenesis [17]. TrxRs catalyze the reduction of oxidized thioredoxin by the oxidation of NADPH [18]. TrxR1 and TrxR2 are also essential for embryogenesis [19]. DIOs are identified as regulators in the metabolism of thyroid hormones [20]. SelN is identified to protect against cellular oxidative stress and play a role in redox-related calcium homeostasis [21]. Overexpression of SelK may improve the antioxidant activity of the heart [22]. It has been well known that the PI3K/Akt signaling pathway could be involved in cell proliferation, migration and cell fusion [23e25]. When PI3K is activated, the downstream factor Akt will be phosphorylated [26]. The phosphorylation sites include Threonine 308 and Serine 473 [27]. But the pathway with knockdown of Trnau1ap in cells is unknown. And several studies have reported the structure and location of Trnau1ap [10,11]. However, studies about the effects of Trnau1ap on cell proliferation and migration are seldom. Thus we constructed the lentiviral shRNA vectors to knock down the Trnau1ap. And our purpose is to find out cellular mechanisms about the Trnau1ap in NIH3T3, JEG-3 and Bewo cells. Finally, we found that knockdown of Trnau1ap inhibited cell proliferation and migration through attenuating the PI3K/Akt signaling pathway. 2. Materials and methods 2.1. Cell culture The mouse embryonic fibroblast cell line (NIH3T3), the human trophoblast choriocarcinoma cell line (JEG-3) and the placental choriocarcinoma cell line (Bewo) were purchased from ATCC. Cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen, USA) plus 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin (Biological Industries). And cells were cultured in an incubator with 5% CO2 at 37 C. 2.2. Transfection of lentiviral Trnau1ap-shRNA vectors
BCA assay. The loading quantity of protein was 50 mg. The total protein was separated by 12% SDS/PAGE with 120 V, followed by transferred to polyvinylidene fluoride (PVDF) membrane (Millipore, Madison, WI, USA) with 200 mA for 1 h and 30 min. The membranes were incubated with primary antibodies at 4 C overnight. Primary antibodies include SelK (1:1000), GPx1 (1:1000), GPx4 (1:1000), DIO (1:1000), Trnau1ap (1:1000), TrxR1 (1:1000), SelN (1:1000) (Proteintech, Wuhan, China), Akt and p-Akt (1:1000) (Thr308, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and bactin (1:1000) (Boster), then membranes were incubated with secondary antibodies (Boster) for 2 h at room temperature. Finally the bands were detected with ECL reagents (Santa Cruz Biotechnology, Santa Cruz, CA, USA) using BioSpectrum Imaging System (UVP, LLC Upland, CA, USA) and were analyzed by image J software. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) The total RNA was extracted by TRIzol reagent (Invitrogen, USA) according to manufacturer's instructions, the concentration was measured by NanoDrop (2000) (Thermo Scientific, USA). RNA samples were transcripted to cDNA with PrimeScript™ RT reagent Kit (TAKARA, Dalian, China). Quantitative Real Time-PCR was performed to measure the expression level of Trnau1ap mRNA using 7500 ABI (Applied Biosystems, Life Technology, USA) with SYBR Green (Roche, Shanghai, China). The qRT-PCR primers for the Trnau1ap and b-actin mRNA were purchased from GENEWIZ. The primer sets are shown in Table 1. The qRT-PCR process was at 50 C for 2 min, 95 C for 10 min, 40 cycles at 95 C for 15 s, 60 C for 1 min, melting curve stage was at 95 C for 15 s, 60 C for 1 min, and at 95 C for 30 s. 2.5. Detectation of malondialdehyde assay The way to detect the cellular oxidative stress level was using Malondial-dehyde (MDA) assay (Beyotime Biotechnology, Shanghai, China). Cells were collected with 0.25% trypsin (Gibco, USA), broken by ultrasonic wave in the extracting solution, then added MDA reagent to the suspension, followed by a waterbath at 95 C for 40 min, finally measured at OD 532 nm with microplate Molecular Devices (SpectraMax M3, USA).
The lentiviral Trnau1ap-shRNA vector (Trnau1ap-shRNA group) and lentiviral negative control-shRNA vector (NC-shRNA group) were purchased from Obio Technology (Shanghai, China). The target sequence of mouse Trnau1ap shRNA was 50 -CGTGGACGATGGCATGCTGTA- 30 , and the target sequence of human Trnau1ap shRNA was 50 -CTGAGAAGTGTTTGCATAA-3’. Exponential growth cells were seeded into 24-well plates with 2 104 cells per well. And cells were transfected with lentiviral shRNA vectors. The multiplicities of infection (MOIs) were 40 in NIH3T3 cells, 30 in JEG3 and Bewo cells. Meanwhile, polybrene (6 mg/ml) was added to improve transfective efficiency [28]. After 5 days, puromycin (2 mg/ ml) was added for screenning positive cells.
The wound scratch assay was performed to detect the cell migration. The Trnau1ap-shRNA cells and NC-shRNA cells were seeded into 6-well plates, scratched by 10 ml plastic pipette tips, and continued cultured in the serum-free DMEM. Cells were imaged at 0 h, 24 h with a fluorescence microscope (Olympus, Tokyo, Japan). The wound healing rates of cells were perfomed with the ratio (width of the healed wound/width of the original wound).
2.3. Western blot analysis
2.7. Cell proliferation assay
The total protein of the Trnau1ap-shRNA group and NC-shRNA group was lysed by RIPA buffer, phosphatase inhibitor and protease inhibitor (100:1:1), and the concentration was measured by
The CCK-8 (Beyotime Biotechnology, Shanghai, China) was performed to detect cell proliferation. The exponential growing Trnau1ap-shRNA cells and NC-shRNA cells were seeded into 96-
2.6. Migration assay
Table 1 Primer sets used in quantitative Real-Time PCR. Gene name
Forward primer
Reverse primer
Mouse b-actin Mouse Trnau1ap Human b-actin Human Trnau1ap
CCGTAAAGACCTCTATGCCAACA ATGGGAGACCTGGAACCCTA GCAAAGACCTGTACGCCAAC CCAGAACACAGGCAGCTACA
CGGACTCATCGTACTCCTGCT TCAGGGCTATTGTCTGGCTG GATCTTCATTGTGCTGGGTGC GCAACCTGGCTTGTCCTTTG
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
well plates with 4000 cells (NIH3T3) per well and 2000 cells (JEG-3 and Bewo) per well, followed by adding 10 ml CCK-8 reagent with 100 ml serum-free DMEM at 24 h, 48 h, 72 h, continued incubation for 2 h, then measured at OD 450 nm with microplate Molecular Devices (SpectraMax M3, USA).
2.8. Statistical analysis The data of Trnau1ap-shRNA group and NC-shRNA group were expressed as mean ± SD. The significance of differences between groups means were analyzed with Student's t-test using GraphPad Prism, P < 0.05 was considered to have statistical significance. And each group had been repeated at least three times.
3
3. Results 3.1. The stable cell lines with reduced expression of Trnau1ap were established The NIH3T3, JEG-3 and Bewo cells were transfected with lentiviral shRNA vectors, followed by screenning positive cells with puromycin for 7 days, and then the total mRNA and protein were extracted. The expressions of Trnau1ap mRNA and protein were measured by qRT-PCR and western blot. After transfected with lentiviral Trnau1ap-shRNA vectors, the expressions of Trnau1ap mRNA were decreased in NIH3T3 cells (Fig. 1A), JEG-3 cells (Fig. 1B) and Bewo cells (Fig. 1C). Meanwhile, the expressions of Trnau1ap protein were also decreased in NIH3T3 cells (Fig. 1D), JEG-3 cells
Fig. 1. Transfection with lentiviral Trnau1ap-shRNA vectors decreased the expressions of Trnau1ap mRNA and protein in NIH3T3, JEG-3 and Bewo cells. (AeC) QRT-PCR was performed to detect the expression of Trnau1ap mRNA in NIH3T3, JEG-3 and Bewo cells. The expression of Trnau1ap mRNA was normalized to b-actin mRNA. (DeE) Western blot analysis was performed to detect the expression of Trnau1ap protein in NIH3T3, JEG-3 and Bewo cells. The expression of Trnau1ap protein was normalized to b-actin protein. The results of Trnau1ap mRNA and protein are expressed as the means ± SD. *P < 0.05, **P < 0.01, compared with the lentiviral NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
4
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. Downregulation of Trnau1ap increased the content of cellular MDA and decreased the expression level of selenoproteins. (AeC) Western blot analysis was performed to measure the expressions of selenoproteins in NIH3T3, JEG-3 and Bewo cells. The expressions of selenoproteins were normalized to the expression of b-actin protein. (DeF) The MDA reagents were used to measure the contents of MDA in NIH3T3, JEG-3 and Bewo cells. The results of MDA content and selenoproteins are showed as the means ± SD. *P < 0.05, **P < 0.01, compared with the NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
(Fig. 1E) and Bewo cells (Fig. 1F). These results indicated that cell lines with reduced expression of Trnau1ap were established. And lentiviral shRNA constructs were used in all subsequent experiments.
3.2. Knockdown of Trnau1ap reduced cellular antioxidant activities Selenoproteins, such as GPxs, TrxRs, SelK and SelN are related to oxidative reaction [16]. They all play an important role in the oxidative stress. As shown in the results, the expessions of selenoproteins (SelK, GPx1, GPx4, TrxR1, and SelN) in NIH3T3 cells (Fig. 2A), JEG-3 cells (Fig. 2B) and Bewo cells (Fig. 2C) were decreased in the Trnau1ap-shRNA groups. MDA, which is an end product of lipid peroxidation, presents one of biomarkers for oxidative stress [29,30]. The results showed that the contents of MDA in NIH3T3 cells (Fig. 2D), JEG-3 cells (Fig. 2E) and Bewo cells (Fig. 2F) were increased in the Trnau1ap-shRNA groups. These results indicated that knockdown of Trnau1ap could reduce cellular antioxidant activities.
5
3.3. Knockdown of Trnau1ap inhibited cell migration and proliferation To identify whether Trnau1ap could impact cell migration, the wound scratch assay was performed. The data showed that the speeds of wound healing in NIH3T3 cells (Fig. 3A), JEG-3 cells (Fig. 3B) and Bewo cells (Fig. 3C) were slower at 24 h in the Trnau1ap-shRNA groups. The CCK-8 assay was performed to confirm whether Trnau1ap could impact cell proliferation. The results showed that the data of OD 450 nm in NIH3T3 cells (Fig. 3D), JEG-3 cells (Fig. 3E) and Bewo cells (Fig. 3F) at 48 h and 72 h were lower in the Trnau1ap-shRNA groups. These data suggested that knockdown of Trnau1ap could inhibit cell migration and proliferation. 3.4. Knockdown of Trnau1ap gene attenuated the PI3K/Akt signaling pathway in the NIH3T3 cells, JEG-3 and Bewo cells Several recent studies showed that the PI3K/Akt signaling pathway was involved in cell proliferation, migration and cell
Fig. 3. The Trnau1ap-shRNA lentiviral vectors inhibited cell migration and proliferation. (AeC) The pictures of wound scratch assay were taken at 0 h, 24 h in NIH3T3, JEG-3 and Bewo cells. Scale bars: 100 mm. (DeF) The data of OD 450 nm were detected at 24 h, 48 h, and 72 h in NIH3T3, JEG-3 and Bewo cells. The results are expressed as the means ± SD. **P < 0.01, ***P < 0.001, compared with the NC-shRNA groups.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
6
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 4. The lentiviral Trnau1ap-shRNA vectors reduced the phosphorylation level of Akt. Western blot analysis was performed to measure the expression level of total Akt and the phosphorylation level of Akt in NIH3T3, JEG-3 and Bewo cells. The ratios of p-Akt/Akt are expressed as the means ± SD. *P < 0.05, compared with the NC-shRNA groups.
fusion [23e25]. Western blot analysis showed that the phosphorylation level of Akt in NIH3T3 cells (Fig. 4A), JEG-3 cells (Fig. 4B) and Bewo cells (Fig. 4C) were reduced in the Trnau1ap-shRNA groups. Results indicated that knockdown of Trnau1ap could attenuate the PI3K/Akt signaling pathway. 4. Discussion NIH3T3 is a tool cell line used in cell transfection and gene expression, JEG-3 is the trophoblast choriocarcinoma cell line, and Bewo is the placental choriocarcinoma cell line, thus we selected NIH3T3, JEG-3 and Bewo cells to research the role of Trnau1ap in the embryonic development. In this study, we have established stable NIH3T3, JEG-3 and Bewo cell lines with reduced expressions of Trnau1ap. We found that knockdown of Trnau1ap with lentiviral shRNA vectors reduced the antioxidant activities of cells. Meanwhile, knockdown of Trnau1ap could actually inhibit cell proliferation. In addition, downregulation of Trnau1ap could also inhibit cell migration. We demonstrated that the phosphorylation level of Akt in the PI3K/Akt pathway was attenuated in the Trnau1apshRNA group. These evidence indicated that knockdown of Trnau1ap could inhibit cell proliferation and migration through the PI3K/Akt signaling pathway. Since the Trnau1ap was discovered [31], the structure and location of the Trnau1ap have been identified in the recent studies [10,11]. Trnau1ap has been characterized as a molecular chaperone to promote the Sec biosynthesis and incorporation into selenoproteins [6]. A series of selenoproteins such as GPxs, TrxRs and DIOs
are associated with redox reactions [15]. In the experiments, lentiviral shRNA vectors were transfected in NIH3T3, JEG-3 and Bewo cells. The expressions of Trnau1ap mRNA and protein were decreased in the Trnau1ap-shRNA groups. And we found that JEG3 cells were most sensitive in three cells. Western blot analysis showed that knockdown of Trnau1ap actually reduced the expressions of selenoproteins. Results indicated that cellular antioxidant activities were reduced in the Trnau1ap-shRNA groups. The MDA has been identified to be one of biomakers for oxidative stress [29,30]. And as our results shown, the contents of MDA in the Trnau1ap-shRNA groups were actually increased than that in the NC-shRNA groups. Thus results indicated that cellular antioxidant activities were reduced in the NIH3T3, JEG-3 and Bewo cells by transfecting with lentiviral Trnau1ap-shRNA vectors. During selenoproteins, GPx4 is essential for spermatogenesis and embryogenesis [17]. TrxR1 and TrxR2 are also essential for embryogenesis [19]. In the experiments, the expressions of GPx4 and TrxR1 were decreased in the Trnau1ap-shRNA groups in NIH3T3, JEG-3 and Bewo cells. Results indicated that Trnau1ap could impact embryonic development, and more influences on embryonic development should be investigated. The PI3K/Akt signaling pathway has been identified to be associated with cell proliferation, migration and cell fusion [23e25]. After knocking down Trnau1ap, expressions of selenoproteins were decreased. The proliferation rates in the Trnau1apshRNA groups were decreased at 48 h and 72 h. Meanwhile, the wound healing rates of the Trnau1ap-shRNA group were also decreased. And Western blot analysis showed that the
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065
X. Hu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
phosphorylation level of Akt was reduced. Thus we supposed that knockdown of Trnau1ap could inhibit cell proliferation and migration through attenuating the PI3K/Akt signaling pathway in the NIH3T3, JEG-3 and Bewo cells. And more cellular mechanisms and biological functions are required to be investigated.
[13]
Conflicts of interest
[14]
The authors declare that they have no conflict of interest. Acknowledgement This work was supported financially by Natural Science Foundation of China (No. 81472929).
[15]
[16] [17]
Transparency document
[18]
Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.05.065
[19]
[20]
References [1] L. Schomburg, U. Schweizer, J. Kohrle, Selenium and selenoproteins in mammals: extraordinary, essential, enigmatic, Cell. Mol. Life Sci. 61 (2004) 1988e1995. [2] T.C. Stadtman, Selenocysteine, Annu. Rev. Biochem. 65 (1996) 83e100. [3] A. Bock, K. Forchhammer, J. Heider, W. Leinfelder, G. Sawers, B. Veprek, F. Zinoni, Selenocysteine: the 21st amino acid, Mol. Microbiol. 5 (1991) 515e520. [4] D.L. Hatfield, V.N. Gladyshev, How selenium has altered our understanding of the genetic code, Mol. Cell Biol. 22 (2002) 3565e3576. [5] Y.F. Chen, H.C. Lin, K.N. Chuang, C.H. Lin, H.S. Yen, C.H. Yeang, A quantitative model for the rate-limiting process of UGA alternative assignments to stop and selenocysteine codons, PLoS Comput. Biol. 13 (2017) e1005367. [6] J.E. Squires, M.J. Berry, Eukaryotic selenoprotein synthesis: mechanistic insight incorporating new factors and new functions for old factors, IUBMB Life 60 (2008) 232e235. [7] S.C. Low, E. Grundner-Culemann, J.W. Harney, M.J. Berry, SECIS-SBP2 interactions dictate selenocysteine incorporation efficiency and selenoprotein hierarchy, EMBO J. 19 (2000) 6882e6890. [8] L. Chavatte, B.A. Brown, D.M. Driscoll, Ribosomal protein L30 is a component of the UGA-selenocysteine recoding machinery in eukaryotes, Nat. Struct. Mol. Biol. 12 (2005) 408e416. [9] X.M. Xu, B.A. Carlson, H. Mix, Y. Zhang, K. Saira, R.S. Glass, M.J. Berry, V.N. Gladyshev, D.L. Hatfield, Biosynthesis of selenocysteine on its tRNA in eukaryotes, PLoS Biol. 5 (2007) e4. [10] F. Oudouhou, B. Casu, A.S. Dopgwa Puemi, J. Sygusch, C. Baron, Analysis of novel interactions between components of the selenocysteine biosynthesis pathway, SEPHS1, SEPHS2, SEPSECS, and SECp43, Biochemistry 56 (2017) 2261e2270. [11] X.M. Xu, H. Mix, B.A. Carlson, P.J. Grabowski, V.N. Gladyshev, M.J. Berry, D.L. Hatfield, Evidence for direct roles of two additional factors, SECp43 and soluble liver antigen, in the selenoprotein synthesis machinery, J. Biol. Chem. 280 (2005) 41568e41575. [12] A. Small-Howard, N. Morozova, Z. Stoytcheva, E.P. Forry, J.B. Mansell,
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
7
J.W. Harney, B.A. Carlson, X.M. Xu, D.L. Hatfield, M.J. Berry, Supramolecular complexes mediate selenocysteine incorporation in vivo, Mol. Cell Biol. 26 (2006) 2337e2346. E.E. Schmidt, Y. Mahdi, X.-M. Xu, B.A. Carlson, N. Fradejas, P. Günter, D. Braun, E. Southon, L. Tessarollo, D.L. Hatfield, U. Schweizer, Expression of selenoproteins is maintained in mice carrying mutations in SECp43, the tRNA selenocysteine 1 associated protein (Trnau1ap), PLoS One 10 (2015) e0127349. G.V. Kryukov, S. Castellano, S.V. Novoselov, A.V. Lobanov, O. Zehtab, R. Guigo, V.N. Gladyshev, Characterization of mammalian selenoproteomes, Science 300 (2003) 1439e1443. L.V. Papp, J. Lu, A. Holmgren, K.K. Khanna, From selenium to selenoproteins: synthesis, identity, and their role in human health, Antioxidants Redox Signal. 9 (2007) 775e806. J. Lu, A. Holmgren, Selenoproteins, J. Biol. Chem. 284 (2009) 723e727. I. Ingold, M. Aichler, E. Yefremova, A. Roveri, K. Buday, S. Doll, A. Tasdemir, N. Hoffard, W. Wurst, A. Walch, F. Ursini, J.P. Friedmann Angeli, M. Conrad, Expression of a catalytically inactive mutant form of Glutathione peroxidase 4 (Gpx4) confers a dominant-negative effect in male fertility, J. Biol. Chem. 290 (2015) 14668e14678. J. Lu, A. Holmgren, The thioredoxin antioxidant system, Free Radic. Biol. Med. 66 (2014) 75e87. r, Focus on mammalian thioredoxin reductases d important seleE.S.J. Arne noproteins with versatile functions, Biochim. Biophys. Acta Gen. Subj. 1790 (2009) 495e526. J. Kohrle, R. Gartner, Selenium and thyroid, Best Pract. Res. Clin. Endocrinol. Metabol. 23 (2009) 815e827. S. Arbogast, A. Ferreiro, Selenoproteins and protection against oxidative stress: selenoprotein N as a novel player at the crossroads of redox signaling and calcium homeostasis, Antioxidants Redox Signal. 12 (2010) 893e904. C. Lu, F. Qiu, H. Zhou, Y. Peng, W. Hao, J. Xu, J. Yuan, S. Wang, B. Qiang, C. Xu, X. Peng, Identification and characterization of selenoprotein K: an antioxidant in cardiomyocytes, FEBS Lett. 580 (2006) 5189e5197. L. Shen, A. Yang, P. Yao, X. Sun, C. Chen, C. Mo, L. Shi, Y. Chen, Q. Liu, Gadolinium promoted proliferation in mouse embryo fibroblast NIH3T3 cells through Rac and PI3K/Akt signaling pathways, Biometals 27 (2014) 753e762. C. Yang, W. Lim, F.W. Bazer, G. Song, Myricetin suppresses invasion and promotes cell death in human placental choriocarcinoma cells through induction of oxidative stress, Canc. Lett. 399 (2017) 10e19. M. Vatish, L. Tesfa, D. Grammatopoulos, E. Yamada, C.C. Bastie, J.E. Pessin, Inhibition of Akt activity and calcium channel function coordinately drive cellcell fusion in the BeWO choriocarcinoma placental cell line, PLoS One 7 (2012) e29353. Y. Xiao, J. Wang, Y. Chen, K. Zhou, J. Wen, Y. Wang, Y. Zhou, W. Pan, W. Cai, Up-regulation of miR-200b in biliary atresia patients accelerates proliferation and migration of hepatic stallate cells by activating PI3K/Akt signaling, Cell. Signal. 26 (2014) 925e932. C.H. Su, C.Y. Wang, K.H. Lan, C.P. Li, Y. Chao, H.C. Lin, S.D. Lee, W.P. Lee, Akt phosphorylation at Thr308 and Ser473 is required for CHIP-mediated ubiquitination of the kinase, Cell. Signal. 23 (2011) 1824e1830. H.Q. Luo, W.T. Zhong, F.M. Liu, Z.Y. Cui, K.Y. Zhou, X.Y. Li, Construction and identification of the recombinant lentiviral expression vector targeting human BAX inhibitor-1 gene, J buon 18 (2013) 1069e1073. D. Tsikas, Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenges, Anal. Biochem. 524 (2017) 13e30. M.T. Islam, Oxidative stress and mitochondrial dysfunction-linked neurodegenerative disorders, Neurol. Res. 39 (2017) 73e82. F. Ding, P.J. Grabowski, Identification of a protein component of a mammalian tRNA(Sec) complex implicated in the decoding of UGA as selenocysteine, RNA 5 (1999) 1561e1569.
Please cite this article in press as: X. Hu, et al., Knockdown of Trnau1ap inhibits the proliferation and migration of NIH3T3, JEG-3 and Bewo cells via the PI3K/Akt signaling pathway, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.05.065